Upload 1006 files to data/part_2

data/part_2/000b08c62d0ecdda7a36846f124a82bb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"000b08c62d0ecdda7a36846f124a82bb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a2c6744b-4b71-4c6b-bdd6-529929b7597d/retrieve"},"pageCount":33,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":80,"text":"Las leguminosas de grano ocupan un lugar predom.i.nante en la dieta humana. Entre ellas se destaca el fríjol seco (Pbaseolus vulgaris)~ el cual se cultiva en mayor extensión en América l.atina, el Leja..no oriente y Arriea. Estas zonas se caracterizan por presentar defiCiencias en la nutrici6n de sus habitantes. \"Es interesante anQtar. qué en las regiones con menOr consumo de protei'na, el consumo de alimentos de origen aniru.al es tarnbi~n menor; en cambiO, el consumo de leguminosas es mayor\" (9)."},{"index":2,"size":43,"text":"El fríjol constituye, por su ,.lm contenido proteínico (de 18 a 25 por ciento) (2) y por su contenido de calorras (.34Q cal/lOO gramos). una fuente alimenticia que podría contribuir a la soluci6n de los problemas nutricionales en los pafses con bajOS ingresos."},{"index":3,"size":106,"text":"Se podría afirmar que existe una alta deficiencia de proteína animal en la mayoría de las naciones pobres; pero debido al alto costo por kilogramo de esta proteína~ quizás I una posible soluCión seda la de consumir mayor cantidad de proteína leguminosa debido a su costo má.s bajo. Si se compara el precio de la carne con el del frí-Jo1 j se observa que, por ejemplo, el valor de un kilogramo de proteína de carne en 1969 en Bolivia era hasta 47 veces mayor que el de un kilogra.mo de proteínas de frr-j01 y hasta 20 veces más en la mayorfa de los países latinOamericanos (6)."},{"index":4,"size":116,"text":"Este trabajo forma. parte de una serie de estudios básicos para mejorar el conocimiento de los sistemas de prodUCCión del fríjol en Amérlca Latina. La informa-ci6n recolectada en este estudio s6lo refleja la situaci6n del cultivo hasta 1973. cuan-do s~ completó el presente inventario. Esta informaci6n corresponde &. los plincipales aspectos del desarrollo del cultivo del frfjol en América Latina. lo cual podrlá facilitar futuros análisis de prioridades en las políticas agrícolas nacionales, regionales e internacíonales. EspecfHcamente. mediante la recopilací6n de informaci6n estadística v descriptiva. disponible con respecto al (.,'Ultivo, se pretende: 1. Smtetiz,&r la situación del fríjol en los países de América Latina, tratando de identificar semejanzas y diferencias existentes en el desarrollo del cultivo."}]},{"head":"2.","index":2,"paragraphs":[{"index":1,"size":99,"text":"Colaborar en la definiúi6n de ne<:esidades prioritarias para orientar esfuerzos en benef1<.:io del desarrollo del cultivo, En febrero de 1973, se llev6 a cabo en Calí, Colombia, un seminario sobre \"El potenCial del Fríjoly de otras Leguminosas de Grano Comestible en América Latina ll auspiciado por el Centro Internacional de Agrieultura Tropical. En la organizaci6n de este seminario ya se habfa tenido en cuenta la necesidad de realizar una encuesta sobre la situaci6n de las leguminosas de grano en América Latina. con el fin de obtener mformación necesaria para orientar la cooperación internacional que podría ofrecerse a los pafses."},{"index":2,"size":102,"text":"El Instituto Interamericano de Ciencias Agrícolas (UCA) de la Organizaci6n de 10$ Estados Americanos se aperson6 del problema, en base a que en años anteriores habfa realizado encuestas similares €n Centro Amérjca (10). Por medio de su representante oficial en cada pars, el lICA envió cuestionarlos a los diferentes técnlcos na-Cionales, qUienes se reunieron en grupos de trabajo para responderlos (12)~ Los países inclufdos fueron Bra.sil. Colombia, Costa Rica, República Dominicana. El Salvador t Hait.!, Honduras, Nicaragua, Panamá, Paraguay y PeriL Estos paIses han tenido una trayeetoria. conocida como productores de fríjol. No se consigui6 lruormación suficiente pata Méjico. Ecuador y Venezuela."},{"index":3,"size":85,"text":"Las pregtUltas del cuestionario pretendían en su mayor parte buscar la informa-cí6n disponible sobre a.spectos relacionados con el cultivo del fríjol, aunque también aparece alguna inforrnací6n de importancia sobre otra clase de leguminosas de gra.no~ Un primer informe de 105 resultndos de las encuestas sobre la situación de las leguminosas de grano com.estible en América Latina, Be encuentra en la memo:ria del seminario realizado en Cal! (4). Resultó evidente que la mayoría de los países enfocan sus esfuerzos investigatívos hacia la producción del frÍJol oom!ín."},{"index":4,"size":49,"text":"En el mforme se hizo mayor énfasis en el aspecto de la organiZaci6n y el impacto de la investigaci6n sobre el desarrollo de las leguminosas. llegando a la conclusión de que existe una organización inadecuada y mala canalizaci6n de los esfuerzos nacionales en beneficio de la producci6n de fríjol."},{"index":5,"size":42,"text":"El presente trabajo trata de cubrir todos los asp€'ctos evaluados en la enCUesta~ Para ello se recopil6 la información por temas, aoarcando desde la producción, la comercialización y el consumo del fríjol, hasta aspectos de mercadeo internacional, políticas nacionales y situ.ación económica."},{"index":6,"size":95,"text":"La divisi6n del trabajo en temas permite una mejor comprensión de la situa-ci6n. la cual facilita la comparación y establece las semejanzas y desigualdades que existen entre países. Sin embargo. se han encontrado una serie de limit.lciones. algunas de orden estad!stioo t otras debidas a la falta total de información o a informa-ci6n insuficiente. La heterogeneidad de los informantes, la diversidad de fuentes de información y el mismo carácter abierto de la .m.ayoda de las preguntas, ha permitido recopilar amplia información, pero a SU vez ha dificultado el procesamiento y a-n1UisÍ8 de la información recopilada."}]},{"head":"paODUCCION","index":3,"paragraphs":[]},{"head":"Zonas productoras","index":4,"paragraphs":[{"index":1,"size":51,"text":"América Latina es la regi6n que presenta la mayor producci6n de fríjol seco en el mundo con 34 por ciento de la producción mWldial (3.858 millones de toneliLdas por año en promedio) en el período 1968-1971 y cada afio este volumen de participaci6n se ha venido incrementando en forma considerable (9)."},{"index":2,"size":62,"text":"Brasil es el país con mayor producciOn de fr.íjol (Cuadro 1). En 1970. produjo 2.211 millones de toneladas que corresponden El m.d.s. del 50 por ciento de la producción total latinoamericana. Repl1b1ica Dominicana en cambio s6lo contribuyó con 1 por ciento del total (28 mil toneladas en 1971). siendo el país de tnás baja producción entre los anotados en el Cuadro 1."},{"index":3,"size":12,"text":"El rendimiento promedio en América LaUna está alrededor de los 600 kgfha."},{"index":4,"size":64,"text":"Durante 19'11 el más bajo rendimiento correspondi6 a Guatemala con 330 kilogramos, mientras que en El Salvador el rendimiento fue de 865 kilogramos. Es importante ver como existen grandes variaciones de los rendimientos entre países y más aun entre zonas de un mismo país, por ejemplo entre los estados de Minas Gerais (557 kg/ha) Y RI<> Grande do Su! (943 kg/ba) en el Brasil."},{"index":5,"size":227,"text":"Seg(tn la informaci6n recolectada, el frijol en América Latina se produce en su mayor parte en pequeñas parcelas explotadas por los mismos miembros de la familia. En El salvador. el 96 por ciento del área sembrada con fríjol, se encuentra en fincas menores de 5 hectáreas. En Panamá el tamaño promedío de las fincas frjo1eras es de 2,6 hectáreas aproximadamente y en Colombia, el 50 por ciento de las fíncas productoras de fríjol son menores de 7 hectáreas y se encuentran situadas en las laderas de las montañas y dispersas entre las diferentes regiones. En Haití las explotaciones frijoleras tienen una extensión promedio de media hectáree.~ Algunas excepciones a la producci6n en pequeñas parcelas se presentan en ciertas zonas como el Valle del Cauca en Colombia., la. zona de la Costa en el Pero o en la República Dominicana, donde hay explotaciones mayores de 30 hectáreas con sistemas de siembra altamente mecanizados. Aunque es difícil saber exactamente la cantidad de mano de obra involucrada en la producci6n de fríjol, se estima que hay una buena proporción de personas relacionadas directa o indirectamente con los procesos de producci6n y comercialización de esta leguminosa. por ejemplo, se estima. que en Colombia equivale a 0,5 por ciento de la poblac:!6n; mjentras en Costa Rica hay un 3,24 por ciento involucrado 0010 en la producci6n sin incluir la comercializaci6n del producto."},{"index":6,"size":44,"text":"La encuesta buscaba también determinar el rn1mero de fincas frijoleras I pero esta información sólo Se pudo obtener para cuatro países y en forma aproximada: 13.000 en Costa Rica, 17 ~ 684 en El Salvador, 90.500 en Guatemala y 66 .. 000 en Haitr."},{"index":7,"size":162,"text":"Se puede observar la heterogeneidad de las zonas productoras de fr!iol no sólo comparando un para con otro. sino aun dentro de un mismo país o dentro de la misma zona. Las mayores altitudes donde se siembra el fríjol se encuentran localizadas en la Región Andina en el pero) con alturas superiores a los 2.800 m. S. n. m. y en la.s cordilleras colombianas con alturas de 2.600 metros. Las altitudes más bajas donde se siembra el fríjol se registran a nivel del mar en las regiones costeras. CQmo ejemplo de la heterogeneidad de las zonas productoras se presenta la región de la costa peruana, principal zona productora nacional de fríjol común~ donde existen altitudes que oscilan desde el nivel del mar hasta los 600 metros. En Nicaragua. en el interior norte. la wmperab.tra núnima es de 13° e, la máxima de 29\" e ~ manteniéndose un promedio entre 18 y 20\" C. La precipitación oscila entre 800 y L 500 mm/año."},{"index":8,"size":135,"text":"En Costa Rica. en la regi6n de la Meseta Central, se siembra el fríjol a altu-raS de L870 m.s.n.m •• oon temperaturas promedio de 17\"C, y más de 2.500 mm/año de precipitaci6n; mientra.s en la región del Pacífico Seco, al oeste de la Meseta Central, la temperatura llega a más de 21\"C. oon precipitaciones de L 850 mm/año, a una altura casi al nivel del mar. En la vertiente del Atlántico. al este de la Meseta Central, se siembra el frfjol en zonas que sobrepasan los 4.200 tnm/afio de precipitación pluvial. Sin embargo. el (rfJol Be siembra con mayor frecuencia en zonas comprendidas entre 200 y 1.200 metros de altura, correspondiendo por lo general a climas templado-cálidos entre 2Q a 3~ e en promedio. y con una precipitación pluviQmétrica entre 1.000 Y 2. 000 mm/afio."}]},{"head":"Sistemas de siembra","index":5,"paragraphs":[{"index":1,"size":95,"text":"Como consecuencia de la heterogeneídad de 10$ recursos en la producci6n del fríjol se hace notable la diversidad de sistemas de Siembra. ~i se tiene en cuenta otra «erie de inconvenientes, como la mala distribuci6n de lluvias, los problemas de plagas. malezas y enfermedades. entonCes se podrra catalogar el cultivo del fríjol como uno de los que presentan mayores riesgos y que causa mayor incertidumbre en la producción. Es muy posible que el pequeño agricultor latinoamericano sH'mbre 'A lrfJol l'Ü asocíaci6n con otros productos, buscando un uso más ink'fiól\\'u \\le la ti~>rra y del tkmpo*."},{"index":2,"size":67,"text":"Las variedades de fríjol cultivadas en América Latina difieren en cuanto a sus eflracterfsticas externas de color. forma. y tamaño del grano. Predomina por Su frecuencia el fríjol de color rojo {oscuro. opaco. brillante, moteado, veteadQ), el t.>ual Si! siembra en todos los países inchúdos en la encJuesta excepto en Brasil. Perú y Guatemala. U fríjol negro {claro, brillante I opaCO) también tiene gran acogida (Cuadro 2)."},{"index":3,"size":77,"text":"Fn BrasH y Guatemala tiene más acogida el fríjol de color negro o mulatíño¡ sin embargo, t!')l el Perú el frijol es grande, de color amarillo y forma. elíptica. En ottos países, como Colombla j se cultivan fríjoles de todas las clases y colores: rojos como el ICA-guaH o calima; amarillos como el ICA~lUí, de forma ovoide y tamaño mediano; de color crema como el lCA-taroa; negro como el fríjol caraota y combinado como la variedad criolla."},{"index":4,"size":47,"text":"La forma del grano presenta también infinidad de características. siendo las más notables las formas reniforme. o\\'Üide, esférica. aplanada y rectangular~ que se encuentran en tamaño pequeño, mediano y grande. Ciladro 2. Frecuencia del color de las variedades predominantes del fríjol (Phaseolus vulgaris) en algunos parses latinoamericanos."},{"index":5,"size":6,"text":"\"\"\", ~,  ' \" ' \""},{"index":6,"size":43,"text":"' \" Los programas de Economía Agrfcola y Fríjol del CIA T están llevando a cabo un estudio de encuestas para conocer 10$ sistemas de producción de fríjol en Colombia ('\"Estudio Agroecon6mioo del Proceso de Producción de Fríjol IPhaseolu5 vulgaris) en Colombia \")."},{"index":7,"size":68,"text":"la En general, la preparaci6n de la tierra se hace manualmente (oon azad6n) o con arados de tracción animal. Se presentan algunas excepciones como en el caso de la Replfulica Dominica.na, donde un 65 por ciento de los agricultores emplea maquinaria para la preparación del terreno, en Colombia un 10 por ciento y, con menor frecuencia, en ciertas regiones del Brasil, Costa Rica, Guatemala, Honduras, panamá y Pero."},{"index":8,"size":84,"text":"Generalmente, el frijol se siembra en forma asociada o intercalado con otros cultivos, principalmente con ma!z y en menor proporci6n con papa t arracacha, algo-d6n, yuca, café~ caña y tabaco. Es asf como en Colomhla~ el 90 por ciento del fríjol se cultiva asociado o intercalado. En Brasil, la producción asociada representa el 80 por ciento (11); la siembra intercalada del frijol se hace principalmente con cultivos tales como maíz y palma africana y. en menor proporción, con algud60 , yuca, ricino y café."},{"index":9,"size":74,"text":"En Guatemala únícamente el 27 ¡x>r ciento del frijol se produce solo, y el resto generalmente con cultivos establecidos de .maíz. La producción asociada proviene del 55 por ciento de las fincas frljoleras. En Honduras J predol'llina el monocultivo (95 por ciento de ta producci6n); el resto se siembra en asociaci6n príncipalmente con maíz. En Haití y Reptllilica Dominicana la prActica corriente es el monocultivo; muy rara vez se sietnbra. con otros cultivos establecidos."},{"index":10,"size":78,"text":"Las densidades de siembra son muy variables~ aun dentro de las mismas zona.s~ dependiendo de la técnica de siembra usada. Por 10 general fluctuan alrededor de las 200'.000 plantas por hectárea J necesitá.ndose de 30 a 50 kg/ha de semilla en siembra mecanizada y un poco m.is de 40 kg/ha en la siembra manual. El ntimero de granos por sitio puede variar desde dos hasta diez, con un promedio de tres a cuatro granos en la siembra manual."},{"index":11,"size":151,"text":"La rotación, con el fríjol) se lleva a cabo en algunas zonas con cultivos tales como marz, papa, yuca. arroz, sorgo y manf. Sin embargo, en Brasil se prefiere la asociación a la rotación del cultivo de frijol por cuanto, generalmente, las lluvias n.o pe-rmiten la rotación en un mismo aiio~ En algunos países. se hace rotación de cultivos por períodos largos; tal es el caso del Pero donde se hace rotaci6n de maízfrijol-algúdón o arroz-fríjol-arroz por períodos de dos o más años. Ta.mbi~n se acostumbra sembrar el fr:l}ol intercalado con otros cultivos en forma continua en rotaci6n. Las estaciones determinan en Costa Rica el cultivo que se debe sembrar: fri)ol en invierno y cultivos hortrcolas, como el tomate, en verano, bajo irrigaci6na Las fechas de siembra y cosecha difieren ampliamente. debido a las condicionés climáticas de cada zona y por ende se presentan diferentes perlodos vegetativos del cultivo (Cuadro 3)."},{"index":12,"size":88,"text":"Por lo general, todos 10$ parses latinoamericanos, de acuerdo con este estudio, usan poca proporción de semilla certificada; 10 por ciento del área en Colombia, y 3,1 por ciento en Costa Rica~ \"~~adl\"l _~. M~'5 de :->:il'mhra'\" S (\"ost-'cha\"* de algunas zonas produ{:turas de fríjol por parses, Sin embargo) algunos paCses utiUZ3.ll frecuentemente semilla de variedades mejoradas y tratadas~ La práctica más común consiste en utilizar semilla de la OOset:ha anterior. usando prácticas de selecci6n y en algunos casos, un tratamiento protector por ul00io de fungicidas y/o insecticidas."},{"index":13,"size":153,"text":"La cosecha se hace gent,~ralmenre a mano. Si al arrancar el frfjol no se encuentra lo suficientemente seco, en algunas regiones del Brasil. se termina de secar sobre la tierra, en Guatemala empIcan tarimas de madera y en Paraguay 10 hacen al aire libre. Lúego se golpea con palos o a máquina para. desvainado y se limpia manualmente antes de almacenarlo. Generalmente, el fríjol se empaca en sacos de 50 a 60 kilogramos o en barriles herméticamente sellados pan almacenarlo, principalmente si se va a utUízar como semilla. En Honduras. Nioaragua Ji Panamá, acostumbran, de acuerdo al método tradicional, mezclar 3 gramos de Ceniza p:>r cada kilogramo desemilla: y luego almacenarlo herméticamente en tanques de combustible de 55 galones~ En el Perú. cuando el grano va a ser vendido al por mayor I se empaca en sacos de yute de aproximadamente 100 kilogramos o en bolsas de polietileno para la venta a granel."},{"index":14,"size":27,"text":"Según la informaci6n recolectada, la alta susceptibilidad a las enfermedades, a las plagas y competencia por nutrhnienws oon las malezas, parecen ser los mayores problemas del cultivo."},{"index":15,"size":54,"text":"Las condiciones ambientales donde-se siembra el frfjol son muy variables; por lo tanto. el ataque de las enfermedades {Cuadro 4) se manifiesta en diversas formas ~ tanto en intensidad como en sus síntomas. Por ejemplo. la mancha. angular (lsariop:sis ~~ia) causa más daño en las zonas calientes del trópico. que en las zonas templadas."},{"index":16,"size":34,"text":"Las enfermedades de mayor frecuencla~ parecen ser las de origen viral, destacándose el virus del mosaico común del frijol. Se está tratando de combatir las enfermedades virales mediante el empleo de variedades más resistentes."},{"index":17,"size":55,"text":"Indudablemente. la roya (!J'.r.Ornyoes p~~~li val'. típica) es quizás el problema que afecta en mayor porcentaje la producci6n de fríjol en todos los países de América Latina, segdn esta encuesta. Se presenta con ma.yor frecuencia durante las estaciones secas (14)~ La antracnosis (Co!!etotrichum l~emuth.~um) es también un problema de alta frecuencia en Jas zonas frijoleras."},{"index":18,"size":45,"text":"Entre las enfermedades que inducen la pudrici6n de la raíz. cabe destacarse por su frecuencia la pudrición surei'ía o añublo del Sur (Sclerotiuro rolfsi!) , la rhizoctonia-Bis o pudrici6n Rruz.octonía (Rhi~9ctoJ11.ª saInoi}, la fusariosis (Fu~ªriurn spp.) y la marchitez esclerótica o moho blanco (Sclerotinia sc1erotiorum)."},{"index":19,"size":18,"text":"De las en.fermedades bacterianas, quizás la más importante es la bacteriosis o anublo común causada por Xanthom~mas phaseo.M:"},{"index":20,"size":156,"text":"Fr\\'cl.wnna de la::; ~llllt'i:muiadc.-; dd !rrJlJl (!.:_hl!?~•<!:LId\" yy!!gliEl'l::\") uo iI.lgun.Js P¡¡!l><::i <loe Au,(!qca Latm.<I_ Pa(i!ii~.r. '. ---------1 1 -'1 ¡;-  V¡l\"U~ \",VbJllCO {en gellnral).  hay más de 9Q insectos que atacan el frfjúl (1), :-x-gún esta cncu('sta (Cuadro 5), lOb chupadorct'i del follaje y de la vaina parecen spr la pl'i¡:;:a IlHís común, puesto que lOí> doce países qUt' enviaron informaci6n 1OO1ca-!'Un tu prcscnt'ia de l'stOS inlSectos, especialmente de la. chicharrita verde o salta hoja (t',mponsca \"pp_). El segundo lugar por frecuencia en el ataque lo ocupan los comedores del follaje, los cuales se presentan en todos los países liJxcepto en Perú y Haití. Entre l'Stos ln:Sl'ctos son más frecuentes los crisomélidos, especialmente Diabrotica t>pp. y la (~spcc:ie balteata, la cual es más común en regiones con alturas menores de :!. HUO metros (1). EJ escarabajo m(\\jieano del fríjol (Epilachna varivestls) es otro de los com~-dúrcs del foUaje más conocidos y difundidos especialmente en Centro América."},{"index":21,"size":31,"text":"Otras de las plagas más frecuentés en latinoamérica son los gusanos trozado res o ¡jerreros y grillos, dt'stacándose por su frecuencia en el ataque el gusano negro o t'U!>CU ~lÍS spp.)."},{"index":22,"size":81,"text":"Ls importante nolar tambit1n la freeuencia de los insectos que atacan las vainas, pspecialmcnte el cucarr6n o picudo de la vaina (Apl0i! godrnani}. que parece concentrarse más en los paises centroamencanos. A las plagas del grano almacenado 00 se les presta la importancia debida posiblemente por no ocasionar disminución en los rendimientos del cultivo. ~ debe hacer especial referencia. al gorgojo del grano alm.acenado, Bruchus sp., el cual bajo condiciones inadecuadas d€ almacenamiento. disminuye 1\" cantidad jo' la calidad del grano."},{"index":23,"size":46,"text":"L¡lS malezas comunes (Cuadro 6) son muchísimas y variables; es así como se presentan en todos los climas y regiones llegando a competir por luz y nutrimentos con la planta de frfjol., ya que ésta es muy eensible en todas las etapas de Su desa~ 1-rollo."},{"index":24,"size":55,"text":"Cuando la planta de fríjol está aún pequeña, las malezas que crecen rá.pidamente la agobian, impidiendo de esta forma un normal desarrollo del cultivo. ::ii la competencia es mis tardfa~ la maduraci6n irregular del óUltivo puede aumentar los costos de cosecha, ya que el agricultor tiene que realizar esta actividad en dos o más etapae."},{"index":25,"size":146,"text":"Las condiciones y grados de infestación de la.s malezas varían de una zona a otra y aun de un lote a otro dentro de una misma finca. Por esta raz6n s610 se mencionarán aquellas malezas que presentan mayor frecuencia -en las informaciones~ Entre ellas está la familia de las gramfneas (Cuadro filo la cual, de acuerdo con los informes so encuentra en todos los países, excepto en El salvador y Colombia. países que no presentaron informaci6n sobre el tema. Las gramíneas parecen ser la.s más perjudiciales para el cultivo~ distingui~ndose por su frecuencia la pata de gallina o arrocillo (Digitaria sanguinalis). la grama (Cynodon daco/lon). el mozote (Cebchrus echinatus) y la llamada pata de gallina o tres cosechas (Eleusine indica)~ . .  ----------,----------------------,.----------------------   I -< ~ f ¡Q U <3 '\" '\" 11: U U '\" <:) '\" ll: '\" '\" '\" '\" &l el \"a"},{"index":26,"size":44,"text":"x Ix otros problemas que afectan al cultivo del frfjol son las condiciones climatológicas desfavorables y la pobreza del suelo. Si se tiene en cUénta que el fríjol en América Latina I se siembra en pequefi&s fincas carentes de sistemas de riego y drenaje."},{"index":27,"size":121,"text":"se puede comprender la importancia que tiene la distribuci6n del agua de lluvia pa.ra el agricultor frijolero y cómo, muchas vecos, el rendimiento de su cosecha, depende fundaíneute.1mente de ello. Cuando hay exceso de lluvia. vienen los problemas por inundaciones, presentándose un ambiente más propicio para el desarrollo de enfermedades y malezas. Cuando las lluvias se distribuyen irregularmente o en forma escasa. la disminuci6n de los rendimientos se hace notDria* La situaci6n por países es bastante similar; casi todos presentan problemas por eXCeSO o escasez de las lluvias debido á. la mala distribución durante el año. También debe tenerse en cuenta la presencia de heladas ocasionales o bajas temperaturas en algunas zonas del Brasil y en 1& Sierra en el Pero."},{"index":28,"size":80,"text":"Debido. en parte, a la falta de prácticas de conservaci6n, la erosión y baja fertilidad o pObreza de los suelos son considerados como los problemas edafo16gicos más comunes en la mayoría de los paIses. En algunas zonas se presentan situaciones más críticas toda vez que se han sembrado terrenos de topograft:a inadecuada; tal es el caso de algunas regiones de la República Dominicana como San José de ocoa, donde se ha llegado a cultivar el subsuelo y la roca madre."}]},{"head":"COMERCIALlZACION","index":6,"paragraphs":[{"index":1,"size":66,"text":"Los canales de mercado del frCjol Se resumen en las transacciones entre el productor, el intertnediario y el consumidor; sin embargo, los sistemas varían según el país y la zona.. El canal de mercado directo se realiza cuando el productor vende directam.ente al consumidor. Son muy frecuentes los mercados directos donde el agricultor tiene la oportunidad de vender su producto al consum.idor eh el mercado local."},{"index":2,"size":24,"text":"Los canales de mercado indirecto son algo más complejos, ya que en ellos pueden entrar uno o muchos intermediarios en el proceso de comercializaci6n."},{"index":3,"size":33,"text":"Son muy comunes los intermediarios recolectores del grano. ya sea de la empresa privada o de alguna. entidad oficial, quienes compran al productor para a su vez vender a un mayorista o distribuidor."},{"index":4,"size":227,"text":"En algunos países. hay entidades gubernamentales que compran el grano al campesino y lo venden directamenre al cunsumidor, tratando de regular los problemas de especulaci6n, mediante la oferta de precios de sustentaci6n para el productor, garantizándole la \"cnta de fSU cosecha y favoreciendo a su vez al consumidor, quien paga menos por el producto. Ejemplos de estos organismos son el rrrE,MA (Instituto de Mercadeo Agropecuario de Colombia)} cuya intervenci6n en el '\\'Olumen total del comercio es mínima, debidu a la escasez de productos agrfcolas que mantienen los precios altos y a que el mercado sigue en poder de intermediarios mayoristas; el INDECA (Instituto Nacional de Comercialización Agrrcola de Guatemala), también de baja intervenci6n por la abundancia de los intermediarios privados, el Banco Nacional de Fomento en Honduras, que cuenta con silos suficientes para comprar a los agricultores e mtermediarios directamente; el IFE (InstituID de Fomento Económico en Panamá), el cual almacena. y vende a los minoristas según la demanda lo vaya exigiendo; EPSA (EmpreSA PúWica de Servicios Agropecuarios en Perú), la cual interviene en el mercado como un comprador mlis. comercíalízaooo luego el prwucto a través de su cadena de supermercados y puestos reguladores; el lNESPRE (Instituto de Estabilizaci6n de Precios en la República Dominicana) I el cual compra 16,7 por ciento de la producci6n nacional por ley y vende al detallista y a los almacenes mayoristas."},{"index":5,"size":142,"text":"El precio de venta de los íríjoles depende de muchos factores entre ellos la variedad y calidad del grano, los cuales repercuten en la oferta y la demanda en el mercado. El cará.cter estacional de las cosechas hace que se presenten muchas fluctuaciones en los precios. Algunos países llevan control de precios como en el Perú para el fríjol canario (US $ O .32/kg durante todos los meses de 1972). En Costa Rica. el Consejo Nacional de Producci6n (CNP) fija los precios mínímos anres del pe-1'[(><10 de producci6n aunque, según la información obtenida, si bien es cíerto que los precios de sustentaci6n han aumentado en forma consíderable, el aumento no ha sido suficiente como para estimular a los grandes agricultores a incremental' Su producción; por otra parte. tampoco se han creado incentivos para que otros agricultores entren al proceso productivo del fríjol."},{"index":6,"size":154,"text":"El almacenamiento eS una. de las medidas que favorece al mercado, controlando las t1uctuaciones de los precios y permitiendo la disponibilidad de alimentos durante cierro perfbdo de tiempo. Generalmente, según la imormaci6n suministrada en las encuestas. el frrjol se almacena por perrodos menores de seis meses. con Wla humedad entre 10 y 15 por ciento. aunque algunos países (Paraná, Brasil) 10 almacenan durante se ls 6 doce meses en sacos o al granel en condiciones generalmente precarias. En la mayoría de los países, no se dispone de silos especiales para fríjoles y estos son almacenados junto con otros granos (principalmente maI'z y arroz); tal es el ca.so de la República Dominicana donde INESPRE (Instituto de Estabilización de Precios) cuenta con capacidad para almacenar 5.000 toneladas de granos. Sin embargo, el almacenamieniD es poco con relación al volumen total producido. Generalmente no existe control de temperatura ni de humedad, aunque si son frecuentes las fumigaciones."},{"index":7,"size":73,"text":"Es difícil conseguir o estimar datos exactos sobre pérdidas del grano un el pro-ceSO de almacemuniento y comercializa.ción; sin embargo? se estima que en Costa Rica, Guatemala y el estado de Ceará en Brasil, ascienden al tres por ciento de la producción total de fríjol. En la República !xHninicana corresponden, aproximadamente, al cinco por ciento~ en tanto que en Honduras y en PanamA. alcanzan proporciones más considerables, 10 y 12 por ciento, rCb-pcctivamente."}]},{"head":"CONSUMO","index":7,"paragraphs":[{"index":1,"size":105,"text":"En el Cuadro 7 se indica la importancia del fríjol como fuente de protefuas para algunos países. El frrjol~ por lo general, se consume en América La.tina cuando el grano está seco o en vaina verde y en algunos paIses como Colombia, Perú y Haitf. también se consume el grano verde. Es importante anotar como un alto porcentaje (más del 85 por ciento en promediO) de la pJ:Oducci6n de fríjol es destinado al consumo humano. quedando muy poco para la alimentaoión &flim,al. Según esta informaci6n, Brasil es el pars con mayor consumo (25 kg/pel'80na/año), seguido por Guatemala con un promedio de 19.09 1<g/persona/año en 1972."},{"index":2,"size":106,"text":"El consumo de la zona rural es siempre mayor que el de la zona urbana, a ex-cepci6n de Haití, donde el consumo rural, de 1971 a 1972_ fué de 4,68 kg/persona/año y el urbano 12,48 kg/persona/año. En cuanto su importancia como fuente de proteínas. el fríjol ocupa el primer lugar en Brasil~ Costa. Rica, El Salyador y Honduras. se trata, a su vez. de un producto de consumo básico para las clases menos favorecidas econ6micamente y para la dieta del pequeño agriculror. Cuadro 7. Importancia del grano como fuente de proteínas J consumo per cápita y disponibilidad nacional de frijol para algunos países de América Latina "}]},{"head":"Zl","index":8,"paragraphs":[{"index":1,"size":27,"text":"El lISO del grano para industria.lización Be considera mínimo pero\" por carecer-8€ de datos, serra difIcil indicar el porcentaje de la disponibilidad l1&Cional dedicado a cstk fin\"'."}]},{"head":"COMF RCIO EXTERIOR","index":9,"paragraphs":[{"index":1,"size":32,"text":"Dada la poca informaci6n y diversidad de datos de la encuesta sobre el comercio i.nternacional del frfjol, es muy diffcil lograr una clasificaci6n exacta sobre los pafses que COmercian con este grano."},{"index":2,"size":119,"text":"Un pars puede ser a la vez importador y exportador de frijol en un mismo año o tener variaciones y fluctuaciones a través del tiempo. POr esta razón, ser!a más COnveniente anotar cuales han sido los parses que han tenido cierta tendencia a exportar. a importar o a autoabastecerse {9}* Entre los pafses exportadores se destaca Honduras que en 1969 exportó 21.875 toneladas, aunque en 1911 sus exportaciones desoondieron en un 50 por ciento. Nicaragua exporta principalmente a Costa Rlea y a El salvador. En 1969, export6 4.664 toneladas (10 por ciento de su producción, aproximadamente) y 5.962 toneladas en el año siguiente. Sin embargo. también ha realizado importaciones en memr cuantib. de Hoeduras y algunos otros países centroamericanos."},{"index":3,"size":36,"text":"Guatemala realiza sus exportaciones a El Salvador, especialmente. aunque su comercio exterior no. es de mayor cuantfa: 3.074 toneladas exportadas en 1910 y 2.655 toneladas importadas el mismo año, provenientes en su mayor parte de Honduras."},{"index":4,"size":148,"text":"El alto consumo per cápita de Brasil y la importancia que tiene el frijol como fuente de proteína en este país, hace que la producción nacional .sea prácticamente autoconsumida y haya sido necesaria la importación de fríjol en años anteriores. Sin embargo, a partir de 1967 las importaciones (11.160 toneladas) han venido disminuyendo considerablemente (1.325 toneladas en 1969). Al misr.ao tiempo ocurre el fen6meno contrario con las exportaciones (2.234 toneladas exportadas en 1967 y a 17.855 toneladas en 1969). Dada la gran extensi6n del territorio brasilero, puede decirse que el comercio se realiza casi en su totalidad entre los mismos estados. Asr, por ejemplo, Gafas exporta el 70 por ciento de su producción a otros estados como Sao Pawl), Guanabara y Minas Geraís. El Comercio internacional de Brasil se realiza princIpalmente con México, Argentina y Cbile de quienes importa. Exporta en meoor cuantía a otros paf'ses de latinoarnérica."},{"index":5,"size":39,"text":"Colombia, tiene tendencía a impOrtar fríjol rojo y realiza exportaciones esporádicas de fríjol negro. ya que éste último es poco apetecido para e1 consumo interno Las expo rtaciones de fríjol negro las hace principalmente a Venezuela y Costa Rica."},{"index":6,"size":59,"text":"Como Costa Rica disrninúy6 su rroduccí6n de fríjol en el período 1964-1968 a raz6n del 12 por ciento anual y al mismo tiem¡x> su población aumentó a una tasa de ;}.85 por ciento (6), vino la necesidad de cubrir la demanda interna recurriendo a , Para una mayol\" discusi6n sobre consumo de frfjol ver las publicaciones (9) y (13)."},{"index":7,"size":42,"text":"ro !'\\k'aragua, el fríjol además de ser un alimento popular tiene una gran im-pt>t'w,mcia en la proouccí6n agrícola; así. el promedio anual de 1968-1970 fue de 56.-1:30 toneladas, lo (:ual lo coluca en 8t:Xto lugar. en t6rmi.nos de valor de la produc-Ción."},{"index":8,"size":44,"text":"En W71, P(' tÍ! produjo -1:1. UB3 toneladas de fríjol para un valor de 9'426. 204 d6~ bn's. ::;i se (:ompara el \"ralo!.\" de la producción de fríjol con el valor total de la pro-OO<.:(.'10n de leguminosas, el fríjol representa el 60 por ciento."},{"index":9,"size":62,"text":"En Costa Rica, El Salvador, Nicaragua y Colombia, el trfjol ocupa un lugar ÍJl-ÍL'rmt>dio; mientra;;; que en países {.'Qmo Panamá y Paraguay tiene poca importancia ecunómica. Sin embargo, regionalrnentc, el frejol puede llegar a ocupar un lugar de gran importancia como es el casO de la zona del Oríente Antioqueño y del Sur del Huila. t'n Colombia y Minas Gerais, en Brasil."},{"index":10,"size":45,"text":"POLlT¡CAo PARA léHIMULAR y MEJORAR LA PRODUCCION Segdn la información obtenida por la encuesta (Cuadro 8}. las políticas nacionales promulgadas con mayor frecuencia por IQS pafses con el objeto de estimular y r.nejoral' la producci6n son principalmente: investigación, asistencia técnica, producclón de semillas y crédito."},{"index":11,"size":110,"text":"En algunos países. se han desarrollado otra serie de poUticas. que aunque no tienen por objeto exclusivamente benefiCiar al productor frijolero. si redundan en su provecho. Tal es el caso, en Colombia; del fríjol de exportaci6n, el cual tenía un 15 por ciento en certificado de abono tributario que servfa ti la vez como incentivo para. el exportado r y como herramienta del gobierno para aumentar sus exportaciones. En Costa Rica, el Consejo Nacional de producci6n (CNP) emplea el sistema de avales. el cual consiste en un mecanismo de financiación donde el CNP actúa como fiador de los agricultores ante los bancos comerciales.     • No hay información en la encuesta."},{"index":12,"size":37,"text":"La polItica de mercadeo ha sido anotada en las encuestas como un estímulo a la producción, por países como BrasU. Colombia y Paraguay. El mercadeo consiste, en este caso, en el almacenamiento, beneficio y venta del grano."},{"index":13,"size":44,"text":"Respecto a la. investigación, se podría decir que en la mayoría de los países no existe un programa específico destinado a promover el cultivo del frfjol. Sin embargo, casi todos cuentan con programas nacionales agropecuarios que incluyen el fríjol en sus planes de investigación."},{"index":14,"size":82,"text":"En la mayoría de los casos. la investigaci6n es realizada por Institutos Gubernamentales como = ministerios de agricultura. secretarías de agricultura o uro ver sidades. También colaboran entidades internacionales como el Instituto Interamericano de Ciencias Agrfcolas (IlCA) en el caso de Costa Rica, el Centro Internacional de Agricultura Tropical {CIAT) en Colombia y programas regionales, como el Programa Común Centroamericano para el Mejoramiento de Cultivos Alimenticios (PCCMCA) en Centro América. Los bancos y otras entidades particulares también prestan colabora-ci6n en algunos parses."},{"index":15,"size":33,"text":"Es importante anotar que en Honduras existe un programa Nacional de Granos Básic061 que dispone de recursos de investigación específicamente para el fríjol. Costa Rica también cuenta con un Plan Nacional de Fríjol."},{"index":16,"size":11,"text":"En Pero y Colombia. existen programas nacionales para leguminosas en general."},{"index":17,"size":13,"text":"En Guatemala hay \\lll programa. nacional para el fomento y mejoramiento del grano."},{"index":18,"size":150,"text":"Según concepto anotado por los informantes. se puede decir que no existe una institución dedicada específicamente a producir semilla. y si la hay lo hace en lUla prop:¡rci6n muy baja con respecto al 'rea s€mbrada. En Colombia, el 13 por ciento de la semilla es certificada y es producida por entidades gubernamentales ~'Omo eRE-SEMILLAS Y por otras particulares. Esta semilla es certificada por el Instituto Colombiano Agropecuario. En Costa Rica, el 7,4 por ciento de la producci6n nacional de semillases certificada, aunque debe anotarse que 00 es muy estricta la certifica-ci6n realizada por e1 Ministerio de Agricultura I según concepto de la encuesta. La producción de semilla certificada en Guatemala en 1972 por el Ministerio de Agricultura fue de 22 toneladas. La Productora Nacional de semillas de lA República Dominicana produjo. en 1969, 27,3 toneladas. que representan solamente el MO por ciento del total de semilla sembrada en el país."},{"index":19,"size":82,"text":"En Brasil, a pesar de existir un comercio reglamentado para el mercadeo de semillas t so produce s610 semilla mejorada pero no certificada. En Honduras, la Direc-ci6n General de Desarrollo produce 695 kg/ailo de semilla mejorada. En perú, no está reglamentado el control de la calidad de la semilla, ni se produce semilla certificada; no obstante, en este pars, el Minist~rio de Agricultura fomenta la producción o venla de semilla, permitiendo a los agricultores almacenar su propia semilla en silos d~l Ministerio."},{"index":20,"size":75,"text":"t:stas dos polrticas, investigación y producci6n de semillas, tienen algo en común: los recursos destinados a promover el cultivo del fríjol son muy limitados. Por una parte, no se Cuenta con suficiente personal chmt:lTico capacitado para llevár a cabo las inve-stip;aciones. Por la otra, aun cuando es una necesIdad sentida¡ no ha recibido el respaldo necesario, pues la cantídad de semilla producida por entidades especiali-:-~ádas es rclatlvamcntc poca y su (~alidad deja mucho que desear."},{"index":21,"size":18,"text":"Otra polftic'a importante es la asistencia técnica, que generalmente va acompafiada de otras polfiicas sobre crédito y/o precios."},{"index":22,"size":58,"text":"Es conven.iente aclarar que la aplicación de las polfticas ü incluso las miSmas poifticas de incentivos pueden variar dentro de un mismo pafs. Tomemos el Brasil como ejemplo; mientras en el E stado de Gúfas cuentan Con varias políticas de estfmulo, en el E stado de Pará se indica que no existen polfUcas directas de beneficio al grano."}]},{"head":"PROBLEMAS Y ESTRATEGIAS PROPUESTAS","index":10,"paragraphs":[{"index":1,"size":75,"text":"Según las indicaciones suministradas por los informantes y en orden prioritario, los principales problemas SOn: la precipitación pluvial (exceso, deficiencia o mala dis-tribuci6n). la presencia de enfermedades, la ineficiencia de los sistemas de comercia-lizaci6n (Cuadro 9), el almacenamiento deficiente, los precios bajos e inestables del producto, el alto oosto de los insumos y la fa1ta de medios de transporte. Cuadro 9. Frecuencia de los problemas del cultivo de fríjo1 en a.lgunos pafses de América Latina."},{"index":2,"size":20,"text":"'\" ~ ..l!! ..  No se dispone de informaciÓn sobre Costa Rica, El salvador, Honduras t Haití, Nicaragua y Panamá."},{"index":3,"size":229,"text":"La principal justificaci6n para los programas de fomento () mejoramiento del cultivo de frrjol, de acuerdo Cón la informaci6n de los diferentes técnicos nacionales t fue la importancia del grano en la dieta alimenticia, por su alto contenido proteínico y por ser base de la nutrlci6n de las clases menOS favorecidas~ También se adujo el aspecto econ6ínicO, como el control de la fuga de divisas al reducir las importaciones, y su potencial como fuente de ingresos al fomentar su exportación, lo cual ~neficiaría además a las clases más necesitadas~ Todos los países, excepto Costa Rica~ comunicaron SU aprobaci6n con relación al fomento de la especie Phaseolus vulgaris. El mutismo de Costa Rica pudiera deberse a que sus costos de producción son los más altos de Centro América (según la encuesta), motivo por el cual los productores nacionales no puedan competir en precio con los fríjoles importados de los países vecinos .. Entre las estrategias propuestas para el fomento de la producci6n del fríjol (Cuadro 10) f:úw gran acogida la necesidad de adiestrar personal tanto técnico romo cientlfico para trabajar en los diferentes programas nacionales. La comunicación e intercambio de i.nformaci6n se anot6 también como importante I ya que esto permite ahorrar esfuerzos en la investiga.cí6n. Ae! mismo. se indicó la necesidad de insistir más sobre los programas de producción de semillas mejoradas, crédito e investiga-ci6n. ,;: i ..  i:"},{"index":4,"size":12,"text":"' \"' ::J g :n  * No hay informaci6n en la encuesta.."}]},{"head":"Z7","index":11,"paragraphs":[{"index":1,"size":108,"text":"RESl:MEN y CONCLlNONES H frf.¡'J! t:S un~ fuente de riqueza nuh'jejúnal quE' pvdría contribuir con mayor 10-tCll.:o;idad a la soluci6n de los problemas alimenticios de América Latina. &; cultiva por 10 general en pequeñas parcelas explotadas pór los miembros de la familia. La produc-oi6n SI:.' genera. principalmente en siembras asociadas e intercaladas con Qtros cultivos, destacándose el maíz como el más frecuente. Por lo menos un 85 por ciento del área destinada a fríjol se siembra <'On semilla proveniente de la misma finca. La prepara-ci6n de la tierra se hace en forma manual o Con arados de tracci6n animal, siendo pocas las excepciones en dondt: Se usa maquinaria."},{"index":2,"size":85,"text":"El beneficio del cultivo se hace en forma rudimentaria, se cosecha a mano y luego se golpea con palo);> o en algunos pocos casos se utiliza la maquinaria, El almacenamiento se efectúa por períodos menores de seis meses y generalmente no hay control de temperatura ni de humedada Debido a las malas condiciones del almacenamiento en la finca, ocu\"rren pérdidas apreciables del grano. Se estima que la capacidad de almacenamiento es muy iX\"ca con relación al volumen total de fríjol producido en todos los países."},{"index":3,"size":26,"text":"Los nU1Y9res problemas del cultivo parecen ser la mala distribución de las lluvias, la. ineficiencia de los sistemas de comercialización y la. incidencia de las enfermedades."},{"index":4,"size":43,"text":"Las enfermedades que afectan en mayor porcentaje la producción en los países latinoamericanos son la roya y en segundo término la antracnosis. Las plagas clasificadas como de mayor frecuencia en la encuesta son: la chicharrita, los crisomélidos y los gusanos trozádores o Herreros."},{"index":5,"size":20,"text":"Existe una gran diversidad de malezas que compite con el irfjol destacándose las gramíneas y las familias Convolvulaceae y Nycta.ginacea.e."},{"index":6,"size":67,"text":"Con respecto al mercadeo del fríjol, se debe anotar la existencia de algu,nas entidades gubernamentales que buscan regularlo en los parses estudiados, pero parece ser que su intervenCi6n no ha sido 10 suficientemente efectiva para lograr sus objetivos. Por lo general. se presentan muchas variaciones en 10$ precios. notándose ciertas disminuciones en los períodos de cosecha~ El comercio internacional es poco en relaci6n al volumen de producci6n."},{"index":7,"size":55,"text":"En la mayoría de los paIses los recursos asignados para la investigación y la \\;'xtensión del fríjol han sido muy bajos. La política de producción de semilla, allilque existe en mayor o menor grado -en todos los parses I no tiene un impacto notorio debido a la poca disponibilidad de recursos destinados a este (ín."}]},{"head":"l8","index":12,"paragraphs":[{"index":1,"size":81,"text":"Entre las estrategias presentadas por 106 diferentes técnicos tuvo gran acogida la necesidad• de crear o reestntcturar los organismos o programas nacionales y que estos sean los encargados de coordinar e impulsar las diversas entidades ejecutoras del fomento y mcjor:amienm de la producción~ Se indic6 asf mismo, la necesidad de adiestrar personal para mejorar In in-vestigaci6n tratando de desarrollar programas de colaooraci6n a nivel internacÍonal. como también adelantar una campaña de información y de correspondencia entre técnicos de los distintos pafses."},{"index":2,"size":27,"text":"La necesidad de c~ita1 para financiar el cultivo se refleja en la sugerencia de los informantes de íncrementar el crédito junto con una poUtica de asistencia técnica."},{"index":3,"size":40,"text":"A su vez. los autores del presente trabajo recomiendan emprender estudios a nivel de la fínea, con el Un de determinar la participaci6n del frijol como fuente de ingreso! de nutrici6n y su contribución al empleo de mano de obra."},{"index":4,"size":33,"text":"Debería estudiarse con m.ayor precisi6-n cuáles son las polIticas con mayores posibilidades de beneficiar más eficientemente a los agricultures y consumidores y que a la vez contribuyan al incl'eItlento de la producci6n .."}]}],"figures":[{"text":" SITUACION DEL CULTIVO DEL l\"RLlOL EN AMERICA LATINA uriel Gutiérrez P. * Mario Infante ** Antonio Pinchinat**'\" "},{"text":" !l Xl I \" '~ 13 \"-Color ~ S \" § . • ~ :¡j..    "},{"text":" ;)s. Pe rna moueu y Rio Ca--ande I "},{"text":"1 :Además !lFte aérea. Ongen ¡u~ 1, Y~n:Y~~ PEMcol! v!>r, tWiCa 'f'hali8tephurus ,,~Sl_u!:!! §!}~ (~.I}l?gc~1!!fcro¡;cle!:2.~ t.!lll (~~b_~_(~-I~'~II) , \"'l!US't;.trtyhum l!1t!.!!,:!uu.-tl1l11~ . '~~~\",\"~'~ ~\"'''\"'''''n nias~s, pudredumbre ri'dit-'Ular, pucU'ldao da flllZ, da raIz, {u¡.¡arlú,.¡H, x I x Mal del talhwm, mJlrchitez, fudel frfjol, ca-hUIXUil. f('rnlgeo. nwt, Nuük. Mancha rulacoon, rourcha-(\\/ltela-nuceÍle.a, web b4ght. ntW\"till hHach;)J3I1. añuhlv ll..ntcH!Q.o. AntraCnW>I8. ¡m.tr&CtlUM~, ¡u¡thra-coo}Jf1. u~ ... \" .... \" ........ I .. r..l\" 1 .. \"\"\",,. \"'''''' Pornambuco, 1'1Irluba Ji lhO Grande do Norte. "},{"text":")',! 1 \" ,ólll•U ;;ofrug~d,,\" .'~tlnw (¡lit' en Amérü.'[l Latina. "},{"text":"Cuadro 5 . Frecuencia de las plagas del ir'¡ol <rhaseolus Maria) en algunos países de A~ríca Latina\" ~ - "},{"text":"<~~! B 8 ~ 8 ! g ~ t. §':!.;:¡ 'e ~ '\" ' <g '¡l ~ !'l i S :; ~ :; ~~ ~ \"'~:ª B1l. ~ 8 8 ¡;j ó :! ~ z o. g, ~&!8~8. "},{"text":" ......... ~~~~~--- "},{"text":"2 * Además Río Grande do Norte.Las familias Com'ol vul~ceae y Nyctaginaceae presentan también una frecuencia relativamente alta, destacándose la grama comwlista o batatilla ~ tiliacea) dentro de las primeras y la verdolaga (Boertiaavia coccineae) dentro de las segundas. "},{"text":" se dispone de informaci6n $uJiciente sobre Colombia, Haitr, Paraguay y Perú. "},{"text":"Cuadro 8 .~ Polftieas nacionales para estimular y mejorar la producción de fríjol (1971). iil ¡¡ \"iI \" é' .    "},{"text":" .. \",8 ~ . . "},{"text":".. 8 o 8 oí! ~ .¡: .*8 .. s. "},{"text":"Cuadro 10 . Estrategias propuestas para el fomento de la producci6n de fríjoL • .. k .. ~ .;1 "},{"text":" .;: k o. \"k k o -S ~ ~ .. .. Q) .!lB ¡:;8.    "},{"text":"Cuadru 1 . Superficje. producción y rendimiento de las principales zonas productoras de fríjol por paises (lD71}~ !';'lfs Zonas productora ~\\lperficie (ha) Ptoducúi6n Rendimiento (ton) (kg/ha) !';'lfsZonas productora~\\lperficie (ha)Ptoducúi6n Rendimiento (ton) (kg/ha) Bra~nl 1< Paraná 790.139 729.GU5 9tH Bra~nl 1<Paraná790.139729.GU59tH  Minas f'& 1'a15 517.609 288.094 Zl5? Minas f'& 1'a15517.609288.094Zl5?  Rio Grande do Sul 259.767 2\"15.031 9.;1 Rio Grande do Sul259.7672\"15.0319.;1  BaMa 212.306 172.069  BaMa212.306172.069  :Sao paulo <!50.150 160.595  :Sao paulo<!50.150160.595  Goías 168.588 115.157  Goías168.588115.157  Total par\" 31484~ 77.3 21211.449  Total par\"31484~ 77.321211.449 Colombia Antioquia 18.270 10.300  ColombiaAntioquia18.27010.300  Narllo 9.920 6.300  Narllo9.9206.300  HUlla 9.740 5.415  HUlla9.7405.415  Valle del Cauca 3.568 3.4Ü5 95•! Valle del Cauca3.5683.4Ü595•!  Total país 68.000 39.000  Total país68.00039.000 El :.alvador Central 23.600 21.500  El :.alvadorCentral23.60021.500  Occidental 11.100 9.500  Occidental11.1009.500  Oriental 5.200 3.500  Oriental5.2003.500  Total pars 39.900 34.500  Total pars39.90034.500 Guatemala Oriental 34.831 13.948  GuatemalaOriental34.83113.948  Nor-Occidental 48.355 10.414  Nor-Occidental48.35510.414  Norte 14.359 7.955  Norte14.3597.955  Nor-Orienta.l 29.266 7.197  Nor-Orienta.l29.2667.197  Total país 185.269 61.154  Total país185.26961.154 Honduras Total 72.700 55.400  HondurasTotal72.70055.400 Nicaragua** Central 38.284 28.389  Nicaragua**Central38.28428.389  Pac1Iico 15.803 11.409  Pac1Iico15.80311.409  Atlántico 5.548 4.245  Atlántico5.5484.245  Total país 60.750 47.993  Total país60.75047.993 República Santiago de los Caballeros 11.563 10.511  RepúblicaSantiago de los Caballeros11.56310.511 Dominicana San Juan de A1aguana 10.687 12.440 1.164 DominicanaSan Juan de A1aguana10.68712.4401.164  Migue)' 3.750 3.409  Migue)'3.7503.409  Ocoa 3.750 3.409  Ocoa3.7503.409  ~an Francisco de Macoris 3.125 2.838  ~an Francisco de Macoris3.1252.838  Total pars 37.500 28.125  Total pars37.50028.125  "}],"sieverID":"f1781781-5c41-4a55-90d9-7b2e3313a468","abstract":""}

data/part_2/0096ea10e82bd0d171bdfc8859e29f07.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0096ea10e82bd0d171bdfc8859e29f07","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e6576703-f6b5-4d82-bb81-9f210be7df54/retrieve"},"pageCount":83,"title":"CGIAR Research Program on Livestock and Fish 2015 Performance Monitoring Report","keywords":["CIAT","ICARDA","WorldFish","Non-CGIAR partners: SLU"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":249,"text":"A.2 Two most significant achievements/success stories Genetics of small ruminant adaptation to hot arid environments A significant step was achieved in understanding how genomic selection might be applied to breeding goats and sheep suitable for hot arid environments. In partnership with scientists from Animal Production Research Institute (Egypt), Iowa State University (USA) and Virginia State University (USA), ICARDA scientists investigated genomic signatures of natural selection for adaptation to hot arid environments. Barki goats and sheep well adapted to the dry Coastal Zone of the Western Desert in Egypt were compared against five exotic breeds of goats and three of sheep originating from temperate regions and thus poorly adapted to hot drylands. The latest genome-wide scan technique was applied and several candidate genomic regions under positive selection were identified. Several of these candidate regions spanned genes that influenced traits related to adaptation to hot arid environments such as thermo-tolerance, energy and digestive metabolism, as well as autoimmune response. Through comparative genome-wide mapping, the study also identified eight common candidate genes under selection in the two species and a shared selection signature that spanned a conserved syntenic segment to bovine chromosome 12 on caprine chromosome 12 and ovine chromosome 10 respectively. The results were published in Heredity and selected for the Heredity Podcast. The results set the basis for further studies to understand and exploit the mechanisms of adaptation to hot arid environments and highlight the potential of indigenous breeds as the genetic resources of choice to mitigate against climate change."},{"index":2,"size":121,"text":"Towards improved vaccines for mycoplasma diseases Contagious bovine pleuropneumonia (CBPP) and contagious caprine pleuropneumonia are major livestock diseases in developing countries caused by mycoplasma. ILRI scientists with collaborators from the French National Institute of Agricultural Research (INRA) and the University of Bern (Switzerland) used state-of-the-art synthetic genomics tools to engineer and phenotype a Mycoplasma mycoides capri strain which lacks the terminal gene in the galactofuranose synthesis pathway. The new mutant genome was engineered within yeast as an intermediate host and genome transplantation was used to generate the mutant Mycoplasma strain. The established technologies are being deployed to identify potential subunit vaccine targets. This work is a significant and exciting step towards creation of an improved live attenuated vaccine for mycoplasma diseases."}]},{"head":"A.3 Financial summary","index":2,"paragraphs":[{"index":1,"size":30,"text":"The program executed USD 28.5 million (80% overall; 92% of W1/2 versus 70% of W3/bilateral) of the total 2015 USD 35.8 million budget. Gender research accounted for 10% of expenditures."}]},{"head":"B. Impact pathways and intermediate development outcomes (IDOs)","index":3,"paragraphs":[{"index":1,"size":161,"text":"The overall program impact pathway and theory of change is described in the program's Results Strategy Framework and Intermediate Development Outcomes (IDOs) (v.3) (http://livestock-fish.wikispaces.com/IDO) and summarized in the program's 2015-2016 extension proposal. The six IDOs adopted by the program are: IDO1-Increased livestock and fish productivity in small-scale production systems for the target commodities; IDO2-Increased quantity and improved quality of the target commodity supplied from the target small-scale production and marketing systems; IDO3-Increased employment and income for low-income actors in the target value chains, with an increased share of employment opportunities for and income controlled by low-income women; IDO4-Increased consumption of the target commodity responsible for filling a larger share of the nutrient gap for the poor, particularly for nutritionally vulnerable populations (women of reproductive age and young children); IDO5-Lower environmental impacts in the target value chains; IDO6-Policies (including investments) support the development of the small-scale production and marketing systems, and seek to increase the participation of women within these value chains."},{"index":2,"size":155,"text":"Indicators for the IDOs and methodology for estimating their target and actual values are described in an IDO Indicator Manual. The program IDOs have been maintained here for consistency; with the adoption of the new CGIAR Strategy and Results Framework 2016-2030, a revised, standard set of IDOs and sub-IDOs has been introduced, so it is anticipated that the indicators and methodology for their estimation will need to be revised. Work continued in 2015 to define how the monitoring and evaluation framework will be operationalized in practice, including the appropriate use of benchmarking, baselines and dedicated data collection. To date, the program is relying on situation analyses for the selected value chain countries that describe a range of indicators of the current status of the target pro-poor value chain based largely on secondary data in the public domain. More detailed baseline information is being collected as bilateral projects are funded and implemented in each value chain."}]},{"head":"C. Progress along the impact pathways","index":4,"paragraphs":[{"index":1,"size":27,"text":"The following summaries are derived from detailed annual reports by value chain and CGIAR center, and synthesis reports by program flagships; they can be accessed at: http://livestock-fish.wikispaces.com/2015_AnnualReports."}]},{"head":"C.1 Progress towards outputs","index":5,"paragraphs":[{"index":1,"size":86,"text":"For the extension period 2015-2016, the program was restructured from six themes to five flagships, three of which support the principal technology drivers of productivity and intensification in livestock and aquaculture systems: animal health, animal genetics, and feeds and forages. The other two flagships (systems analysis for sustainable innovation and value chain transformation and scaling) apply a combination of relevant biological and social science to address key dimensions associated with pro-poor value chain development and intensification and ensure more effective agricultural research-for-development that translates into impact."},{"index":2,"size":30,"text":"Flagship 1-Animal health: This flagship generates data and materials for solutions to improve the pro-poor management of animal health and food safety in the selected value chains and more generally."},{"index":3,"size":304,"text":"A first cluster of activities assesses productivity constraints imposed by disease to inform prioritization. The delay in work on this agenda was resolved with new dedicated capacity on livestock and fish health at ILRI and WorldFish, strengthening the flagship's engagement in the target value chains. Research on emerging diseases in farmed fish is becoming a priority. In collaboration with Merck Lab Singapore and Bangladesh Fisheries Research Institute, Streptococcus agalactiae biotype 1 was identified as the main cause of streptococcosis in Tilapia in ponds and cages in Bangladesh, prompting initiation of a cross-sectional epidemiological study. Initial fish health scoping and diagnostic studies by ILRI and Merck identified Aeromonas veronii as a possible factor in significant summer mortality that has emerged on tilapia fish farms in Egypt, and are serving as the basis for in-depth histopathologic and epidemiological studies. The CGIAR Research Program on Agriculture for Nutrition and Health (A4NH) contributed complementary results establishing that Egyptian farmed fish is safe from the point of view of chemical contamination but could be unsafe because of spoilage caused by poor post-harvest handling. In Uganda, initial characterization of the pig disease situation has led to a focus on improving biosafety in the value chain. Key outputs were publications characterizing the pig value chain, results and tools for participatory risk assessment of African swine fever and assessing knowledge, attitudes, practices, capacities and incentives (KAPCI) for its control through biosecurity among pig producers, traders, butchers, input suppliers and extension workers. A study on the socio-cultural factors and gender dimensions in pig management and biosecurity identified factors that govern the level of adoption and application of biosecurity measures at farm level, such as the perception of some farmer communities that throwing away the animal carcasses is a waste of food, or the taboo for some communities associated with burying a dead animal."},{"index":4,"size":170,"text":"The program's new epidemiology capacity has raised the profile of the flagship's second cluster on animal population health. In Ethiopia, health issues for rams in community-based breeding programs (CBBP), a central best-bet for small ruminant value chain development, began to be addressed through a sero-survey. Importantly, preliminary results showed no differences between rams in CBBPs and animals from non-program herds, which means that CBBPs urgently need to develop health schemes to reduce disease transmission risks through breeding animals. In Uganda, the focus is still on better understanding the epidemiology of African swine fever: risk factors for outbreaks and risk factors in smallholder systems were identified, the measure of infectiousness R0 was estimated to be between 1.6 and 3.4, and a cohort study found low incidence of carrier animals in smallholder systems compared to higher prevalence in samples collected at slaughter indicating farmers rapidly sell animals perceived as sick at onset of clinical signs. Genotype IX, the primary strain found in Uganda outbreaks, was sequenced and compared with genotype X virus."},{"index":5,"size":386,"text":"Much of the flagship activity remains concentrated in the third cluster development of vaccines and diagnostics for priority neglected diseases. Recombinant protein to five new candidate sporozoite antigens for East Coast fever was made, of which two are going forward towards vaccine trials 1 . A method to differentiate BoLA-A18 and BoLA-A18v cattle was developed and a panel of eight different peptide-MHC class I tetramer was developed to assess peptide specific CD8 T cell responses to immunization, and a library of ~41,000 synthetic peptides derived from 506 genes was ordered to facilitate the identification of new schizont candidate vaccine antigens. Experiments using adenovirus prime/MVA boost with the Tp1 antigen in three different formats were also carried out, and while all protocols induced CD8 T cells that were positive in ELISPOT and in killing of peptide pulsed cells, these cells did not kill parasiteinfected cells. There was some indication of immunity to challenge but the data were equivocal. Results on antigenic variation in Infection & Treatment Method (ITM) vaccine stabilates showed that the vaccine stabilates displayed far less variation than field isolates, provoking re-thinking on how the current mixture induces broader protection than single isolates. Other studies confirmed that ITM vaccinated cattle were not protected against natural challenge with buffalo-derived T. parva, and contributed to growing evidence that co-infections need to be better understood for effective control. Progress was achieved in understanding of immune response to recombinant proteins and the role Mycoplasma polysaccharides and their potential use in vaccine development. The third cluster aims at strengthening the delivery and use systems for improved animal genetic resources. To support the challenge of scaling out improved small ruminant genetics from CBBP in Ethiopia, a literature review of the current state of knowledge related to the reproductive performance and characteristics of Ethiopian sheep was completed, and initial evaluations were conducted of innovative reproductive technology options, including an assessment of breeding soundness of rams; development of clean, non-invasive and cost-effective estrous synchronization protocols for sheep and goats; and development of an effective field solution for artificial insemination in sheep with fresh semen. In Senegal, a review of the national dairy germplasm production and delivery value chain provided recommendations to strengthen the value chain. A new research agenda on poultry genetics was initiated with innovation platforms established in Ethiopia, Tanzania and Nigeria."},{"index":6,"size":116,"text":"Work under the fourth cluster targets 'breakthrough technologies' to support improved genetics in the smallholder context. Reproductive technologies are key, and advanced methods to determine sperm viability by flow cytometry were established to address this. Farmer recording systems are also a critical challenge, and a data capture and management system was developed, tested and used for chicken data. Improving access and ownership of AnGR information was achieved by testing and transferring country level databases (called Country-DAGRIS) to partners from focal institutes in 17 African countries. Finally, the livestock biorepository at ILRI continue to grow, and guidelines and an ODK system for its use as a service were established, while the fish biorepository at WorldFish became operational."},{"index":7,"size":31,"text":"Flagship 3-Feeds and forages: This flagship develops superior feed and forage options that respond to current and evolving demands to increase meat, milk and fish production, while reducing the ecological footprint."},{"index":8,"size":172,"text":"A first cluster of activities has been working to establish a shared platform of tools and approaches to support the feed research agenda. This has now largely been achieved as the flagship's Technology Platform is able to address most feed advisory, feed analytical and phenotyping demands from the CRP's value chains, other CRPs and collaborating NARES and private sector. Central to the platform are the diagnostic and analytical tool developments for FEAST, TechFit, SoFT, extended feed demand-supply scenarios and near-infrared spectroscopy (NIRS). To respond to growing use of the Feed Assessment Tool, FEAST, among researchers and agricultural development practitioners and institutions, an e-learning version of the tool was developed and made available in collaboration with the Humidtropics CRP. The value of incorporating gender dimensions into the tool was demonstrated in work in Ethiopia. New equations were developed and validated for the stationary NIRS network including results for all amino acids (AA) in 200 representative samples from Africa and Asia to address the increasing importance of monogastric and fish feeds and feed ingredients."},{"index":9,"size":105,"text":"The second cluster seeks to ensure existing feed resources are used better. In Ethiopia, sheep fattening strategies were evaluated and demonstrated the importance of sheep breed in determining profitability. Abassa tilapia were also shown to improve feed conversion in Egyptian aquaculture, and an analysis of the fish feed value chain in Egypt was reported. On-farm pilot studies in India generated evidence of the benefits of chopping of crop residues using a range of locally produced choppers with different degree of sophistication and improved feed presentation in feeding troughs: feed intake was increased, feed waste reduced, and labour investment of women in feeding cut down substantially."},{"index":10,"size":210,"text":"Creating higher quality feed options is the focus of the third cluster. Major efforts were again devoted to increasing fodder/feed biomass quantity and quality through identification, breeding and dissemination of superior food-feed cereal (maize, sorghum, pearl millet, rice, wheat and leguminous crops: cowpea, chickpea, groundnut) and maize, sorghum and pearl millet forage) cultivars. An important finding is that many Napier, sorghum and pearl millet forage cultivars perform poorly in terms of fodder quality, with low voluntary feed intake compared to maize forage. Breeding programs for interspecific Brachiaria hybrids and intraspecific B. humidicola hybrids have full cultivar development pipelines and are advancing rapidly in terms of improving genetic gain through the evaluation of larger populations, integration of improved high-throughput phenotyping protocols, and development of relevant molecular tools. Further evidence was generated on the multipurpose benefits from some forages notably Brachiaria and the BNI capacity of B. humidicola. New research on upgrading of lignocellulosic biomass for animal feed using ammonia fiber expansion (AFEX) was initiated with Michigan Biotechnology Institute. A successful pilot feed value chain for poultry and pigs based on turning cassava peel into a concentrate feed was established in collaboration with the RTB and Humidtropics CRPs. Use of maize fiber-a by-product of starch production-as basal feed for ruminants was optimized."}]},{"head":"Flagship 4-Systems Analysis for Sustainable Innovations (SASI):","index":6,"paragraphs":[{"index":1,"size":92,"text":"This flagship acts at the interface between the technology generation flagships (Health, Genetics and Feeds & Forages) and the value chain transformation and scaling flagship (VCTS), to ensure integration of the various components through a whole-systems perspective looking at livestock and fish value chains as coupled socio-ecological systems that are operating in a wider regional and global context. The flagship was established for the extension period to consolidate cross-cutting elements of previous, smaller themes and serves as a temporary arrangement to facilitate transition to the Phase 2 CRPs on Fish and Livestock."},{"index":2,"size":333,"text":"A first cluster of activities is dedicated to cross-cutting research that supports pro-poor value chain transformation, including gender dimensions reported in a separate section. To test the appropriateness of institutional models for inclusive value chains, analyses were reported of dairy business hubs and producer preferences in Tanzania and pig cooperative and slaughter options in Uganda. Partial equilibrium modelling indicated that improving efficiency in the Tanzania informal dairy value chain would mainly be in the form of scale rather than cost efficiency, offering relatively large benefits to both producers and consumers. An innovation systems approach was applied to documenting the processes and innovation architecture in the Tanzania dairy value chain, highlighting the key role of dairy development at national level and various organizations and platforms at local level. Important evidence relevant to the program's theory of change came from an innovative analysis of household data conducted jointly with CCAFS CRP and published in PNAS which suggests that targeting poverty through improving market access and off-farm opportunities is a better strategy to increase food security than focusing on agricultural production and closing yield gaps: this finding can be interpreted as support for the CRP's value chain approach. Applications of an improved environmental impact assessment framework (CLEANED) for the dairy value chain in Tanzania, the dual-purpose cattle value chain in Nicaragua and the pig value chain in Uganda were reported. Investment in the Mazingira lab in Nairobi began to generate returns: an indigenous sheep feeding trial showed that the protein rich roots, leaves and vines of the sweet potato have the ability to significantly improve productivity and decrease methane emissions intensity in animals fed low-quality basal diets, like poor quality pasture or stovers. New investment was made to develop the human nutrition dimension by convening a consultation at the Leverhulme Centre for Integrative Research on Agriculture and Health for coalition building and to develop an agenda on the role of animal-source food in the developing world; a first draft strategy for nutrition-related research was subsequently prepared."},{"index":3,"size":80,"text":"The second cluster under this flagship provides cross-cutting backstopping on the design and development of integration intervention packages in the target value chains. The focus to date has been on developing and implementing a best-bet protocol with criteria and evidence for deciding which components to take forward for scaling as part of an intervention strategy. As part of the development of a comprehensive global livestock information system to better target livestock research and investment, the Livestock Geo-Wiki was significantly improved."},{"index":4,"size":54,"text":"A third cluster is intended to assess progress and capture lessons. Work under this cluster has been focusing on the developing an M&E framework and system appropriate for an AR4D program, responding to the recommendations of the CRP Science & Partnership Advisory Committee and the CRP-Commissioned External Evaluation on the program's value chain approach."},{"index":5,"size":72,"text":"Flagship 5-Value chain transformation and scaling: This flagship was redefined for the extension period to focus on using research to develop evidence-based interventions to promote inclusive, sustainable animal-source food value chains and stimulate processes to achieve transformative scale in the target value chains. The value chain research teams serve as the interface between cross-cutting research in the other flagships and integrated solutions for generating impact in a specific national or regional context."},{"index":6,"size":313,"text":"After an initial phase of assessment during the first years of the CRP, much of the work by the value chain research teams has now shifted to piloting and validating best-bet interventions, which is the focus of the first cluster of activities. The exact stage and level of activity varied considerably across the value chains depending on when CRP country engagement began and on donor investment achieved. In addition to work led by other flagships, efforts focused on product quality in collaboration with A4NH, business development services, integrating gender and policy analysis. In Ethiopia, processing technologies to improve quality and safety of goat dairy products were tested. Analysis of the pig sector in Vietnam highlighted the opportunity to develop market differentiation and price premiums for 'safe' pork produced by Vietnam Good Animal Husbandry Practices (VietGAHP) certified producers. Based on gaps identified in business management practices in surveyed co-operatives, materials were prepared in Uganda to promote pig business planning and financial management in Uganda to begin building capacity within the value chain. Gender perceptions of resource ownership and their implications for food security were explored among rural livestock owners in Tanzania, Ethiopia, and Nicaragua, providing qualitative evidence that local meaning and gender dynamics play a crucial role in food security at the household level, and can inform locally relevant approaches to improving gender equity. A gendered analysis of barriers to adoption of best practices in pig value chain in Vietnam described how labor allocation in pig production aligned with traditional gender roles of men and women changes as scale increases, with the role of women vis-à-vis men declining. Results of updated modeling of the Vietnam pork sector shows that smallholders will remain the dominant suppliers of Vietnam's pork market in the next decades. This analysis combined with systems dynamic modeling to evaluate value chain performance contributed to policy change recognizing the smallholder sector role."},{"index":7,"size":96,"text":"The second cluster focuses on research to support implementation of innovations at scale, including improving assessment of capacity development needs and the role of innovation platforms. Various forms of innovation platforms are being applied to facilitate identifying opportunities and adapting best-bet technologies. The multistakeholder process and its role in fostering innovations and enhancing market linkages was documented for Tanzania, offering the lesson that innovation platforms at different levels are a very efficient approach to identifying and resolving complex mix of constraints to dairy development at the local level when there is an appropriate mix of actors."},{"index":8,"size":36,"text":"The deployment of innovation platforms in bilateral projects in India, Tanzania and Egypt demonstrates how to deal with the institutional environment that may enable or limit adoption and the role of the platforms in scaling up."}]},{"head":"C.2 Progress towards the achievement of research outcomes and IDOs","index":7,"paragraphs":[{"index":1,"size":44,"text":"The program devotes science to generating novel technologies and effective strategies that support inclusive livestock and fish value chain development and transformation. Several examples demonstrate that research from the program is being taken up by next users beyond the program's direct sphere of control."},{"index":2,"size":109,"text":"• In Ethiopia, the strategy for genetic improvement of small ruminants in lower-input systems based on CBBP has been prioritized by the national research system and Livestock Ministry for important Ethiopian sheep and goat breeds and is being considered as a component of the Second Growth and Transformation Plan. • In Vietnam, the Department of Livestock Production relied on evidence provided by the program to revise the Livestock Development Strategy to 2030 to address the need for a better and more conducive environment for smallholders to sustain their competitiveness in the pork sector. • In Bangladesh, improved Tilapia are being utilized by 59 hatcheries for multiplication and further dissemination."},{"index":3,"size":57,"text":"Also, 78 semi-automated feed mills are now in operation with more than 500 tons of feed provided to 800 remote small farmers. Training of 300 nutritionists and engineers in commercial automated feed mills helped produce more than 60,000 tons of quality feed using extrusion technology. Ten feed companies adopted user-friendly fish feed formulation software developed by WorldFish. "}]},{"head":"C.3 Progress towards impact","index":8,"paragraphs":[{"index":1,"size":36,"text":"Evidence about impact of program research were provided by an internal evaluation of the Egyptian aquaculture intervention, performance monitoring of the Bangladesh aquaculture intervention, a review of CBBP in Ethiopia and private sector forage seed sales."},{"index":2,"size":242,"text":"An impact assessment of the fish value chain project in Egypt, the IEIDEAS project, provided insights on changes in the yields and profits of fish farmers as a result of training on best management practices (BMP) and adoption of the Abbassa Tilapia strain. The IEIDEAS project theory of change assumed that BMP trained and farmers stocking the faster-growing Abbassa strain would increase their productivity and production, resulting in increased employment along the value chain. The impact assessment found farms adopting the Abbassa strain achieved much more efficient use of feeds (feed conversion ratio of 1.48 compared to 1.83 on control farms), and BMP-trained farmers achieved significantly higher net profits (29.3%) compared to control farmers (12.3%), with fish farmers who stocked the Abbassa strain probably using the faster growth of the new fish to achieve the target harvest weight slightly earlier but, because they only stock once per season, this did not result in higher production. It is assumed going forward that more profitable BMP-trained fish farmers will be confident enough to invest in higher productivity and that once fish farmers are used to the faster growth of the improved strain, they will devise strategies to increase their productivity. Improved understanding of the decision-making process of fish farmers will be studied to test this hypothesis, i.e. whether more profitable fish farmers will invest in sustainable intensification, thereby increasing productivity and production, or continue to improve efficiency (and reduce environmental impacts) without increasing production."},{"index":3,"size":117,"text":"In Bangladesh, the Aquaculture for Improved Nutrition project's own annual performance survey analyzed the impact of its interventions on farms and in the seed value chain (source: project reports). The results indicate that more than 550,000 fish farmers have benefited from program interventions, resulting in improved quality of inputs (fish seed), farm management practices, and farm outputs. Increased capacity of the private sector to supply Indian Major Carps fingerlings among 425,732 fish farmers contributed to increased fish sales by USD16.3 million; more than 76,000 fish farmers trained increased their fish production and sales by USD12.6 million; and shrimp hatcheries supplying diseasefree seed to 17,362 farmers, together with training, resulted in an additional incremental sales of USD79.9 million."},{"index":4,"size":42,"text":"An evaluation of three CBBPs for small ruminants in Ethiopia indicated that such programs have generated reasonable improvements in the recorded traits. The CBBP have also contributed to increased income from sale of sheep and goats as well as household meat consumption."},{"index":5,"size":58,"text":"Brachiaria hybrids from the CIAT breeding program are being adopted around the world: from 2001-2013, seed sales data shows adoption on approximately 475,000 hectares (source: private company data). Data for 2014 shows further adoption on approximately 64,000 hectares. Main adopter countries are Brazil, Mexico, Colombia, and Nicaragua but also countries in Asia and Africa have started increasingly adopting."}]},{"head":"D. Gender research achievements","index":9,"paragraphs":[{"index":1,"size":71,"text":"The program's gender initiative made significant progress across all four objectives of the Livestock and Fish gender strategy related to: gender capacity development; approaches and strategies to improve value chain participation; gender transformative approaches; and consumption (nutrition). As a joint effort with the program's capacity development specialist, a participatory gender capacity assessment tool for partners was developed working with a consultant, Transition International. The results are reported under Section F below."},{"index":2,"size":244,"text":"The innovative approach reported last year to address the challenge of developing internal capacity for gender mainstreaming moved forward with a coordinated set of activities to strengthen the capacity of non-gender scientists to use and understand gender concepts, tools and analysis. The activity is led by the Royal Tropical Institute (KIT) with the support of the CRP gender experts and involves coaching non-gender scientists to apply a gender lens in their research. Ten gender-integrated research projects were funded and implemented specifically in response to the 2014 call for gender-integrated research proposals, and sixteen projects were coached across all flagships and in six target value chains. Initial reports from the coached studies have been written and a subset are being prepared for publication. Integrating gender into Livestock and Fish research is an ongoing process to build up the collective capacity for interdisciplinarity. This approach has generated increasing appreciation by non-gender scientists of the value of gender analysis for improving the quality and impact of their technical, value chain and systems research. The surge of interest in and commitment to gender-integrated research has, however, put additional pressure on the limited gender staff in trying to respond to all of the requests to integrate gender in proposal writing, tool development and implementation, data analysis and discussion. A challenge going forward will be to clarify roles and responsibilities of all researchers (gender and non-gender) to ensure high quality science and benefits are appropriately shared by the researchers involved."},{"index":3,"size":252,"text":"The program's strategic gender research is focusing on gender relations and dynamics, access to and control of productive resources and gender transformative approaches. Analyses on this subject included an article reviewing recent tools developed to capture gender relations at household and community levels, and a policy brief on how to take into account that farmers' capacity to mitigate climate change is affected by gender relations. Access to and control of productive resources is often mentioned as a key factor affecting the ability of livestock farmers, women in particular, to participate in value chains, control the generated revenues and generally improve their livelihoods. One study reported how four dairy and horticultural projects impacted on the income and asset base of participating women and men farmers, finding the gender-asset gap did not decrease due to gender-asset disparities that limit women's participation in projects and by gender norms that reduced their control over generated revenues. Another study examined how gender affects preferences for livestock species and ownership and management of goats in a Kenyan district, concluding that a gender lens is needed when introducing new livestock species. A second study clarifies how ownership perceptions of livestock differ from other assets in selected households in Tanzania, Ethiopia and Nicaragua, largely due to the informal nature of livestock ownership. The study concluded that 'livestock ownership' is an unreliable indicator of progress on gender but at the same time, livestock offer opportunities to enhance women's control over resources when gender norms regulating the utilization of livestock are addressed."},{"index":4,"size":80,"text":"Research continued on gender transformative approaches, including radio vignettes produced in the Nicaragua value chain to question traditional gender roles. Another publication focusses on the role of gender-transformative approaches in agricultural research for development, using the aquaculture sector in Bangladesh as a case study. The IEIDEAS impact assessment concluded that while there was evidence of economic gain among the informal female fish vendors in Egypt, the main benefit was the sense of empowerment that was created through a group-based approach."},{"index":5,"size":51,"text":"The women' empowerment in livestock index (WELI) captures changes in empowerment specific to livestock keeping, and was applied in Tanzania in conjunction with a nutrition survey. A TV episode of the television series Shamba Shape-up in Kenya incorporated input from the CRP about the role of women's groups in livestock development."}]},{"head":"E. Partnerships building achievements","index":10,"paragraphs":[{"index":1,"size":46,"text":"The Swedish University of Agricultural Sciences (SLU) was the first non-CGIAR partner to join the program under a program partner agreement. The priority for SLU contributions will be to strengthen recognized gaps in the animal health flagship, particularly with respect to animal population and reproductive health. "}]},{"head":"F. Capacity building achievements","index":11,"paragraphs":[{"index":1,"size":109,"text":"Training activities are embedded throughout the program and a list of events is provided in the Performance Indicator Table in annex. Approximately 139,000 people, 53% of them women, were involved in short-term training events during the year. These included a series of training events in Uganda on improved pig management involving 3,177 pork value chain actors, in Bangladesh on aquaculture and business management skills for 130,848 value chain actors (55% women); and in Tanzania on dairy practices and management for 1,821 dairy value chain actors, of which half were women. The program also hosted 102 graduate fellows as future leaders in research, nearly half of whom (45%) were women."},{"index":2,"size":61,"text":"Particular attention was given to instructional design and developing blended-learning materials to support and increase research uptake. Initial efforts include classroom and online modules for the Feed Assessment Tool (FEAST), a joint development with CRP Humidtropics, and the Learning Management System launched in partnership with SONATA Learning and which provides a centralized platform for developing online courses to reach wider audiences."},{"index":3,"size":138,"text":"A key achievement for capacity development efforts in 2015 was to complete the development of a participatory gender capacity assessment tool for partners, led by Transition International. The tool has been used with research and development partners in four value chains: Tanzania, Ethiopia, India and Uganda. Its findings have been documented in various formats including reports for each value chain and blog posts. The assessment has led to a set of interventions to be implemented in 2016. After participating in the assessment, ATA adopted the tool for wider use with its partners. The participatory assessment was found to already increase the partners' understanding of what gender analysis entails in research and development work, and also in the institution's workplace arrangements. As a result, partners became pro-active in identifying what support they need to strengthen the desired gender skills."}]},{"head":"G. Risk management","index":12,"paragraphs":[{"index":1,"size":16,"text":"The three major risks that may hinder the expected delivery of results by the program include:"}]},{"head":"Increasing program and funding uncertainty and complexity:","index":13,"paragraphs":[{"index":1,"size":120,"text":"An assumption underlying the Livestock and Fish CRP approach is that a focused interdisciplinary focus on improving selected value chains will improve the relevance and urgency of AR4D. Maintaining sufficient continuity to allow this approach to demonstrate impact is threatened by both the constant reconfiguration of CGIAR arrangements and priorities, and the increasing restrictions on W1/2 funding and reliance on bilateral funding. To manage this risk, the CRP is giving more emphasis to translating major components of its research agenda into very large bilateral proposals that may be attractive to consortia of donors and that can provide more stability over several years. This will also address associated risks of alienating partners and not being able to attract quality scientific staff."}]},{"head":"Weak M&E systems:","index":14,"paragraphs":[{"index":1,"size":121,"text":"The need for a credible M&E system for the CRP has been highlighted by recent reviews, the risk being that the program does not detect poor performing or inappropriate research in a timely way, or donors perceive it as inadequate and lose confidence. At the same time, there is a risk of investing in developing a CRP-specific system that does not meet evolving system-level requirements, such as the adoption of the IDOs defined by the SRF superseding those previously developed by the Livestock and Fish CRP. To balance these risks, the CRP is giving priority to developing first a theory of change-based M&E system for monitoring its research, while contributing to efforts to develop a system-level strategy for monitoring the IDOs."}]},{"head":"Weak program management systems:","index":15,"paragraphs":[{"index":1,"size":77,"text":"As also pointed out in the recent Independent External Evaluation, relying on program information extracted periodically from center financial management systems, whether OCS-based or not, has not been effective and has restricted the ability to manage the CRP strategically. To address the risk of this situation continuing, priority is being given to reviewing the existing CCAFS system and adapting it to the Livestock and Fish context so that it is in place for the phase II CRPs."}]},{"head":"H. Lessons learned H.1 Confidence of indicators","index":16,"paragraphs":[{"index":1,"size":85,"text":"The indicators reported in Table 1 are derived from detailed data presented in the various background reports, which cite the supporting evidence. The program has confidence in the quality of the indicator data supplied because of the straightforward data collection methods and application within a simple database across the nine value chains, five partners and five flagships. This allows for duplications to be more easily detected and resolved. The program also performed a mid-year update of indicator data which has contributed to more exhaustive reporting."}]},{"head":"H.2 Changes in research direction","index":17,"paragraphs":[{"index":1,"size":147,"text":"A major funding opportunity supported the opening of new research on poultry genetics. Although the CRP does not currently include a target poultry value chain, the focus on poultry genetics responds to concerns that the CRP was ignoring poultry, as well as contributes an important dimension with a shorter generational cycle to understanding issues regarding appropriate use of indigenous genetic resources and their delivery, as well as providing the opportunity to assess the appropriateness of poultry value chains in addressing the CRP's objectives. New work was also initiated on the delayed herd health agenda and to address emerging fish health issues through cross-center collaboration with external partners. A significant step was taken to realize the CRP's ambitions to address human nutrition dimensions more directly by developing a consensus on priority research opportunities with a range of potential partners, but which will require mobilizing new resources to pursue."}]},{"head":"H.3 Lessons learned from evaluation","index":18,"paragraphs":[{"index":1,"size":162,"text":"The CRP benefitted from several forms of evaluation including review by the Science and Partnership Advisory Committee, finalization of a CRP-Commissioned External Evaluation on the value chain approach, preliminary findings of the Independent External Evaluation and an advisory audit by the CGIAR Internal Audit Unit. Overall, these evaluations have consistently endorsed the science agenda and approach being pursued by the CRP, but highlighted challenges and particularly weaknesses in its management systems. A central challenge remains more effectively linking the cross-cutting work in the flagships to the work in the target value chains, and ensuring sufficient scientific rigor for the action research in the value chains. Another important gap has been the lack of agribusiness expertise to translate the various research outputs into workable business-based interventions at value chain level, which is being addressed through new staff recruitment. Improving management systems has been given priority, both with respect to M&E systems and online systems for real-time monitoring of program activities and budgetary resources."},{"index":2,"size":141,"text":"Important insights were provided by an internal assessment of aquaculture project work in Egypt. The project theory of change assumed that farmers trained in best management practices and stocking the faster-growing Abbassa strain would increase their productivity and production. However, the assessment found that farmers behaved logically by using their training to feed more efficiently and reduce operating costs, maintaining the same production levels but with higher profits. Farmers using the Abbassa strain were probably using the faster growth of the new fish to achieve the targeted harvest weight slightly earlier, but as they only stock once per season this did not result in higher production. This challenge to the theory of change has led to a critical re-think of the approach and the need to understand better farmer behaviour, and point to the need for a more research-based M&E system."}]},{"head":"I. Financial report","index":19,"paragraphs":[{"index":1,"size":8,"text":"The financial reports are attached as Annex 3."},{"index":2,"size":29,"text":"Annex The CRP has defined and collected baseline data on the main dimensions of gender inequality in the CRP's main target populations relevant to its expected outcomes ( IDOs)"},{"index":3,"size":112,"text":"The gender analysis within value chains undertaken in 2014 has continued and deepened in 2015. Fourteen gender-integrated research projects have been undertaken in value chains and in the technical flagships, which go beyond sex-disaggregated data collection to embedding gender concepts in overall research questions and considering gender dimensions in design as well as using gender analysis once the data is collected. Some projects diagnose gender-based constraints in main target populations, for example, the gendered analysis of the fish feed chain in Bangladesh and gender-integrated value chain analysis of five main fish species, also in Bangladesh. Another example of baseline data collection is that of the empowerment and nutrition research undertaken in Tanzania."},{"index":4,"size":21,"text":"Sex-disaggregated social data collected and used to diagnose important genderrelated constraints in at least one of the CRP's main target populations"}]},{"head":"And","index":20,"paragraphs":[{"index":1,"size":91,"text":"The CRP has defined and collected baseline data on the main dimensions of gender inequality in the CRP's main target populations relevant to its expected outcomes (IDOs) And CRP targets changes in levels of gender inequality to which the CRP is or plans to contribute, with related numbers of men and women beneficiaries in main target populations all institutes in L&F in order to align 2015 gender budgeting. In addition, in preparations for the phase II CRPs, a theory of change on gender was developed based on the 2015 gender agenda. "}]}],"figures":[{"text":" Initial progress was made in building the capacity of research and development partners in NI, ET, UG and TZ value chains through the implementation of a participatory assessment tool for gender capacities which helped increase their awareness of what gender analysis entails and what their individual and institutional shortcomings are. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" • Pig value chain training manuals developed by the program are being used more widely by Pig Production and Marketing Uganda Ltd, Adina Foundation and Masaka district local government for their own activities, serving to scale out capacity development interventions. • Outputs from the smallholder dairy team in Tanzania were recognized as influencing the decision of large dairy processors to source supplies from agro-pastoralist producers. • The Animal Health Flagship achieved its target of having 200,000 doses of East Coast fever (ITM) vaccine deployed by other actors in East Africa. • A manual for artificial insemination on goats has been taken up by goat herder associations in Pakistan and by the relevant institutions from the State Ministry of Livestock to train village-based technicians in local semen production from genetically superior bucks.  "},{"text":" Collaborations were initiated with several private sector companies to leverage particular veterinary research capacities. The Merck aquaculture R&D lab in Singapore contributed analyses of fish disease in Bangladesh; Harris Vaccines Inc. is helping test their proprietary vaccine technology for East Coast fever; Senova GmbH is involved in developing the lateral flow diagnostic test for CBPP; and Hester Biosciences is participating in the continued development of the thermos-stable vaccine for PPR. WorldFish expanded its relationship with Skretting, the largest global fish feed company, by signing a research partnership agreement to operate a feeds research facility at the WorldFish Abbassa research center in Egypt. The facility will help identify new feed raw materials for inclusion in aquaculture feeds in Egypt and Africa. In Tanzania, a private-public partnership was forged with ASAS Dairies, a major milk processor in Tanzania, to directly involve a target market client with five farmer groups as part of piloting of dairy market hubs and using a check-off system to facilitate market transactions.At national level, a promising new type of arrangement for scaling is the program's engagement with the Ethiopia Agricultural Transformation Agency (ATA): the agency organized a workshop on design of small ruminant breeding programs jointly with the Ethiopian Agricultural Research Institute and the Livestock and Fish CRP team. At the same time, the agency participated in the stakeholder gender capacity assessment conducted by the CRP and is promoting wider use of the tool among its partners. Similarly, in Colombia, the program is engaging with the Livestock Roundtable seeking to implement sustainable livestock production. The strengthened animal health flagship established new, but more conventional, collaboration with the National Animal Health and Diagnostic Investigation Centre in Ethiopia and the National Veterinary Research Institute in Vietnam in carrying out farm-level sero-surveys.  "},{"text":" 1. Program Indicators of ProgressDetailed explanation for the source of the indicators can be found at http://livestock-fish.wikispaces.com/2015_AnnualReports in the Source of Summary Indicators file and in the various Flagship, center and value chain reports posted there. Explanatory notes at the bottom of thetable are provided for selected indicators. Law No. 124/1983 concerning fishing and regulation of aquaculture, Egypt Minister of Agriculture Decree No. 303/1987 concerning issue of executive regulation for Law No. 124/198, Egypt Minister of Agriculture Decree No. 447/2012 concerning amendment of the executive regulation of fisheries and aquaculture law, issued by Decree No. 303/1987, Egypt Presidential Decree No. 190/1983 concerning establishment of GAFRD, Egypt Presidential Decree No. 456/1983 concerning specification of water surfaces where fishing is developed and overseen by GAFRD, Egypt Minister of Agriculture Decree No. 446/1983 concerning oversight of GAFRD on fish resources companies, Egypt Minister of Agriculture Decree No. 2655/2003 concerning prohibition of use of the hormone of 17 alpha methyl testosterone to produce unisex tilapia, Egypt Law No. 123/1983 concerning aquatic cooperatives, Egypt Minister of Agriculture Decree No. 181/1984 concerning issue of executive regulation for Law No. 123/1983, Egypt Presidential Decree No. 190/1983 concerning establishment of GAFRD, Egypt Presidential Decree No. 456/1983 concerning specification of water surfaces where fishing is developed and overseen by GAFRD, Egypt Minister of Agriculture Decree No. 446/1983 concerning oversight of GAFRD on fish resources companies, Egypt Minister of Agriculture Decree No. 2655/2003 concerning prohibition of use of the hormone of 17 alpha methyl testosterone to produce unisex tilapia, Egypt Law No. 123/1983 concerning aquatic cooperatives, Egypt Minister of Agriculture Decree No. 181/1984 concerning issue of executive regulation for Law No. 123/1983, Egypt Law No. 48/1982 concerning protection of the River Nile and water channels from pollution, Egypt Minister of Irrigation Decree No. 92/2013 concerning amendment of executive regulation of the law for protection of water and canals from pollution, issued by Decree No. 402/2009, Egypt Law No.9/2009 concerning amendment of environment Law No. 4/1994, Egypt Prime Minister Decree No. 338/1995 concerning executive regulation of environment Law No. 4/1994, Egypt Prime Minister Decree No. 1741/2005 concerning amendment of some provisions of Prime Minister Decree No. 338/1995 concerning executive regulation of environment Law, Egypt Indicator KNOWLEDGE, TOOLS, DATA Deviation narrative (if actual is more than 10% away from target) (Phase I) journals produced by CRP 10. Number of strategic value chains analyzed by CRP 16.Number of trainees in long-term programs facilitated by CRP Community based livestock breeding Annex 2. Performance indicators for gender mainstreaming with targets defined 2014 2015 Target Actual Target Actual http://hdl.handle.net/10568/56822 Gendered rapid assessment and benchmarking tools for Uganda Smallholder Pig Value chain http://livestock-fish.wikispaces.com/Uganda+pig+value+chain+bench+marking+tools Toolkit for assessing knowledge attitude practices capacities and incentives of input suppliers on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/file/view/ASF_KAPCI_Input_suppliers_180315_FINAL.pd f Toolkit for assessing knowledge attitude practices capacities and incentives of extension staff on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/Gender+Initiative Questionnaires on gender dynamics in the dairy value chain governance system of Nicaragua https://www.dropbox.com/sh/vthachqprok7s3v/AADNCXpTuo9W-907Flo_Z8l8a?dl=0 Longitudinal monitoring tool for the ADA Genetics Project https://ilri-angr.wikispaces.com/Nicaragua+Project+Tools Focus group discussion guide on assessing gender norms in design and implementation of pig business hubs http://livestock-fish.wikispaces.com/file/view/GTA%20tools%20for%20the%20HUBs.pdf http://livestock-fish.wikispaces.com/SASI+FP http://livestock-http://www.wageningenur.nl/en/Education-Programmes/prospective-Year+3+%282015%29+final.docx fish.wikispaces.com/file/view/GTA%20tools%20for%20the%20HUBs.pdf and genetics, Wageningen, Netherlands http://livestock-fish.wikispaces.com/file/view/BMZ-GIZ-BNI-Project+Report-# Farm-level GHG and nutrient balance calculator producer level gender-disaggregated L&F value-chain data http://livestock-fish.wikispaces.com/Gender+Initiative Questionnaires on gender dynamics in the dairy value chain governance system of Nicaragua https://www.dropbox.com/sh/vthachqprok7s3v/AADNCXpTuo9W-907Flo_Z8l8a?dl=0 Longitudinal monitoring tool for the ADA Genetics Project https://ilri-angr.wikispaces.com/Nicaragua+Project+Tools Focus group discussion guide on assessing gender norms in design 5 -Training for MSc students in Summer school in Animal breeding humidicola, various sites in Nicaragua and implementation of Pig business hubs (see Annex 3) 9 14 N= 11 Analysis of wild forages as pig feed in Nagaland, India, South Asia https://www.wageningenur.nl/en/activity/Advanced-course-on-Design-and-implementation-of-breedingprograms-for-smallholder-poultry-farmers.htm 7 -Training on Livestock recording and database management, and 10 54 N = 54 7 -Bachelors 24 -Masters Fish feed mills, Khulna hub, Bangladesh http://www.worldfishcenter.org/content/affordable-quality-feed-helps-programs: Essentials rural-bangladeshi-farmers-grow-more-fish and examples the use of MISTRO livestock recording and monitoring database software for Rwanda Agricultural board, Kigali, Rwanda http://ilri-angr.wikispaces.com/file/view/Trip%20Report-Rwanda-20150717.pdf 2 -Training to farmers on animal breeding management through focus group discussions, Nicaragua http://ilri-research in the CRP Biological Nitrification Inhibition (BNI) potential of Brachiaria initiative-to-improve-livelihoods-of-smallholders-and-boost-food-security/ angr.wikispaces.com/file/view/Report_FDG_Nicaragua_2015_format.pdf (female) POLICIES IN VARIOUS STAGES OF DEVELOPMENT Performance Indicator CRP performance approaches CRP performance meets requirements CRP performance exceeds requirements 2016 Target Not set 22 -PhD 28. Numbers of 4 5 requirements N = 19 1 -Other Policies/ Regulations/ 1. Gender inequality targets Sex-disaggregated social data is being Sex-disaggregated social data collected and used to diagnose Pig breeding policy, Nagaland, India defined collected and used to diagnose important gender-related constraints in at least one of the CRP's TECHNOLOGIES/PRACTICES IN VARIOUS STAGES OF DEVELOPMENT 18. Number of technologies/NRM practices under 32 22 N = 27 Analyzed (Stage 1) http://clippings.ilri.org/2015/08/13/tanzania-livestock-modernization-Biological https://asia.ilri.org/2016/01/12/nagaland-breeding-policy/ important gender-related constraints main target populations Administrative Procedures Tanzania Livestock Modernization Initiative, in at least one of the CRP's main target populations And Indicator KNOWLEDGE, TOOLS, DATA Deviation narrative (if actual is more than 10% away from target) (Phase I) journals produced by CRP 10. Number of strategic value chains analyzed by CRP 16.Number of trainees in long-term programs facilitated by CRP Community based livestock breeding Annex 2. Performance indicators for gender mainstreaming with targets defined 2014 2015 Target Actual Target Actual http://hdl.handle.net/10568/56822 Gendered rapid assessment and benchmarking tools for Uganda Smallholder Pig Value chain http://livestock-fish.wikispaces.com/Uganda+pig+value+chain+bench+marking+tools Toolkit for assessing knowledge attitude practices capacities and incentives of input suppliers on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/file/view/ASF_KAPCI_Input_suppliers_180315_FINAL.pd f Toolkit for assessing knowledge attitude practices capacities and incentives of extension staff on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/Gender+Initiative Questionnaires on gender dynamics in the dairy value chain governance system of Nicaragua https://www.dropbox.com/sh/vthachqprok7s3v/AADNCXpTuo9W-907Flo_Z8l8a?dl=0 Longitudinal monitoring tool for the ADA Genetics Project https://ilri-angr.wikispaces.com/Nicaragua+Project+Tools Focus group discussion guide on assessing gender norms in design and implementation of pig business hubs http://livestock-fish.wikispaces.com/file/view/GTA%20tools%20for%20the%20HUBs.pdf http://livestock-fish.wikispaces.com/SASI+FP http://livestock-http://www.wageningenur.nl/en/Education-Programmes/prospective-Year+3+%282015%29+final.docx fish.wikispaces.com/file/view/GTA%20tools%20for%20the%20HUBs.pdf and genetics, Wageningen, Netherlands http://livestock-fish.wikispaces.com/file/view/BMZ-GIZ-BNI-Project+Report-# Farm-level GHG and nutrient balance calculator producer level gender-disaggregated L&F value-chain data http://livestock-fish.wikispaces.com/Gender+Initiative Questionnaires on gender dynamics in the dairy value chain governance system of Nicaragua https://www.dropbox.com/sh/vthachqprok7s3v/AADNCXpTuo9W-907Flo_Z8l8a?dl=0 Longitudinal monitoring tool for the ADA Genetics Project https://ilri-angr.wikispaces.com/Nicaragua+Project+Tools Focus group discussion guide on assessing gender norms in design 5 -Training for MSc students in Summer school in Animal breeding humidicola, various sites in Nicaragua and implementation of Pig business hubs (see Annex 3) 9 14 N= 11 Analysis of wild forages as pig feed in Nagaland, India, South Asia https://www.wageningenur.nl/en/activity/Advanced-course-on-Design-and-implementation-of-breedingprograms-for-smallholder-poultry-farmers.htm 7 -Training on Livestock recording and database management, and 10 54 N = 54 7 -Bachelors 24 -Masters Fish feed mills, Khulna hub, Bangladesh http://www.worldfishcenter.org/content/affordable-quality-feed-helps-programs: Essentials rural-bangladeshi-farmers-grow-more-fish and examples the use of MISTRO livestock recording and monitoring database software for Rwanda Agricultural board, Kigali, Rwanda http://ilri-angr.wikispaces.com/file/view/Trip%20Report-Rwanda-20150717.pdf 2 -Training to farmers on animal breeding management through focus group discussions, Nicaragua http://ilri-research in the CRP Biological Nitrification Inhibition (BNI) potential of Brachiaria initiative-to-improve-livelihoods-of-smallholders-and-boost-food-security/ angr.wikispaces.com/file/view/Report_FDG_Nicaragua_2015_format.pdf (female) POLICIES IN VARIOUS STAGES OF DEVELOPMENT Performance Indicator CRP performance approaches CRP performance meets requirements CRP performance exceeds requirements 2016 Target Not set 22 -PhD 28. Numbers of 4 5 requirements N = 19 1 -Other Policies/ Regulations/ 1. Gender inequality targets Sex-disaggregated social data is being Sex-disaggregated social data collected and used to diagnose Pig breeding policy, Nagaland, India defined collected and used to diagnose important gender-related constraints in at least one of the CRP's TECHNOLOGIES/PRACTICES IN VARIOUS STAGES OF DEVELOPMENT 18. Number of technologies/NRM practices under 32 22 N = 27 Analyzed (Stage 1) http://clippings.ilri.org/2015/08/13/tanzania-livestock-modernization-Biological https://asia.ilri.org/2016/01/12/nagaland-breeding-policy/ important gender-related constraints main target populations Administrative Procedures Tanzania Livestock Modernization Initiative, in at least one of the CRP's main target populations And 1. Number of flagship \"products\" produced by CRP 2. % of flagship products produced that have explicit 5. % of tools that have an explicit target of women farmers 7. Number of open access databases maintained by CRP 5 Not set Not set 6 None N/A 24 (60%) 7 6 None N/A http://livestock-fish.wikispaces.com/VCD+Uganda Gender sensitive toolkit for participatory assessment of livestock disease constraints http://livestock-fish.wikispaces.com/VCD+Ethiopia Toolkit for Participatory risk assessment of African swine fever in the N = 26 (37%) Uganda Pig Value Chain assessment tools http://livestock-fish.wikispaces.com/VCD+Uganda -Pig Value Chain Development -Uganda-Uganda Pig Value Chain bench marking assessment tools phkE3a?dl=0 Animal Feeds Analysis Application: http://temp.icarda.org/afawa https://www.dropbox.com/sh/h653mvi9auo6vah/AADdd94H1jjLRsEMwOm Tools and Resources N = 18 GIS layers MoreMilkiT scenarios: Spatial practicalities and master-students/MSc-programmes/MSc-Animal-Sciences/International-Use of Brachiaria humidicola hybrids with high Biological Nitrification Programmes/European-Master-in-Animal-Breeding-and-Genetics/Summer-school-and-minor.htm Inhibition potential to reduce environmental footprint, various implications for Tanzania dairy value chain: http://ilri-cleaned.wikispaces.com/file/view/GeoPortalPGISlayers.zip 3 -Training course in Quantitative Genetics and Genomics, Kenya locations globally 5 1 (20%) Not set 1. Number of flagship \"products\" produced by CRP 2. % of flagship products produced that have explicit 5. % of tools that have an explicit target of women farmers 7. Number of open access databases maintained by CRP5 Not set Not set 6None N/A 24 (60%) 76None N/A http://livestock-fish.wikispaces.com/VCD+Uganda Gender sensitive toolkit for participatory assessment of livestock disease constraints http://livestock-fish.wikispaces.com/VCD+Ethiopia Toolkit for Participatory risk assessment of African swine fever in the N = 26 (37%) Uganda Pig Value Chain assessment tools http://livestock-fish.wikispaces.com/VCD+Uganda -Pig Value Chain Development -Uganda-Uganda Pig Value Chain bench marking assessment tools phkE3a?dl=0 Animal Feeds Analysis Application: http://temp.icarda.org/afawa https://www.dropbox.com/sh/h653mvi9auo6vah/AADdd94H1jjLRsEMwOm Tools and Resources N = 18 GIS layers MoreMilkiT scenarios: Spatial practicalities and master-students/MSc-programmes/MSc-Animal-Sciences/International-Use of Brachiaria humidicola hybrids with high Biological Nitrification Programmes/European-Master-in-Animal-Breeding-and-Genetics/Summer-school-and-minor.htm Inhibition potential to reduce environmental footprint, various implications for Tanzania dairy value chain: http://ilri-cleaned.wikispaces.com/file/view/GeoPortalPGISlayers.zip 3 -Training course in Quantitative Genetics and Genomics, Kenya locations globally5 1 (20%) Not set target of women farmers/NRM managers 3. % of flagship products produced that have been assessed for likely gender-disaggregated impact 4. Number of tools produced by the CRP 15. Number of trainees in long-term programs 8. Total number of facilitated by CRP publications in ISI users of these open (male) access databases 9. Number of Not set 25 7 Not set 57 N/A 40 50 244,268 48  N/A N = 70 smallholder pig value chains in Uganda http://livestock-http://livestock-SoFT Tropical Forage Selection: http://www.tropicalforages.info 94 -Training of dairy farmers on using weigh bands for predicting the fish.wikispaces.com/Uganda+pig+value+chain+bench+marking+tools DAGRIS (origin, distribution, diversity, present use and status of weight of dairy animals from heart-girth measurements, Senegal fish.wikispaces.com/file/view/Qualitative_VC_assessment%20of%20ASF_18 Tanzania smallholder dairy value chain change pathway indigenous farm animal genetic resources). http://dagris.info http://ilri-0315_FINAL.pdf Toolkit for rapid value chain assessment of animal health and husbandry practices http://livestock-fish.wikispaces.com/file/view/Rapid_assessment_Animal%20Health%20_FIN AL_180315.pdf Toolkit for assessing knowledge attitude practices capacities and incentives of pig producers on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/file/detail/Tanzania_dairy_VC_change angr.wikispaces.com/file/detail/Senegal%20Dairy%20Genetics%20training% AZIZI Bio-repository: http://azizi.ilri.cgiar.org 202015.pdf pathway_2015.pdf Nicaragua Value Chain Assessment tools http://livestock-fish.wikispaces.com/Country+rapid+VC+assessment Gender transformative toolkit for Bangladesh value chain http://livestock-fish.wikispaces.com/file/view/VCA_ENG_Producers_6Feb15_final.docx Animal Genetic Training Resources: http://agtr.ilri.cgiar.org Baseline on improved breeds in Nicaragua (ADA-financed project): N = 63 Law No. 89/1998 concerning government bids and tenders, Egypt 5 -Bachelors GAFRD Decision No. 70/1986 concerning rent and allocation of http://data.ilri.org/portal/dataset/adanicbaseline N = 341,050 30 -Masters GAFRD land, Egypt Baseline FSP-Solidaridad project: http://livestock-fish.wikispaces.com/file/detail/Informe LB Proyecto Carne y Lácteos competitivos FINAL28OCT.docx Raw feed material nutrient values (Aquaculture Bangladesh): 26 -PhD Minister of Agriculture Decree No. 1132/2007 concerning offering N = 70 aquaculture and hatcheries overseen by GAFRD for rent or lease-2 -Other holding, Egypt Not set 40 Not set Not set 67 target of women farmers/NRM managers 3. % of flagship products produced that have been assessed for likely gender-disaggregated impact 4. Number of tools produced by the CRP 15. Number of trainees in long-term programs 8. Total number of facilitated by CRP publications in ISI users of these open (male) access databases 9. Number ofNot set 25 7 Not set 57N/A 40 50 244,268 48N/A N = 70 smallholder pig value chains in Uganda http://livestock-http://livestock-SoFT Tropical Forage Selection: http://www.tropicalforages.info 94 -Training of dairy farmers on using weigh bands for predicting the fish.wikispaces.com/Uganda+pig+value+chain+bench+marking+tools DAGRIS (origin, distribution, diversity, present use and status of weight of dairy animals from heart-girth measurements, Senegal fish.wikispaces.com/file/view/Qualitative_VC_assessment%20of%20ASF_18 Tanzania smallholder dairy value chain change pathway indigenous farm animal genetic resources). http://dagris.info http://ilri-0315_FINAL.pdf Toolkit for rapid value chain assessment of animal health and husbandry practices http://livestock-fish.wikispaces.com/file/view/Rapid_assessment_Animal%20Health%20_FIN AL_180315.pdf Toolkit for assessing knowledge attitude practices capacities and incentives of pig producers on biosecurity for the control of African swine fever in Uganda http://livestock-fish.wikispaces.com/file/detail/Tanzania_dairy_VC_change angr.wikispaces.com/file/detail/Senegal%20Dairy%20Genetics%20training% AZIZI Bio-repository: http://azizi.ilri.cgiar.org 202015.pdf pathway_2015.pdf Nicaragua Value Chain Assessment tools http://livestock-fish.wikispaces.com/Country+rapid+VC+assessment Gender transformative toolkit for Bangladesh value chain http://livestock-fish.wikispaces.com/file/view/VCA_ENG_Producers_6Feb15_final.docx Animal Genetic Training Resources: http://agtr.ilri.cgiar.org Baseline on improved breeds in Nicaragua (ADA-financed project): N = 63 Law No. 89/1998 concerning government bids and tenders, Egypt 5 -Bachelors GAFRD Decision No. 70/1986 concerning rent and allocation of http://data.ilri.org/portal/dataset/adanicbaseline N = 341,050 30 -Masters GAFRD land, Egypt Baseline FSP-Solidaridad project: http://livestock-fish.wikispaces.com/file/detail/Informe LB Proyecto Carne y Lácteos competitivos FINAL28OCT.docx Raw feed material nutrient values (Aquaculture Bangladesh): 26 -PhD Minister of Agriculture Decree No. 1132/2007 concerning offering N = 70 aquaculture and hatcheries overseen by GAFRD for rent or lease-2 -Other holding, EgyptNot set 40 Not set Not set 67      45 53 45 53  "}],"sieverID":"71bb9b9b-2e3d-4aa3-98f5-fb332b7fb1af","abstract":"CGIAR is a global partnership that unites organizations engaged in research for a food-secure future. The CGIAR Research Program on Livestock and Fish aims to increase the productivity of small-scale livestock and fish systems in sustainable ways, making meat, milk and fish more available and affordable across the developing world. The Program brings together five partners: the International Livestock Research Institute (ILRI) with a mandate on livestock; WorldFish with a mandate on aquaculture; the International Center for Tropical Agriculture (CIAT), which works on forages; the International Center for Research in the Dry Areas (ICARDA), which works on small ruminants; and the Swedish University of Agricultural Sciences (SLU) which provides expertise particularly in animal health and genetics. http://livestockfish.cgiar.orgThe Program thanks all donors and organizations who globally supported its work through their contributions to the CGIAR Fund."}

data/part_2/00cdf425e73e99dc823deed166636df6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00cdf425e73e99dc823deed166636df6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4a14d2c7-192d-489b-869b-b96de8170cd8/retrieve"},"pageCount":28,"title":"","keywords":[],"chapters":[{"head":"Summary","index":1,"paragraphs":[{"index":1,"size":128,"text":"Small ruminants are an integral part of mixed crop and livestock systems in Mali and they fulfil various roles in household food security as source of meat and milk, and means of additional income to meet food and cash needs. Besides, small ruminants also produce manure which is an invaluable source of organic matter for improving soil fertility. However, small ruminant production in Mali is challenged by the poor performance of animals largely due to inadequate nutrition and diseases. Given the low inputs into sheep and goats production by the smallholder farmers, their animals are rarely vaccinated or treated regularly against diseases and supplementary feeding is often on an ad hoc basis. Combining health and feed interventions can lead to a better animal performance than a single technology."},{"index":2,"size":311,"text":"Based on our experience and promising results from feed and health interventions for improved small ruminant production in Ghana under the Africa RISING project, a pilot study was initiated in Mali involving combined feed and health interventions in two communities namely Sirakele and Zanzoni in Koutiala District in the southern region of Mali. The objective of this study was to assess the effects of combined feed and health interventions on small ruminant production in mixed crop and livestock systems in southern Mali. Zanzoni village served as the control group while Sirakele received feed and health intervention. Twenty households were randomly selected in each community for a year-long study spanning the period August 2016 to August 2017. Results from the study showed that the average household flock size for sheep and goats in the feed and intervention group doubled within a year (August 2016-sheep: 5.30±0.81; goats: 6.75±1.24; July 2017-sheep: 11.90±1.56; goats: 12.70±2.04) whereas average flock size in control group (Zanzoni) remained largely the same within the same period. The average number of birth per household for both sheep and goats were 5.72±2.10 and 15.20±3.41 for control and treatment groups, respectively. The mortality rate was significantly lower in Sirakele with the intervention than in the control site. Results on weight development showed that the goats and sheep under treatment gained 42.98±3.28 and 47.12±2.73 g/day, respectively compared to 22.59±2.29 and 16.58±2.74 g/day for goats and sheep, respectively under control. Significantly more manure was collected from the animals under the feed and health intervention compared to those in the control group. Partial cost benefit analysis showed the annual net return of 95,349±25,388 Franc CFA (FCFA) per household for the feed and health intervention in Sirakele compared to 88,575±8,693 FCFA per household for the control group in Zanzoni. The results confirm that feed and health intervention lead to significant and profitable improvement in small ruminant production."}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":222,"text":"Small ruminants are an integral part of mixed crop and livestock systems in Mali and they fulfil various roles in household food security as source of meat and milk and means of additional income to meet food and cash needs (Wilson 1986;Ba et al. 1996). In the West African Sahel, majority of farmers raise small ruminants for immediate source of income, as insurance against emergencies and as mitigating measures in case of crop failures (Wilson 1991). Besides, small ruminants also produce manure which is an invaluable source of organic matter for improving soil fertility. In Mali, about 90% of households own sheep and goats as they are important for the livelihood strategies of many resource poor rural households (Ba et al. 1996). Small ruminant rearing provides employment opportunities for rural women and youth as they are heavily involved in the management of sheep and goats (Wilson 1991;Lebbie 2004). The short generation intervals of small ruminants compared to cattle allows for rapid flock growth within a short provided there is adequate nutrition and veterinary care. Compared to cattle, small ruminants tend to withstand drought much better (Lebbie 2004). For example, Wilson (1991) reported that the during the drought of the early 1980s in the Sahel, cattle losses were over 80% while those of small ruminants were not more than 50% of the flocks."},{"index":2,"size":289,"text":"In view of the potential for rapid flock growth and the varied functions small ruminants fulfil in mixed crop and livestock systems, they could be a means of improving household food security and poverty alleviation among smallholder farmers. However, small ruminant production in Mali is challenged by the poor performance of animals largely due to inadequate nutrition and diseases (Wilson 1986;Ba et al. 1996). Given the low inputs into sheep and goats production by the smallholder farmers, their animals are rarely vaccinated or treated regularly against diseases (Ba et al. 1996) and supplementary feeding is often on an ad hoc basis (Ayantunde et al. 2014). Consequently, high mortality rate is common in small ruminant flocks in Mali (Ba et al. 1996) as well as in other Sahelian countries. One way in which mortality could be reduced is by vaccinating small ruminants against main diseases such as pasteurellosis, peste des petits ruminants (PPR) and deworming them. In addition to healthcare, strategic supplementation of the small ruminants is also essential to improve their performance ( The underlying hypothesis for this study was that combinations of improved management practices results in higher animal productivity, income, and household food security than single technologies. In this study, the interventions focused mainly on provision of healthcare and supplementary feeding. The objective of the study was to assess the effects of combined feed and health interventions on small ruminant production in mixed crop and livestock systems in southern Mali. The specific objectives were: (1) to assess the effects of feed and health package on sheep and goats live weight changes, flock dynamics (birth, death, offtake) and manure production, and (2) to quantify the costs and benefits of feed and health package in smallholder small ruminant production."}]},{"head":"Methodology","index":3,"paragraphs":[]},{"head":"Study sites","index":4,"paragraphs":[{"index":1,"size":236,"text":"The study was undertaken in Sirakelé (-5.48 o long; 12.51 o lat) and Zanzoni (-5.57 o long; 12.61 o lat) villages in Koutiala District in southern region of Mali. Sirakélé is a village in the rural commune of Songoua that is situated about 15 km north of Koutiala town, while Zanzoni is located in commune Fakolo about 35 km from Koutiala town. Koutiala District is the cotton production capital of Mali. Both study communities are in a region with a high concentration of smallholder crop and livestock farmers which implies that the mixed crop and livestock farming system is dominant. The two study sites have a Sudanian climate characterized by an alternation of dry and rainy seasons that last about six months each. The dry season is normally between November and April while the rainy season is between May and October. Annual precipitation varies between 750-1,100 mm. Crop farming and livestock husbandry are the main sources of household foods and income in the study areas. The feed resources in both study sites are similar as reported by Umutoni et al. (2015) from the study on the evaluation of feed resources in Koutiala and Bougoni districts in southern Mali. The main feed resources are natural pastures, crop residues and agro-industrial byproducts. This report was based on a one-year monitoring of sheep and goat flocks belonging to 40 households in two communities between August 2016 and August 2017."}]},{"head":"Household selection for the study and animal management","index":5,"paragraphs":[{"index":1,"size":146,"text":"The study involved 20 households in each community. The households were selected randomly based on ownership of sheep and or goats and willingness to participate in the study which entails monitoring of their animals for about one year. Both communities are intervention communities in the 'Zones of Influence' of the USAID-funded Africa RISING program in Mali. The goal of Africa RISING is to create opportunities for smallholder farm households to move out of hunger and poverty through sustainably intensified farming systems that improve food, nutrition, and income security, particularly for women and children, and conserve or enhance the natural resource base. At the beginning of the study in August 2016, the two communities were randomly allocated to either control or treatment groups. The control group consists of the 20 selected households in Zanzoni village while the treatment group comprises of the 20 selected households in Sirakelé."},{"index":2,"size":283,"text":"The sheep and goat flocks in the treatment group received vaccination against pasteurellosis, PPR and trypanosomiasis, deworming and regular health care in case of any sickness, and supplementary feed (300 g of cotton seed cake per animal per day) throughout the 12 months of the study. Cotton seed cake was used as supplement in this study as it is readily available in the study sites due to widespread cultivation of cotton. The quantity of cotton seed cake offered was based on similar studies in Ghana where between 200 and 300 g of supplement was offered per animal (Konlan et al. 2017). Given that the experiment was undertaken on farm, physiological status was not considered while deciding the amount of supplement to be distributed to animals as it is difficult to adjust quantity offered to animal physiological status in rural farm conditions. The treatment package is referred to as 'Feedhealth (FH) intervention' in this report. Vaccines produced by the Malian Central Veterinary Laboratory (Laboratoire Central Vétérinaire de Bamako) named 'Ovipeste' and 'Pastovin' were used for vaccination against PPR and pasteurellosis, respectively. Sheep and goats under FH intervention were vaccinated once per year against PPR at the dosage of 1 ml per animal and twice per year against pasteurellosis at the dosage of 2 ml per animal. The treatment animals were also vaccinated against trypanosomosis with Verben B12 and Kelamidum. Prophylaxis in the form of antibiotic and multivitamin injections, and deworming were given to treatment animals. Deworming was done twice in a year, at the beginning of the study in August and at the end of the rainy season in October using SYNANTHIC (oxfendazole). Treatment animals were also provided with the curative treatment when necessary."},{"index":3,"size":218,"text":"The flocks in the control group did not receive any feed and or health intervention from the project. However, farmers in the control group treated their sick animals irregularly and offered crop residues particularly sorghum straw, cotton straw and groundnut haulms after the crop harvest, and browses in the late dry season on an ad hoc basis. In both study sites, daily management of sheep and goats involved grazing of natural pastures during the rainy season and crop residues in the dry season by most of the animals. Animals that were being fattened, lactating does and ewes, and sick animals were normally left around the homesteads, and fed there. The young animals (lambs and kids) were not allowed to graze until they were 3-4 months old. On returning from grazing, the animals in the FH intervention were each offered cotton seed cake as a supplement, which was often consumed immediately. At night, the animals in both control and treatments groups were tethered to pickets or penned in enclosures or shelters around the homesteads. About 94% of the sheep the study areas was Djallonke breed with the remaining belonging to Sahelian long-legged breeds. The Sahelian long-legged sheep were mainly male for fattening. The West African dwarf (about 96%) was the dominant goat breed with a few Sahelian longlegged goats."},{"index":4,"size":11,"text":"Rams being fattened tethered at the homestead (photo credit: Clarisse Umutoni/ILRI)."}]},{"head":"Flock monitoring and data collection","index":6,"paragraphs":[{"index":1,"size":103,"text":"All the sheep and goats in the selected 20 households each in Zanzoni (control) and Sirakelé (feed-health intervention) were ear-tagged at the beginning of the study in August 2016 for identification and weighed (see the Picture 2 of animal weighing). At the beginning of the study, the total flock of the 20 households consisted of 78 sheep and 84 goats in Zanzoni making a total of 162 animals while in Sirakelé the total flock consisted of 106 sheep and 135 goats making 241 animals in total. All animals in both the control and treatment groups were weighed every month for 3 days consecutively."},{"index":2,"size":170,"text":"The two field technicians responsible for the monitoring of the experimental animals visited each household every month to collect data of any change in the household flock (demographic event) including birth, death, sale, animal slaughtered, giving out animal as gift or on caretaking, receipt of animal as gift or on caretaking arrangement, and loss through theft. The data on occurrence of death in the flocks was used to calculate mortality rate which is the number of death recorded as a percentage of the total flock at the beginning of the study. Offtake rate was calculated as the number of animal sold, slaughtered and given out as a percentage of the total flock at the beginning of the study. The manure deposited at the enclosures or shelters by the animals was collected each morning after removal of the sheep and goats from the pens by each household in both control and treatment groups. It was air dried and stored in a bag for weighing every month by the AMEDD field technicians."},{"index":3,"size":6,"text":"Animal weighing (photo credit: Clarisse Umutoni/ILRI)."}]},{"head":"Collection of feed and faecal samples","index":7,"paragraphs":[{"index":1,"size":104,"text":"Two samples of feed resources fed to the experimental animals were collected in the early and late dry seasons. The feed resources were mainly crop residues, browses and agroindustrial by-products. In total, 46 feed samples were collected and ground to pass through a 2 mm sieve for laboratory analysis of their chemical composition. Two faecal (manure) samples of 0.5 kg fresh weight were collected monthly from each household and these were air dried. Collected samples for each household were combined per season (wet/rainy, early dry and late dry) and ground for laboratory analysis. In total, 120 faecal samples were prepared for the laboratory analysis."}]},{"head":"Laboratory analysis of feed and faecal samples","index":8,"paragraphs":[{"index":1,"size":154,"text":"Samples of feed resources in the study sites were collected mainly in the early and late dry seasons (October 2016 to May 2017),air dried and prepared for laboratory analyses. They were analysed for dry matter (DM), ash content, nitrogen, fibre components [neutral detergent fibre (NDF), acid detergent fibre (ADF), and acid detergent lignin (ADL)] and in vitro organic matter digestibility (IVOMD) using the near infrared reflectance spectroscopy (NIRS) technique. The sample fineness for NIRS analysis was 2mm. The wave length range to estimate the chemical composition was 1,100 to 2,500 nanometres. NIRS is an indirect analytical method based on the development of empirical models in which the concentration of a feed constituent is predicted from complex spectral data (De Boever et al. 1995). Crude protein was estimated from nitrogen content (nitrogen x 6.25). Metabolizable energy (Mcal/kg DM) was derived from IVOMD. The faecal samples were analysed for DM, OM, N and phosphorus (P) concentration."}]},{"head":"Statistical analysis","index":9,"paragraphs":[{"index":1,"size":68,"text":"Data analysis was performed with SAS (SAS, 1987) using means procedures for descriptive statics while T-Test was used to compare the means of demographic events (birth rate, mortality rate, offtake rate etc.), average daily gains, quantity of manure collected per household and cost and benefit between the control group and the group with feed-health intervention. Unless otherwise specified, the level of significance was set at P < 0.05."}]},{"head":"Results and discussion","index":10,"paragraphs":[]},{"head":"Flock structure and dynamic","index":11,"paragraphs":[{"index":1,"size":285,"text":"The average flock size per household at the beginning of the study in August 2016 for sheep was 3.90±0.82 and 5.30±0.81 for the control and feed-health intervention groups, respectively (Table 1). For goats, the average flock size was 4.20±0.97 and 6.75±1.24 for the control and FH intervention groups, respectively. The results showed that the both sheep and goat flocks were dominated by females irrespective of the treatment. At least 80% of the sheep flock was female at the beginning of the study while at least 75% of the goat flock was female at the same period. These results agreed with the results on small ruminant production in the agro-pastoral systems in Central Mali by Wilson (1986) where it was reported that the females accounted for at least 75% of the sheep and goat flocks. Generally, the flock is dominated by female animals for reproduction and for flock growth, whereas the male sheep and goats are often sold to meet household cash needs as reported by Ba et al. (1996) that the offtake rate of male animals is often high compared to the female animals. The average flock size per household of sheep and goats at the beginning in our study sites in Koutiala district was lower than for the agro-pastoral sheep and goat flock in Central Mali reported by Wilson (1986) which were on average 9.48 and 23.57 for sheep and goats, respectively. The higher flock size of agro-pastoral flock than those of mixed croplivestock farmers in southern Mali is expected as the farmers in the south are more oriented towards cropping than raising livestock whereas the agro-pastoralists are livestock keepers by tradition though they have settled down to grow crops (Ayantunde et al. 2011)."},{"index":2,"size":247,"text":"After a year, the flock size of the control group remained largely the same as at the beginning of the study (sheep-male 0.65±0.22; female: 2.95±0.73; goats-male: 1.15±0.33; female: 3.45±0.72) whereas the flock size of sheep and goats per household under FH intervention doubled within the same period (Table 1). The total number of the flock for the FH group increased from 106 sheep at the beginning of the study (August 2016) to 236 at the end of July 2017 while the number of goats increasing from 135 to 252 (Figure 1). These results demonstrate that feed and health interventions led to significant increase in flock size of sheep and goats within a short period through better reproductive and growth performance. Similar results were reported by Ba et al. (1996) in Mali with introduction of health treatment alone. Konlan et al. (2017) also reported synergistic benefits of the combined effect of providing concentrate feed and healthcare to small ruminants kept by smallholder farmers in northern Ghana. A similar trend of significant increase in small ruminant number with feed and health intervention was reported by Avornyo et al. (2015) also in northern Ghana.  Results on flock dynamics (Table 2) showed significant differences in birth rate, mortality rate and offtake rate between the control and feed-health intervention group. The mortality rate of the control group was 30.4% during one year of the study while that of the FH group was 13.3%, which was significantly lower than of the control group."},{"index":3,"size":359,"text":"The results confirmed that mortality rate is always high in a small ruminant flock without adequate healthcare and nutrition (Konlan et al. 2017). According to Wilson (1986), the mortality rate can be up to 30% in sheep and goat flock in extensive livestock systems where healthcare is inadequate and nutrition can be poor, particularly in the dry season. Ejlertsen et al. (2012) reported mortality rates of 25-32% for sheep flock and of 13-23% for goat flock in southern Mali based on a recall survey. The major causes of death in the flocks in our study were diseases such as respiratory problems, diarrhoea and fever, losses due to predator and injuries. Similar causes of death were reported by Ba et al. (1996) for small ruminant flock in semi-arid areas of Mali. The results on repartition of birth and death in the control and FH groups between September 2016 and August 2017 are presented in Figure 2 and Figure 3. Most births tended to occur between March and September (Figure 2) while deaths tended to occur throughout the year though the lowest recorded cases of death were in January and February.    Wilson (1986) for small ruminants in agro-pastoral systems in central Mali. Offtake generally tended to be much higher in males than in females as the major reason for offtake is sale to meet immediate cash needs of the households and the males are often targeted for this (Ba et al. 1996). In our study, we did not collect sexdisaggregated data for the offtake but the anecdotal evidence from the participating households supports the claim that offtake is higher in males than in females. Generally, offtake is influenced by the number of animals available, immediate cash needs, prevailing market prices and animal's age and condition. Interventions that lead to significant increases in flock size like supplementary feeding and healthcare will tend to increase offtake as shown by the significant difference between the offtake rate of the control group and the feed-health group in our study. In Mali and other Sahelian countries in West Africa, sale of small ruminants is one of the key strategies for coping with crop failures (Lebbie 2004)."}]},{"head":"Body weight development and change","index":12,"paragraphs":[{"index":1,"size":200,"text":"The results of this study showed that feed and health intervention had significant effect on body weight development and the average daily gain (ADG) of sheep and goats (Table 3). The average daily gains of sheep and goats in the control group were 16.58±2.74 and 22.59±2.29 g/day while the ADG for the animals that received feed and health intervention was almost double (sheep: 47.12±2.73; goats: 42.98±3.28). For the few lambs and kids that were weighed at birth, the birth weights were similar for both control and treatment groups. The body weight development trend was similar until the fourth month for sheep (Figure 4a) and until the fifth month for goats (Figure 4b) under both control and treatment groups. Afterward, there was significant difference in the weight development of both groups. At one year of age, sheep and goats under the FH group weighed significantly higher than those under the control (Table 3).  are heavier than the West Africa dwarf breeds which are dominant in southern Mali where our study was conducted. The higher body weight of sheep and goats as from 4 months of age showed that the effect of supplementary feeding and healthcare on body weight development is cumulative."}]},{"head":"Manure production and nutrient content","index":13,"paragraphs":[{"index":1,"size":429,"text":"Results of manure collected from sheep and goats by households under control and feedhealth intervention are presented in Table 4. More manure was collected by the households that received feed-health intervention than by those under control across all seasons (early dry, late dry and wet seasons). This suggests that feed and health intervention is also beneficial for soil fertility improvement as the farmers could collect more manure to apply to their crop fields. The main challenge of manure collected at homesteads is transportation to the crop field, particularly if the farm is far from the village. The manure collected per animal per day was highest for both groups (control: 102±4.06 g DM/animal/day; feed-health: 121.52±4.52 g DM/animal/day) in the late dry season while it was lowest in the wet season. This could be attributed to longer time spent around the homestead by the animals in the late dry season as there was virtually no feed in the grazing areas at this period which allowed for more manure to be collected. In the wet season, it is generally more difficult to collect manure as the water content in faeces is high. The quantities of manure collected from animals in both groups when expressed in g DM/kg live weight/day (Table 4) were much lower than the quantities of 10 to 13 g DM/kg live weight/day reported by Ayantunde et al. (2007) for sheep under feeding trials using faecal collection bags. This shows that there were losses in the collection of the manure by the farmers in this study. Besides, the manure deposited by the animals during grazing could not be collected which also explains the lower quantities of collected manure in this study. Manure nitrogen and phosphorus contents were similar for both control and treatment groups except in the wet season when the nitrogen content was higher for the feed-health group than the control. The values of nitrogen and phosphorus concentration in the manure found in this study were much higher than those reported by Ayantunde et al. ( 2007) from feeding trials with sheep fed on groundnut haulms as supplement in the early dry season in Niger. In their study, the nitrogen concentration ranged from 10.7-12.8 g/kg DM and the phosphorus concentration ranged from 1.9-2.8 g/kg DM. The higher values could be partly attributed to better quality feed in southern Mali than the millet straw as basal feed and groundnut haulms as supplement used in the feeding trials by Ayantunde et al. (2007) as high nutrient feed will generally result in higher nutrient content of the manure (Ayantunde et al. 2018)."},{"index":2,"size":99,"text":"In addition, the higher values obtained in this study could be attributed to contamination as manure collected might have been contaminated by urine, feedstuffs offered to the animals and dust. Given that manure collected by the households for application to the crop field is often a mixture of faeces and urine, our results give an indication of nutrients that may return to the soil. Higher manure nitrogen and phosphorus outputs were observed for manure collected by the households under the feed-health intervention than those in the control group which again confirms that better nutrition results in better manure quality."},{"index":3,"size":167,"text":"The results on repartition of manure collected per household flock and per animal are presented in Figure 5 and Figure 6. The results showed that the quantity of manure collected per household per day tended to increase linearly from September 2016 to August 2017 for the feed-health group while it remained almost the same for the households in the control group (Figure 5). When expressed as quantity collected per animal per day, the quantity collected was between 100-120 g DM/animal/day for the feed-health group while the values for the control group were between 80-100 g DM/animal/day (Figure 6). In view of the importance of animal manure for soil fertility in West African Sahel, the more manure that could be collected, the better for the smallholder farmers as manuring leads to increased crop yield (Ayantunde et al. 2018). The main challenge is maintaining the appropriate number of animals to provide adequate manure.  A farmer spreading manure collected from his flock on the crop field (photo credit: Clarisse Umutoni/ILRI)."}]},{"head":"Nutritional quality of the available feed resources","index":14,"paragraphs":[{"index":1,"size":73,"text":"Apart from the natural pastures, the other major feed resources found in the study sites were crop residues, agro-industrial by-products and browses. The common crop residues included sorghum stover, cotton straw, cowpea hay and groundnut haulms (Table 5) while the agro-industrial by-products were cotton seed cake and maize bran. Cotton seed cake had the highest crude protein among the feed resources offered to sheep and goats by the farmers in the two treatments."},{"index":2,"size":206,"text":"The legume residues (cowpea hay and groundnut haulm) were also high in crude protein and in vitro organic matter digestibility. The browses (leaves of shrubs and trees) are important feed resources in the late dry season when there is feed scarcity (Umutoni et al. 2015) and they generally have high crude protein content, but they are high in lignin content (Table 5). The values of crude protein content of the cowpea hay and groundnut haulm in this study were higher than those reported by Umutoni et al. (2015) which could be attributed to period of collection of the feed samples and the associated differences in the leaf: stem ratio. The legume residues like cowpea hay and groundnut haulms are normally collected and stored and used to feed household animals in the dry season or sometimes sold as the prices are often high (Ayantunde et al. 2014). The cereal straws are normally left on the crop field to be grazed by the animals. However, some farmers collect and store them at homestead to feed their flock. The quantity and quality of feed resources available decreased as the dry season progressed. Also, the importance of crop residues decreased as the dry season progressed while that of browse increased. "}]},{"head":"Partial cost and benefit analysis","index":15,"paragraphs":[{"index":1,"size":248,"text":"The results of a partial cost and benefit analysis of the control and feed-health intervention showed that the net return from the intervention was significantly higher than for the control (Table 6). The annual net return for the treatment was 95,349±25,388 FCFA per household compared to 88,575±8,693 FCFA per household. The sources of revenue were weight gained, manure collected and animal sale (offtake; Table 6) while the costs were associated with veterinary care and feed cost. The results showed that traditional small ruminant production with low inputs is profitable provided there is no major disease outbreak, which could explain the reason for widespread rearing of small ruminants by smallholder farmers. However, the farmers can generate more revenue through small ruminant production by providing supplementary feed and healthcare for their animals. For households with a large flock size, it is prudent and profitable to provide supplementary feed and standard healthcare (vaccination against PPR and pasteurellosis, deworming and curative measures) to their animals as the risk is high of losing most of the animals in the event of major disease outbreak like PPR with reported mortality rate of 80%  (2011) were to be adjusted to the flock size in our study, the annual profits in our study will be higher than the returns from dairy sheep and goats. Our results confirm that feed and health interventions to improve small ruminant production are profitable. Providing an enabling environment for veterinary services is critical for ensuring farmers can access animal health services. "}]},{"head":"Feedback from the farmers about the pilot study","index":16,"paragraphs":[{"index":1,"size":134,"text":"To assess the impression of the participating farmers of the pilot study in both study communities, a meeting was organized on 31 October 2017 and 1 November 2017 in Sirakelé and Zanzoni, respectively. Farmers in Sirakelé expressed their gratitude to the project for the pilot study through which their flocks were provided with cotton seed cake and healthcare. They were really happy for the positive effects of the feed and health intervention on the performance of their animals. They observed that after one year of the study they have seen tremendous improvement in the body weight of their animals and in their flock sizes. Many said their flock size doubled or even tripled. They noted that the way their flock increased rapidly suggested that they could depend on small ruminant rearing for their livelihood."},{"index":2,"size":209,"text":"Specific benefits from the feed and health intervention according to the participating farmers in Sirakelé included drastic reduction in mortality rate, increase in birth rate, additional household income through increased offtake, increased body weight, and high quantity of manure collected. In addition, their knowledge of management of small ruminants improved through the training provided by the project. On the improved small ruminant husbandry, they acquired knowledge on animal healthcare, particularly awareness of the need for vaccination against different diseases and the importance of deworming. They also stated that they acquired knowledge on how to feed their sheep and goats to improve their body weight development. Further, as result of the study, they realized that they could collect significant amount of manure from their animals and this has led some of them to start building pens or hangars for their animals. Farmers in Sirakelé they had not been really interested in small ruminant rearing before as it was considered as activity for women but after one year of the study, they have realized the great potential small ruminant rearing can contribute to their family wellbeing. As a result of this, most of them said that they will continue with the vaccination of their animals and with provision of supplementary feed."},{"index":3,"size":11,"text":"Group discussion with participating farmers in Sirakele (photo credit: Clarisse Umutoni/ILRI)."},{"index":4,"size":13,"text":"Picture 5: Group discussion with participating farmers in Zanzoni (photo credit: Clarisse Umutoni/ILRI)."},{"index":5,"size":122,"text":"The farmers in the control group in Zanzoni were not enthusiastic about the project because there were no interventions in their village. The project gave a 50 kg bag of rice to each household towards the end of the study for their participation. The farmers reported high mortality rate in their flock and the constraint of feed availability, especially during the rainy season when they had to tether their animals and feed them at home to avoid damage to their crops. However, the farmers said that the study raised their awareness on the potential of collecting large amount of manure from small ruminant rearing for their crop fields. The daily collection of manure also made them clean the animal pens and sheds."},{"index":6,"size":112,"text":"The feedback from farmers in both Sirakelé and Zanzoni suggests that building their capacity in animal husbandry is essential to improving small ruminant production in mixed crop and livestock systems in Mali and in other Sahelian countries in West Africa. Also building awareness of the benefits of small ruminant rearing can motivate farmers to invest in better management of their flocks. For example, construction of pens or hangars for housing the animals will facilitate collection of animal manure for application for crop farming. Extension services, which are weak in Mali and in other countries in the region, need to be strengthened to build the capacity of the farmers in improved animal husbandry."}]}],"figures":[{"text":" Ben Salem and Smith 2008; Nantoume et al. 2011; Konlan et al. 2017). Combining health and feed interventions will lead to a better animal performance than a single technology. Based on our experience and promising results from feed and health interventions for improved small ruminant production in Ghana under the Africa RISING project (Avornyo et al. 2015; Konlan et al. 2017), a pilot study was initiated in Mali involving combined feed and health interventions in two Africa RISING intervention communities in Koutiala District in the southern region of Mali. "},{"text":"Figure 1 : Figure 1: Flock growth of households under control and feed-health intervention in Zanzoni and Sirakelé, in Koutiala District during one year of monitoring. "},{"text":"Figure 2 : Figure 2: Number of birth in household flock under control and feed-health intervention in Zanzoni and Sirakelé, in Koutiala District. "},{"text":"Figure 3 : Figure 3: Number of death in household flock under control and feed-health intervention in Zanzoni and Sirakelé, in Koutiala District. "},{"text":"Figure 4a : Figure 4a: Weight development of sheep under control and feed-health intervention from 1 to 12 months in Zanzoni and Sirakelé, Koutiala District. "},{"text":"Figure 4b : Figure 4b: Weight development of goats under control and feed-health intervention from 1 to 12 months in Zanzoni and Sirakele, Koutiala Districts. "},{"text":"Figure 5 : Figure 5: Manure collected per day per household (g DM/day/household) by farmers from sheep and goats under control and feed-health intervention groups. "},{"text":"Figure 6 : Figure 6: Manure collected per animal per day (g DM/animal/day) by farmers from sheep and goats under control and feed-health intervention groups. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 : Household flock composition (mean ± standard error) at the beginning (August 2016) and at the end of the study (July 2017) in Zanzoni (control) and Sirakelé (feed-health intervention) in Koutiala District Variable Control (n=20) Feed-health (n=20) VariableControl (n=20)Feed-health (n=20) Beginning of the study   Beginning of the study (August 2016)   (August 2016)  Sheep  Sheep Average number of male 0.75±0.33 a 1.10±0.25 a Average number of male0.75±0.33 a1.10±0.25 a Average number of female 3.15±0.69 a 4.20±0.70 a Average number of female3.15±0.69 a4.20±0.70 a Average total flock 3.90±0.82 a 5.30±0.81 a Average total flock3.90±0.82 a5.30±0.81 a  Goat  Goat Average number of male 0.50±0.20 a 1.60±0.42 b Average number of male0.50±0.20 a1.60±0.42 b Average number of female 3.70±0.81 a 5.15±0.97 a Average number of female3.70±0.81 a5.15±0.97 a Average total flock 4.20±0.97 a 6.75±1.24 a Average total flock4.20±0.97 a6.75±1.24 a End of the study   End of the study (July 2017)   (July 2017)  Sheep  Sheep Average number of male 0.65±0.22 a 5.20±0.93 b Average number of male0.65±0.22 a5.20±0.93 b Average number of female 2.95±0.73 a 6.70±0.93 b Average number of female2.95±0.73 a6.70±0.93 b Average total flock 3.60±0.84 a 11.90±1.56 b Average total flock3.60±0.84 a11.90±1.56 b  Goat  Goat Average number of male 1.15±0.33 a 3.90±0.89 b Average number of male1.15±0.33 a3.90±0.89 b Average number of female 3.45±0.72 a 8.80±1.35 b Average number of female3.45±0.72 a8.80±1.35 b Average total flock 4.60±0.99 a 12.70±2.04 b Average total flock4.60±0.99 a12.70±2.04 b  "},{"text":"Table 2 : Flock dynamic of sheep and goats under control (Zanzoni village) and feed-health intervention (Sirakelé village) between August 2016 and August 2017 Variable Control (n=20) Feed-health (n=20) VariableControl (n=20)Feed-health (n=20) Average number of birth per household 5.72±2.10 a 15.20±3.41 b Average number of birth per household5.72±2.10 a15.20±3.41 b Birth rate (%) 69.9±3.4 a 126.7±4.9 b Birth rate (%)69.9±3.4 a126.7±4.9 b Mortality rate (%) 30.4±2.7 a 13.3±3.1 b Mortality rate (%)30.4±2.7 a13.3±3.1 b Offtake rate (%) 30.4±2.9 a 38.8±3.1 b Offtake rate (%)30.4±2.9 a38.8±3.1 b Average price per animal sold (FCFA) 19,777±841 a 24,887±964 b Average price per animal sold (FCFA)19,777±841 a24,887±964 b Average income from animal sale per 38,537±7,560 a 169,125±26,545 b Average income from animal sale per38,537±7,560 a169,125±26,545 b household (FCFA)   household (FCFA) Average number of animal purchased per 0.02±0.01 a 0.34±0.04 a Average number of animal purchased per0.02±0.01 a0.34±0.04 a household   household Average number of animal slaughtered for 0.04±0.02 a 0.09±0.02 a Average number of animal slaughtered for0.04±0.02 a0.09±0.02 a consumption per household   consumption per household Average number of animal given out as 0.04±0.01 a 0.03±0.01 a Average number of animal given out as0.04±0.01 a0.03±0.01 a gift/caretaking per household   gift/caretaking per household Average number of animal received for 0.01±0.01 a 0.08±0.03 a Average number of animal received for0.01±0.01 a0.08±0.03 a caretaking per household   caretaking per household Average number of animal lost to theft per 0.03±0.01 a 0.04±0.02 a Average number of animal lost to theft per0.03±0.01 a0.04±0.02 a household   household  "},{"text":"Table 3 : Weight changes of goats and sheep over a one-year period under control and feedhealth intervention in Zanzoni and Sirakelé, Koutiala District Variable Control  Feed-health VariableControlFeed-health Goats     Goats  n Mean ± se n Mean ± se nMean ± senMean ± se Weight at 1 month (kg) 10 2.45±0.16 a 36 2.62±0.09 a Weight at 1 month (kg)102.45±0.16 a362.62±0.09 a Weight at 3 months (kg) 36 5.65±0.17 a 101 5.71±0.13 a Weight at 3 months (kg)365.65±0.17 a1015.71±0.13 a Weight at 1 year (kg) 14 12.89±0.80 a 36 16.78±0.34 b Weight at 1 year (kg)1412.89±0.80 a3616.78±0.34 b Average daily gain (g/day) 131 22.59±2.29 a 311 42.98±3.28 b Average daily gain (g/day)13122.59±2.29 a31142.98±3.28 b Sheep     Sheep  n Mean ± se n Mean ± se nMean ± senMean ± se Weight at 1 month (kg) 6 2.92±0.27 a 10 3.00±0.13 a Weight at 1 month (kg)62.92±0.27 a103.00±0.13 a Weight at 3 months (kg) 15 7.23±0.39 a 34 6.75±0.22 a Weight at 3 months (kg)157.23±0.39 a346.75±0.22 a Weight at 1 year (kg) 3 18.5±0.76 a 17 22.34±0.88 b Weight at 1 year (kg)318.5±0.76 a1722.34±0.88 b Average daily gain (g/day) 117 16.58±2.74 a 225 47.12±2.73 b Average daily gain (g/day)11716.58±2.74 a22547.12±2.73 b  "},{"text":"Table 4 . Collected manure by households under control and feed-health intervention from experimental sheep and goats between September 2016 and August 2017 in Zanzoni and Sirakele in Koutiala District. Variable Control Feed-health VariableControlFeed-health Early dry season (Oct-Jan)   Early dry season (Oct-Jan) Collected manure-g DM/day/household 815±46 a 1729±65 b Collected manure-g DM/day/household815±46 a1729±65 b Collected manure-g DM/animal/day 96.12±3.78 a 119.72±4.55 b Collected manure-g DM/animal/day96.12±3.78 a119.72±4.55 b Collected manure-g DM/day/animal/kg live 5.14±0.19 a 5.88±0.24 a Collected manure-g DM/day/animal/kg live5.14±0.19 a5.88±0.24 a weight   weight Nitrogen concentration (g/kg DM) 20.95±0.31 a 21.35±0.29 a Nitrogen concentration (g/kg DM)20.95±0.31 a21.35±0.29 a Phosphorus concentration (g/kg DM) 3.76±0.13 a 4.96±0.14 b Phosphorus concentration (g/kg DM)3.76±0.13 a4.96±0.14 b Manure nitrogen output (g/day) 16.48±0.81 a 37.03±1.47 b Manure nitrogen output (g/day)16.48±0.81 a37.03±1.47 b Manure phosphorus output (g/day) 2.81±0.14 a 8.64±0.43 b Manure phosphorus output (g/day)2.81±0.14 a8.64±0.43 b Manure nitrogen output (g/animal/day) 1.98±0.07 a 2.57±0.10 a Manure nitrogen output (g/animal/day)1.98±0.07 a2.57±0.10 a Manure phosphorus output (g/animal/day) 0.35±0.02 a 0.60±0.03 a Manure phosphorus output (g/animal/day)0.35±0.02 a0.60±0.03 a Late dry season (Feb-May)   Late dry season (Feb-May) Collected manure-g DM/day/household 891±49 a 2392±104 b Collected manure-g DM/day/household891±49 a2392±104 b Collected manure-g DM/animal/day 102±4.06 a 121.52±4.52 b Collected manure-g DM/animal/day102±4.06 a121.52±4.52 b Collected manure-g DM/day/animal/kg live 5.67±0.20 a 5.68±0.21 a Collected manure-g DM/day/animal/kg live5.67±0.20 a5.68±0.21 a weight   weight Nitrogen concentration (g/kg DM) 21.15±0.39 a 20.89±±0.34 a Nitrogen concentration (g/kg DM)21.15±0.39 a20.89±±0.34 a Phosphorus concentration (g/kg DM) 3.89±0.15 a 3.74±0.19 a Phosphorus concentration (g/kg DM)3.89±0.15 a3.74±0.19 a Manure nitrogen output (g/day) 18.74±1.04 a 50.51±2.60 b Manure nitrogen output (g/day)18.74±1.04 a50.51±2.60 b  "},{"text":"Table 5 : Chemical composition of the main feed resources for ruminants in Zanzoni and Sirakele in Koutiala District (% on a dry matter basis). Feed type OM CP NDF ADF ADL IVOMD ME(MJ/kg DM) Feed typeOMCPNDFADFADLIVOMDME(MJ/kg DM) Crop residues        Crop residues Cowpea hay (leaves and stems) 88.46 19.06 36.06 24.57 5.65 72.03 9.83 Cowpea hay (leaves and stems)88.4619.0636.0624.575.6572.039.83 Groundnut haulm (leaves and stems) 88.67 16.30 54.69 44.22 9.32 61.63 8.85 Groundnut haulm (leaves and stems)88.6716.3054.6944.229.3261.638.85 Cotton straw (leaves and stems) 95.74 13.01 47.42 20.79 6.09 71.21 9.47 Cotton straw (leaves and stems)95.7413.0147.4220.796.0971.219.47 Sorghum stover (leaves and stems) 94.41 4.23 71.59 46.29 6.38 51.91 7.68 Sorghum stover (leaves and stems)94.414.2371.5946.296.3851.917.68 Agro by-product        Agro by-product Cotton seed cake 89.33 25.15 65.28 43.54 8.35 71.04 9.73 Cotton seed cake89.3325.1565.2843.548.3571.049.73 Maize bran 94.13 16.15 42.19 10.08 1.97 74.64 10.44 Maize bran94.1316.1542.1910.081.9774.6410.44 Herbage        Herbage Cenchrus biflorus 85.28 17.78 49.79 34.31 7.13 65.76 8.96 Cenchrus biflorus85.2817.7849.7934.317.1365.768.96 Browse        Browse Vitellaria paradoxa (leaves) 90.43 11.15 41.09 32.79 12.64 58.56 8.69 Vitellaria paradoxa (leaves)90.4311.1541.0932.7912.6458.568.69 Sclerocarya birrea (leaves) 93.67 14.98 45.28 44.88 18.27 41.06 6.25 Sclerocarya birrea (leaves)93.6714.9845.2844.8818.2741.066.25 Guiera senegalensis (leaves) 96.69 10.97 49.11 43.43 14.89 55.77 8.62 Guiera senegalensis (leaves)96.6910.9749.1143.4314.8955.778.62 Ziziphus mauritiana (leaves) 93.77 17.76 45.28 30.87 8.77 64.99 9.70 Ziziphus mauritiana (leaves)93.7717.7645.2830.878.7764.999.70 Saba senegalensis (leaves) 90.07 10.12 36.36 28.47 12.69 51.46 7.86 Saba senegalensis (leaves)90.0710.1236.3628.4712.6951.467.86 OM: Organic matter; CP: crude protein; NDF: neutral detergent fibre; ADF: acid detergent fibre; ADL: acid detergent lignin; IVOMD: In vitro organic matter digestibility; OM: Organic matter; CP: crude protein; NDF: neutral detergent fibre; ADF: acid detergent fibre; ADL: acid detergent lignin; IVOMD: In vitro organic matter digestibility; ME: metabolizable energy.        ME: metabolizable energy.  "},{"text":" Fodder trees and shrubs play an important role in ruminant nutrition in the late dry season from March to May (Ickowicz and Mbaye 2001). The preference for browse species varied according to season and animal species. The goats tended to prefer browses compared to sheep; hence, browses form a significant proportion of goat diets during the late dry season (Zampaligré et al. 2013).  "},{"text":" (Ba et al. 1996). The annual profits reported in this study were lower than the annual profits obtained from 100 dairy sheep of 362,700 FCFA and 476,400 FCFA for 100 dairy goats in a study byNantoume et al. (2011)  in Kaye region of Mali. If annual profits reported by Nantoume et al.  "},{"text":"Table 6 : Partial cost and benefit analysis (FCFA/household/year) of control and feed-health intervention of small ruminants in Zanzoni and Sirakele in Koutiala District for 1 year. Variable Control (n=20) Feed-health (n=20) VariableControl (n=20)Feed-health (n=20) Revenue from weight gains 46,596±3,364 a 241,058±14,189 b Revenue from weight gains46,596±3,364 a241,058±14,189 b Revenue from manure collected 5,886±519 a 15,474±844 b Revenue from manure collected5,886±519 a15,474±844 b Revenue from animal sale 38,537±7,560 a 169,125±26,549 b Revenue from animal sale38,537±7,560 a169,125±26,549 b Gross return 91,020±8,738 a 425,657±34,961 b Gross return91,020±8,738 a425,657±34,961 b Supplement (cotton seed cake) cost 0 a 300,988±17,717 b Supplement (cotton seed cake) cost0 a300,988±17,717 b Veterinary cost 2,445±176 a 29,320±1,725 b Veterinary cost2,445±176 a29,320±1,725 b Total cost 2,445±176 a 330,308±19,442 b Total cost2,445±176 a330,308±19,442 b Net return 88,575±8,693 a 95,349±25,388 a Net return88,575±8,693 a95,349±25,388 a  "}],"sieverID":"ad04617f-4b38-4a77-8445-30c9dda61e59","abstract":""}

data/part_2/00d92a25629af22956de018ca15d02cc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00d92a25629af22956de018ca15d02cc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e3299ee5-4ebb-44bd-b066-571b8c83dabe/retrieve"},"pageCount":1,"title":"Promotion of Energy Efficient and Water Saving Technologies for Smallholder Irrigation","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":2,"text":"Results/Achievements Method/Approaches"},{"index":2,"size":25,"text":"• Implantation of solar pump irrigation in 16 districts in Oromia, SNNPR, Amhara and Tigray • Follow up survey • Impact evaluation using Difference-in-Difference approach."},{"index":3,"size":3,"text":"Plan for 2019"},{"index":4,"size":50,"text":"• The feasibility of solar pump depends on the method of water application, crop type, land size and discount rate. • As compared to furrow and overhead water delivery systems, drip system is more productive and less labor intensive (Table 2). • Investment in solar pump is feasible and worthy."},{"index":5,"size":14,"text":"• Solar powered water pumping is in line with the Ethiopian Government's CRGE strategy."},{"index":6,"size":2,"text":"The www.africa-rising.net"}]},{"head":"Key challenges and lessons","index":2,"paragraphs":[{"index":1,"size":36,"text":"We thank farmers and local partners in Africa RISING and other sites, ATA, WLE and IWMI for their contributions to this research. We also thank USAID for its financial support through the Feed the Future Initiative."}]},{"head":"Acknowledgement","index":3,"paragraphs":[{"index":1,"size":89,"text":"During PHASE I, Africa RISING (AR) project has tested and piloted solar pump based water lifting for smallholder's irrigation. This was linked and tested with different water delivery and application systems to test which application methods lead to most efficient and maximum benefits. Following AR-PHASE I, the Agricultural Transformation Agency (ATA) has taken an initiative to pilot solar based irrigation. Hence, knowledge created through PHASE II of AR will be used to support ATA's initiative to further out scale solar pump beyond the current plan of 14 pilot districts."},{"index":2,"size":55,"text":"MoU is initiated between IWMI and ATA. AR-IWMI will contribute through research, knowledge sharing, monitoring and evaluation (M&E) and capacity building. A stratified sampling technique was employed to select respondents for a base line survey. The study population includes rural hhs in 6 SNNP woredas and 2 woredas each in Oromia, Amhara and Tigray regions. "}]}],"figures":[{"text":" Africa Research In Sustainable Intensification for the Next Generation (Africa RISING) program comprises three research-fordevelopment projects supported by the United States Agency for International Development as part of the U.S. government's Feed the Future initiative. Through action research and development partnerships, Africa RISING will create opportunities for smallholder farm households to move out of hunger and poverty through sustainably intensified farming systems that improve food, nutrition, and income security, particularly for women and children, and conserve or enhance the natural resource base. The three projects are led by the International Institute of Tropical Agriculture (in West Africa and East and Southern Africa) and the International Livestock Research Institute (in the Ethiopian Highlands). The International Food Policy Research Institute leads an associated project on monitoring, evaluation and impact assessment. "},{"text":"Table 1 . Number of surveyed sample households.• Solar pump irrigation is new and expensive to afford for rural households in Ethiopia. • Access to credit and financing is a problem.• Lack of knowledge is constraining factor.• Lengthy procumbent procedure cause delay to implement/pilot the technology. Region No. of target hhs Diesel Manua Only Total RegionNo. of target hhsDieselManuaOnlyTotal  for solar pump Pump l Pump Rainfed sample hhs Parameters for solar pumpPumpl PumpRainfedsample hhsParameters Oromia 28 28 28 28 112 Oromia28282828112 SNNPR 72 72 72 72 288 SNNPR72727272288 Amhara 40 40 40 40 160 Amhara40404040160 Tigray 20 20 20 20 80 Tigray2020202080 Total 160 160 160 160 640 Total160160160160640  "},{"text":"Drip Furrow Demonstration plot (m 2 ) 200 200 Amount of water used m3/demonstration plot 52 105 Amount of water m3/ha 2600 5266  Pumping capacity l/second 0.5 0.5 Pumping capacity l/second0.50.5 Total discharge l/hr. 1800 1800 Total discharge l/hr.18001800 Total discharge m3/day 14 14 Total discharge m3/day1414 Cropping season (days) 80 80 Cropping season (days)8080 Total discharge m3/season 1152 1152 Total discharge m3/season11521152 Potential irrigable land (m2) 4431 2188 Potential irrigable land (m2)44312188  "},{"text":"Table 2 . Comparison of drip and furrow irrigation.  "}],"sieverID":"adef88fd-aac0-4f4d-a140-e36f0748c9d4","abstract":""}

data/part_2/017d4f137689e9de8aaa76a8d474254e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"017d4f137689e9de8aaa76a8d474254e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/da4d4d6f-5003-430d-9589-d9c4cf4f6a39/retrieve"},"pageCount":48,"title":"","keywords":[],"chapters":[{"head":"Partnerships","index":1,"paragraphs":[]},{"head":"1.","index":2,"paragraphs":[{"index":1,"size":9,"text":"Animal health: core group-Malaysia, Thailand, India, China, Bangladesh 2."},{"index":2,"size":20,"text":"Animal genetic resources: core group-Vietnam, Philippines, Sri Lanka, Nepal, India, Bangladesh This work will be done in collaboration with FAO"}]},{"head":"3.","index":3,"paragraphs":[{"index":1,"size":34,"text":"Feed resources: core group-China, Bangladesh, Philippines, Indonesia, Vietnam, Bhutan Time frame Research methodologies and priority setting: multidisciplinary and systems approach, diagnostic and ex ante/ex post assessments, providing tools for priority setting and resource allocation."}]},{"head":"2.","index":4,"paragraphs":[{"index":1,"size":20,"text":"Policy and socio-economics: national/regional/international livestock development, trade and marketing, poverty alleviation and natural resource base, need to influence policy makers."}]},{"head":"3.","index":5,"paragraphs":[{"index":1,"size":16,"text":"Technology transfer: process (not products) for extension/user linkages (two-way process linkages to research methodologies and priorities."}]},{"head":"4.","index":6,"paragraphs":[{"index":1,"size":28,"text":"Training: build new capacity, strengthen existing capacity, relevant training driven by research needs and built on existing expertise and facilities of region, training materials to support national/regional training."}]},{"head":"5.","index":7,"paragraphs":[{"index":1,"size":20,"text":"Information: lack of information and relevant information at all levels (researchers, extension staff and farmers), build on existing national/regional resources."}]},{"head":"6.","index":8,"paragraphs":[{"index":1,"size":24,"text":"Networking: review recent/existing networks to build on positive experiences, sustainable networking with clear objectives and subject focus to allow resource sharing and joint funding."}]},{"head":"Building partnerships","index":9,"paragraphs":[{"index":1,"size":2,"text":"Objective 1."},{"index":2,"size":11,"text":"Maximising NARS-ILRI research benefits and transfer of technologies through effective partnerships."}]},{"head":"2.","index":10,"paragraphs":[{"index":1,"size":18,"text":"Building on existing mechanisms for partnerships (hence need to audit existing activities and facilities before planning new activities). "}]},{"head":"Issues and actions","index":11,"paragraphs":[{"index":1,"size":1,"text":"1."}]},{"head":"Provision of information and knowledge","index":12,"paragraphs":[{"index":1,"size":40,"text":"• Audit existing information resources and services for animal agriculture in Asia. To be co-ordinated by ILRI with information from in-country/regional contacts. • Establish 'network' of information resources and services to provide scientists with access to information on animal agriculture."},{"index":2,"size":23,"text":"• Develop, maintain and distribute database of literature on Asian animal agriculture. First version in 1998, produced by ILRI and in-country/regional information systems."},{"index":3,"size":14,"text":"• Collect non-conventional literature relating to animal agriculture. To be done in selected countries."},{"index":4,"size":20,"text":"• Produce knowledge products for researchers and trainers based on research results of NARS-ILRI research in Asia and existing information."}]},{"head":"Training","index":13,"paragraphs":[{"index":1,"size":55,"text":"• Audit existing training activities/facilities for animal agriculture in Asia. To be co-ordinated by ILRI with information from in-country/regional sources. • Establish regional training courses to strengthen existing research capacity for NARS-ILRI collaborative research. Topics driven by needs of research (see 'Time frame' below). Using regional training facilities, and trainers from the region and ILRI."},{"index":2,"size":16,"text":"• Training materials development, based on regional training courses, to support other national/ regional training activities."},{"index":3,"size":24,"text":"• Graduate training-degree-related research projects within ongoing NARS-ILRI collaborative research, with students registered at universities within region, and supervision by national and ILRI scientists."}]},{"head":"3.","index":14,"paragraphs":[]},{"head":"Networking","index":15,"paragraphs":[{"index":1,"size":33,"text":"• Audit existing and recently closed networks having partial or whole focus on livestock. Determine possible entry point for ILRI into existing network(s). To be co-ordinated by ILRI with information from in-country/regional contacts."}]},{"head":"4.","index":16,"paragraphs":[{"index":1,"size":37,"text":"South-south exchange • Establish annual programme of 3-4 day seminars leading to exchange of experiences and knowledge. Proceedings of each seminar to be published. First seminar proposed on small-holder dairy production and marketing in Asia and Africa."}]},{"head":"Nature of partnerships","index":17,"paragraphs":[{"index":1,"size":1,"text":"1."},{"index":2,"size":5,"text":"Partnerships to be established with:"},{"index":3,"size":8,"text":"• international organisations (e.g. FAO, OIE, WHO etc)"},{"index":4,"size":5,"text":"• other international research centres"},{"index":5,"size":3,"text":"• regional organisations"},{"index":6,"size":6,"text":"• national ministries, universities, research institutes"},{"index":7,"size":4,"text":"• funding agencies 2."},{"index":8,"size":3,"text":"Partnerships built around:"},{"index":9,"size":8,"text":"• shared goals, defined objectives and agreed benefits"},{"index":10,"size":7,"text":"• shared resources (human, physical and financial)"},{"index":11,"size":10,"text":"• open communication based on agreed tasks and time frames"}]},{"head":"• clear facilitation","index":18,"paragraphs":[]},{"head":"Prioritised list of areas for training courses","index":19,"paragraphs":[{"index":1,"size":1,"text":"1."},{"index":2,"size":20,"text":"List of possible areas for training courses were drawn up by participating countries, to support the NARS-ILRI research being planned."}]},{"head":"2.","index":20,"paragraphs":[{"index":1,"size":4,"text":"In order of priority:"},{"index":2,"size":13,"text":"• animal genetic resources/biodiversity (to be planned and delivered in collaboration with FAO)"},{"index":3,"size":6,"text":"• farming systems research with livestock"},{"index":4,"size":127,"text":"• feed and feed management; feed utilisation and budgeting; forage genetic resources; rumen microbiology • animal health and disease epidemiology; disease diagnostics I am very happy to know that in 1996 the International Livestock Research Institute conducted an assessment of livestock development needs and research priorities in Asia and that in this important conference scientists and policy makers from Asia will evaluate the ILRI recommendations as well as present their own governments' views on livestock development. I suppose this is a good chance for the representatives to exchange their experience and ideas for livestock development directions. At the same time the conference will create opportunities for strengthening co-operation and understanding between the countries in the continent in general, and between the country members and ILRI in particular."},{"index":5,"size":51,"text":"The Vietnamese Government and people have been implementing an economic renovation policy step-by-step to industrialise and modernise agricultural activities, including livestock production. We are promoting agricultural diversification, encouraging and developing animal husbandry by smallholders to meet increasing demand of animal products, and to create more jobs and increase income for farmers."},{"index":6,"size":45,"text":"Recognising the importance of science and technology, the Vietnamese Government has adopted the policy of facilitating the contribution of scientists, including livestock scientists, to the country. We attach the utmost importance to staff training and to exchanges of experience, especially with you, our international friends."},{"index":7,"size":63,"text":"On this occasion, I would like to express my sincere thanks to the Consultative Group for International Agricultural Research (CGIAR), ILRI and ILRI's General Director for initiating this important meeting. I would also like to thank the participants for visiting our beautiful country. I know you will develop a good impression of our hospitality and friendship in a very short and valuable time."},{"index":8,"size":41,"text":"I hope that after this important conference, the co-operation between countries in Asia in livestock development and research will be strengthened, and that the livestock industries will be developed for the prosperity of each country and for better lives for farmers."},{"index":9,"size":33,"text":"Finally, I would like to wish all distinguished guests and representatives every success in your discussions. I trust that the conference will be worth while. I am pleased to declare this conference open."},{"index":10,"size":2,"text":"Thank you. "}]},{"head":"Research priorities in individual countries","index":21,"paragraphs":[{"index":1,"size":85,"text":"This section presents the research priorities in individual countries that were made at the conference. They highlight the relevance to these countries of the research priorities recommended for ILRI in Asia. Some countries have re-emphasised the main constraints and major issues to livestock improvement, and these are indicated. Others have indicated ways in which their countries might participate in collaborative research. China also identified ten research projects relevant to South China which ILRI should participate in, and also indicated matching funds from the national programmes."}]},{"head":"Bangladesh","index":22,"paragraphs":[{"index":1,"size":2,"text":"Research priorities   "}]},{"head":"Research institutes suggested by the China Academy of Agricultural Sciences (CAAS) for co-operation with ILRI","index":23,"paragraphs":[]},{"head":"India","index":24,"paragraphs":[{"index":1,"size":87,"text":"Research priorities and future programmes -Land use pattern in diverse agro-ecological zones -Protection of soil erosion from natural or man-made calamities -Study of proper and hygienic waste management -Proper and efficient use of surface and ground water for quality production -Selection of plant species for aforestation that grow faster and provide sufficient fodder, fuel and housing materials -Selection and conservation of disease-resistant, hardy, dual-purpose breeds for sustainability of livestock production -Integration of efforts of the various national/international agencies for better protection of these scarce resources -Political commitment"}]},{"head":"Philippines","index":25,"paragraphs":[{"index":1,"size":2,"text":"Research priorities "}]},{"head":"Collaboration with ILRI","index":26,"paragraphs":[{"index":1,"size":27,"text":"The Philippines is committed to collaborating with ILRI through the Philippine Council for Agriculture, Forestry and Natural Resources Research and Development (PCARRD), particularly in the following areas:"},{"index":2,"size":20,"text":"• Biotechnology for the improvement of the carabao (water and riverine buffaloes). The Philippine Carabao Center is the lead institution."}]},{"head":"•","index":27,"paragraphs":[{"index":1,"size":17,"text":"Breeding and genetics on the improvement, use and conservation of priority livestock resource other than the carabao."}]},{"head":"•","index":28,"paragraphs":[{"index":1,"size":18,"text":"The development of production strategies for small ruminants as a business enterprise particularly when raised under coconut farms."}]},{"head":"•","index":29,"paragraphs":[{"index":1,"size":37,"text":"The Philippine livestock NARS is well organised with specific mandates and roles among the members of the network. The medium-term research and development (R&D) plan is focused and the limited resources are directed to address priority needs."}]},{"head":"•","index":30,"paragraphs":[{"index":1,"size":46,"text":"The Agriculture Commission, created and based at the House of Senate, has almost completed its task of identifying needs to modernise agriculture. The Commission recognises the role of research and development for food production and national development. The livestock sector is a beneficiary in this exercises"}]},{"head":"Sri Lanka","index":31,"paragraphs":[{"index":1,"size":2,"text":"Major issues "}]},{"head":"Animal genetic resources in Asia","index":32,"paragraphs":[]},{"head":"T. Irvin","index":33,"paragraphs":[{"index":1,"size":132,"text":"Concern about reduction in genetic diversity has been expressed primarily in terms of loss of breeds and strains. For the common livestock species such as cattle, sheep, goats and pigs, especially in the developed world, breeds are well defined and recognised as distinct intraspecific groups, the members of which share particular characteristics which distinguish them from other such groups, and formal organisations usually exist for each breed or breed group. In the developing world, breeds are not generally clearly defined in this way, yet there exist strains or geographically separated populations with potential for exploitation because of desirable traits such as disease resistance, adaptation to poor quality feeds or heat tolerance. Any selection or conservation of such strains or breeds will require characterisation to elucidate the unique genetic resources that are available."},{"index":2,"size":244,"text":"Molecular genetic techniques, particularly those based on analysis at the DNA level, are the most accurate means of genetic characterisation. Complete characterisation of the different animal types must involve estimation of the genetic diversity and micro-evolutionary relationships through description of their genetic profiles. This will provide information as to which of these populations represent homogeneous breeds/strains and which of them are different. Such knowledge will enable decision-making regarding the choice of breeds for selection and conservation. Additionally, such genetic analysis could facilitate identification of genetic duplicates and/or separation of breeds on the basis of genetic distinctiveness. Pairwise genetic distances estimated among breeds/strains/populations of a species, and the single phylogeny constructed from these distances that best represents all the relationships among the breeds will aid objective and rational decision making in the choice of breeds for preservation, for utilisation and for evaluation studies to determine comparative genetic merit. Characterisation of the breeds in this way can then lead to identification of traits which may have potential for enhancing improved productivity. It is then possible to identify the genetic basis of these traits, phenotypic markers associated with the traits, and apply marker-assisted introgression techniques to introduce appropriate traits into more productive breeds. Ultimately, molecular genetic techniques can be applied to characterise the markers more precisely and even to identify and isolate the genes responsible for desirable traits. This then raises the prospect of introducing these traits through transgenic techniques into the genomes of other relevant breeds."},{"index":3,"size":123,"text":"The measurement of genetic diversity within species and relationships among populations within species have been identified as priorities in the characterisation of domestic animal genetic resources (AnGR) by FAO and ILRI. ILRI scientists are currently involved in the molecular characterisation of African ruminant genetic resources-cattle, sheep and goats, and considerable capacity has been developed in this area. In the process of defining its global agenda for livestock research, ILRI has conducted extensive consultations in Asia to identify requirements and to set priorities for livestock research in Asia. These consultations have identified inadequate characterisation and poor utilisation of indigenous animal genetic resources as among the top constraints to livestock production in the region. Particular need for the characterisation of the bovini has been emphasised."},{"index":4,"size":100,"text":"The current needs are to estimate genetic relationships among strains/breeds of different bovini and their relationships with their wild relatives; to estimate the extent of genetic diversity in these populations; to classify the strains/breeds on the basis of genetic distinctiveness in order to facilitate rational utilisation and conservation; to quantify the extent of genetic introgression into these populations by other breeds/strains, including closely related species; to build the capacity of Asian NARS in genetic characterisation of domestic animal diversity; and to assist NARS to develop appropriate breeding and selection strategies to exploit the wide livestock genetic diversity within the region."},{"index":5,"size":52,"text":"If these objectives can be achieved, they will provide a basis for the classification of the populations into genetically unique categories and hence will facilitate a cost-effective assessment and choice of breeds or populations that have potential for selection and improvement or are in danger of extinction and thus need immediate attention."},{"index":6,"size":167,"text":"An approach to characterising and identifying the potential of AnGR in Asia is through a three-way collaboration between ILRI, FAO and NARS. ILRI, through its Animal Genetic Resources Project, has established expertise in developing sampling protocols, marker selection and optimisation, genotyping and data analysis. Through collaboration with FAO, it would be possible to identify appropriate NARS and obtain logistical support for sampling through the national focal points already established through the regional project in 12 countries in the region. Selected NARS scientists would be involved in the genotyping either as collaborating scientists or as graduate fellows. ILRI's molecular genetics capacity, linked as necessary to other advanced laboratories, could be involved in the selection of markers, testing of these under different conditions, and exchange of samples to facilitate an envisaged 'global analysis' incorporating results from various studies involving different populations. In this context, ILRI already collaborates with scientists in Australia and Japan for work in Asia and has established strong links with other groups elsewhere in the world."}]},{"head":"ILRI's Animal Health Improvement Programme (AHIP)","index":34,"paragraphs":[{"index":1,"size":2,"text":"T. Irvin"}]},{"head":"Background","index":35,"paragraphs":[{"index":1,"size":81,"text":"The contribution of livestock to the productivity and sustainability of smallholder farming systems can be severely compromised by ill health and diseases. However, disease is only one of the constraints which limit productivity in such systems. This means that improving animal health must form part of a strategy within which appropriate attention must also be given to improving management, nutrition and breeding in an integrated way. It is unlikely that any one intervention on its own will result in sustainable improvements."},{"index":2,"size":49,"text":"Improving animal health must also adopt an integrated approach which includes: genetic improvement, improved management, chemotherapy, vaccination, vector control and diagnosis. Understanding the epidemiology of diseases in different farming systems will enable a correct balance of these interventions to be developed which are appropriate to different diseases and situations."}]},{"head":"Current research within the AHIP","index":36,"paragraphs":[{"index":1,"size":91,"text":"The AHIP currently focuses on improving control of tropical vector-borne haemoparasitic diseases (particularly theileriosis and trypanosomiasis, with increasing attention being given to heartwater, babesiosis and anaplasmosis) and helminthiasis of ruminant livestock, blending basic and applied research approaches to achieve programme objectives. These objectives are to improve methods for the control of ILRI's target diseases through development of new vaccines, improved diagnostics, non-immunological disease control techniques (including chemotherapy), genetically improved livestock resistant to disease, and strategies that incorporate these research products into an integrated approach appropriate to different regions and production systems."},{"index":2,"size":372,"text":"The strength of the AHIP lies in ILRI's comparative advantage in ruminant immunology, molecular genetics, molecular biology, pathobiology, vector biology, chemotherapy, epidemiology and the development of diagnostic tools to support livestock disease control programmes and improved vaccine technologies. Activities in these areas are in turn linked to other research programme areas within ILRI's overall research programme. These include impact assessment, policy, crop-livestock systems and socio-economics. Effective integration of these disciplines provides a holistic approach to addressing disease control. This approach is exemplified by the work on development of the p67 vaccine against one of ILRI's main target diseases, East Coast Fever (ECF-Theileria parva infection of cattle). This work was initiated on the basis of epidemiological and socio-economic studies which showed the serious impact of ECF, particularly on smallholder dairy production in East and Central Africa, the inadequacy and limitations of current control methods (including a rather crude infection-and-treatment method utilising live, potentially lethal organisms for immunisation) and the demand from smallholder dairy farmers for a better vaccine. Fundamental molecular approaches were therefore adopted for identification and isolation of a protective antigen (p67) and production of this antigen in a bacterial expression system. From earlier work it was known that animals that recover from ECF are solidly immune to subsequent homologous challenge. In separate studies, therefore, the immunological mechanisms involved in protection were elucidated, and this information was used to study and analyse the effects of artificial immunisation with the p67 antigen. These studies led to formulation of an immunisation strategy combining an optimal formulation of antigen and adjuvant which induces protective immunity in cattle against the disease. In collaboration with colleagues in the epidemiological project areas, a protocol for field-testing and evaluation of the vaccine has been developed and field trials are about to begin. If these are successful, ILRI will evaluate the potential socio-economic impact of the vaccine and identify the most appropriate delivery mechanisms so that the vaccine can be applied in a way that is sustainable and affordable by smallholder farmers. This work offers the first opportunity for control of this important disease with an assured quality and a safe product. A similar integrated approach is being adopted for trypanosomiasis, the other target disease with which ILRI is involved."},{"index":3,"size":183,"text":"Another important approach being adopted within the AHIP is based on the fact that a number of indigenous breeds of livestock, which have evolved under natural selection pressures of disease, poor quality feeds and harsh environmental conditions, have acquired specific resistance traits to these selection pressures which enable them to survive and be productive in situations where less adapted and exotic breeds cannot survive. These resistance traits are under genetic control and are therefore inherited by subsequent generations. Currently, the work within the AHIP on genetics of disease resistance is focusing on trypanotolerance in cattle and resistance to helminth infections in sheep and goats to characterise and quantify the genetic basis of this resistance in indigenous breeds, and to identify phenotypic markers which can be used in marker-assisted selection and introgression programmes in order to exploit resistance genes more effectively by introducing them into more productive breeds. Again, this work forms part of an integrated approach to improving livestock productivity, which involves other relevant groups within ILRI in terms of molecular genetics through to exploitation of resistance traits within a farming systems context."}]},{"head":"Potential role for the AHIP in Asia","index":37,"paragraphs":[{"index":1,"size":164,"text":"At present, the AHIP research is focused primarily on cattle with some work (particularly on the genetics of resistance to helminths) in sheep and goats. Although there is generic research capacity in areas such as molecular biology and immunology, our mandate does not extend to include viral and bacterial diseases, nor is there expertise on diseases of pigs and poultry. However, the programme will be expanded to include buffaloes. The areas where the AHIP can contribute to livestock disease research in Asia are therefore limited and one of the main outcomes of the present meeting will be an identification of the complementary areas where the AHIP can interact with relevant groups within Asia. This identification and prioritisation will be done in the context of the following general considerations: The AHIP looks forward to the prospect and opportunity of forging links and developing collaborative projects with Asian partners along the lines indicated, and to exploring other opportunities for obtaining joint funding to conduct such work."}]},{"head":"Sustainable Production Systems Programme:","index":38,"paragraphs":[{"index":1,"size":5,"text":"current activities and future opportunities"}]},{"head":"H. Li Pun","index":39,"paragraphs":[]},{"head":"Programme objective","index":40,"paragraphs":[{"index":1,"size":27,"text":"The main objective of ILRI's Sustainable Production Systems Programme is to improve human welfare through the development of more productive and sustainable crop-livestock systems in developing countries."}]},{"head":"Background","index":41,"paragraphs":[{"index":1,"size":101,"text":"With nearly 2.9 billion more people to feed in 2025 than in 1996 in the developing countries and with limited scope for expanding cropped land, the increased demand for crop and livestock products will continue to drive tropical agricultural systems towards intensification and market orientation. In smallholder systems there will be greater interdependence of livestock and crop enterprises, accompanied by increases in the use of inputs such as draft power, manure and fertilisers, crop residues and planted forages, more productive animal genotypes and disease control strategies. These issues define the programme's focus on market-oriented smallholder crop-livestock systems taking a holistic approach."},{"index":2,"size":68,"text":"In order to improve the productivity and sustainability of these systems, biological, environmental and socio-economic constraints have to be overcome. Therefore, opportunities for changing the systems in a sustainable manner have to be carefully identified and chosen. Special attention needs to be given to understand the complexities and similarities of the systems across ecozones, identify, generate and adapt technologies and policies that have wide recommendation domains and applications."},{"index":3,"size":47,"text":"There is a wealth of information and technology already generated throughout the developing world but its adaptability and applicability beyond its place of origin is rarely known. Therefore, a good start can be made by building up from existing knowledge through partnerships among the NARS and ILRI."}]},{"head":"Ongoing activities","index":42,"paragraphs":[{"index":1,"size":20,"text":"Currently the programme has activities under four themes in three ecoregions. Issues being addressed under each are briefly outlined below. "}]},{"head":"Systems analysis and impact assessment","index":43,"paragraphs":[]},{"head":"Background and justification","index":44,"paragraphs":[{"index":1,"size":235,"text":"Poor nutrition because of poor quality feeds and fluctuating feed supply is a major constraint to tropical livestock productivity. The need to supply greater quantities of quality fodder requires development of both new forages and feeding strategies that will enhance the efficiency with which conventional on-farm feed resources are used. Research at ILRI has identified a range of herbaceous forages and fodder tree species which can be used to alleviate the constraints of lack of feed and which can be incorporated as part of sustainable farming systems. In particular leguminous forages are an important, high quality feed for supplementation of the more abundant but lower quality crop residues available in many tropical areas. Fodder trees also provide an important source of feed and have considerable potential for increased use, especially in semi-arid areas where they often maintain green leaf into the dry season. In addition to livestock feed they also provide fertiliser in the form of mulch, fuelwood, poles and building timber, shade, shelter and windbreaks and can be used for soil stabilisation, soil water management and increasing soil fertility through nitrogen fixation. Such plants offer advantages over herbaceous species in terms of superior persistence, higher yields, better resistance to mismanagement and a capacity to retain high quality forage under stress conditions. However, the presence of phytochemicals in the leaves, pods and seeds of many species act as anti-nutritional factors and prevent their widespread use."},{"index":2,"size":141,"text":"Recognising the importance of feed resources research as part of integrated efforts in increasing livestock productivity, ILRI will continue strategic research on the estimation of feed value and use of forages and crop residues and will link this with new research capacity in rumen microbiology and phytochemistry. This will concentrate on identification and detoxification of anti-nutritional factors in both fodder trees and crop residues. ILRI will make full use of its extensive germplasm collection of tropical and subtropical forage species in the identification and development of new forages to support livestock production in a range of farming systems and environments. Research aimed at assessing the value and improving utilisation of tropical feeds, including forages and crop residues, will be carried out in collaboration with ICRISAT and the International Center for Tropical Agriculture (CIAT) as well as NARS partners in ecoregional consortia."},{"index":3,"size":34,"text":"Ruminant feed resources research at ILRI studies the interactions between feeds and rumen function and includes three projects which cover the forage resources, their linkages with rumen function and their utilisation by the animal."}]},{"head":"Conservation and characterisation of forage genetic resources","index":45,"paragraphs":[{"index":1,"size":162,"text":"Forage germplasm is an essential resource for developing adapted and productive plants for livestock feed, increasing animal nutrition and productivity. However, forage biodiversity is being eroded through destruction of habitat as land is taken into cultivation to meet the demand for food for the rapidly increasing population. There is an urgent need to conserve this resource and to characterise and use the material in development of new forages. ILRI maintains a large collection of over 13,000 accessions of over 1000 species of grasses, legumes and fodder tree species for use in the development of livestock feeds. This collection is held in trust by ILRI under the auspices of FAO as part of the international network of ex situ collections and ILRI has made a commitment to ensure continued access to and availability of the germplasm in its gene bank. The objectives of this project are to conserve and characterise forage biodiversity and to ensure its use in the development of livestock feeds."},{"index":2,"size":111,"text":"The outputs of this activity will be a diverse collection of forage germplasm conserved according to internationally accepted standards to meet the commitment to FAO. The morphological, molecular and phytochemical traits of key species will be characterised and disease-free germplasm distributed for forage research and development. These forages will be used for feeding livestock which will improve animal nutrition and increase productivity with related improvements in diets and income of rural people, thus helping to alleviate poverty. Conservation of biodiversity will ensure that this germplasm remains available for a long-term benefit for future generations and to meet future demands. Incorporation of forages in sustainable farming systems will have positive environmental effects."}]},{"head":"Rumen microbiology for feed utilisation enhancement","index":46,"paragraphs":[{"index":1,"size":86,"text":"Although the presence of anti-nutritional factors limit the use of some forages, adapted and wild ruminants have evolved rumen fermentation mechanisms to utilise these forages. There is the potential to exploit these adapted rumen microbes to better utilise fibrous feeds and forages containing anti-nutritional factors for improved livestock nutrition. The objectives of this project are to characterise rumen micro-organisms for their effects on rumen fermentation and detoxification of anti-nutritional compounds and to promote the use of better adapted strains for increasing nutritional status of tropical livestock."},{"index":2,"size":133,"text":"The outputs of this project will be characterisation of rumen micro-organisms for improved ability to utilise fibrous feeds and detoxify anti-nutritional factors. Specific strains or genotypes of rumen bacteria, fungi or protozoa with enhanced capacity will be identified and made available for further use in tropical livestock. Information on the effects of plant toxins on rumen microbes will be used in selection of plant species for livestock feed. Identification and use of rumen microbes better able to degrade fibre and detoxify anti-nutritional factors in forages will promote increased nutrition for livestock through improved utilisation of poor quality feeds and leguminous forages. This will also allow development and use of sustainable and low cost livestock feeding systems by smallholder farmers, resulting in increased productivity and subsequently, increases in smallholder income, food security, and welfare."}]},{"head":"Feed utilisation improvement for enhancing livestock productivity","index":47,"paragraphs":[{"index":1,"size":116,"text":"Feed resources development and utilisation offer major opportunities for improving livestock productivity in the tropics. Ruminants in the tropical developing world depend on a fluctuating supply of poor quality native pastures, crop residues, and increasingly on fodder trees as protein supplements. Strategic research aimed at using better quality crop residues and changing the diet through strategic supplementation will have positive effects on digestion, reducing particle size, increasing microbial protein synthesis and the rate at which solid and liquid phases of the digesta pass out of the rumen. The objectives of this project are to develop improved methods for assessing nutritive value of tropical feeds, to improve feed utilisation and determine the relationships between feeds and productivity."},{"index":2,"size":58,"text":"The outputs of this research will be a better understanding of the factors limiting the efficiency of utilisation of poor quality feed. Robust screening methods for feed quality traits will be developed to be used for selection of better quality crop residues. Improved feed efficiency will be achieved through modified rumen ecosystems and improved kinetics of fibre digestion."},{"index":3,"size":97,"text":"Information on feed quality and the efficiency of feed utilisation by ruminants will be used in production systems research to develop feeding strategies to increase livestock nutrition and productivity. Improved utilisation of poor quality feeds will enhance livestock productivity, leading to a reduced need for supplementation and, therefore, economical and sustainable smallholder feeding systems. The improved diets, increased weight gains, reduced reproductive wastage and increased milk production will ensure food security, income and thus poverty alleviation. Increased use of fodder trees will also contribute to protection of the natural resource base by preventing or minimising environmental degradation. "}]},{"head":"Training courses","index":48,"paragraphs":[]},{"head":"Information Services","index":49,"paragraphs":[{"index":1,"size":42,"text":"ILRI has established a substantial library and documentation service for the benefit of its scientists and partners. There are limits to the information service we can provide, and we are currently examining new ways through which we can usefully support NARS scientists."}]},{"head":"ILRI libraries","index":50,"paragraphs":[{"index":1,"size":95,"text":"ILRI libraries in Ethiopia and Kenya contain over 60,000 books and 25,000 bound journals; over 1600 journals are regularly acquired. The library collection covers all the main disciplines of animal agriculture. The libraries include an in-house bibliographic database of over 100,000 records. ILRI also collects non-conventional or gray literature. It is estimated that almost 50% of the literature on animal agriculture is in the form of reports, unpublished documents and theses-the gray literature. Much of this literature has great value to all scientists, but particularly to scientists within the same region or comparable farming systems."},{"index":2,"size":50,"text":"ILRI also publishes information products on CD-ROMs. The first version of three bibliographic databases on one CD-ROM recently produced contains: • animal agriculture in Africa, based on the library holdings of six international research organisations • a global database on animal traction • selected records from ILRI's main bibliographic database"}]},{"head":"Networks","index":51,"paragraphs":[{"index":1,"size":61,"text":"ILRI has provided co-ordination to a number of NARS networks involved with small ruminant, cattle and feed resources research. The networks are restricted to African countries and are presently being re-organised into three multidisciplinary networks. These networks are designed to strengthen NARS research capacity, encourage a peer-review process within NARS, and support multi-site collaborative research between NARS scientists in different countries."},{"index":2,"size":36,"text":"Networking can be a very effective way of sharing resources, but time consuming to co-ordinate and all too rarely becomes financially self-supporting. For these reasons ILRI will join and encourage existing networks in Asia wherever possible."}]},{"head":"ILRI and NARS in Asia Priorities for strengthening research capacities","index":52,"paragraphs":[{"index":1,"size":97,"text":"The NARS-ILRI consultations in Asia have concluded that there is need for training on farming systems research that integrates food crops-trees-livestock; and on the linkages between research-extension-users. Some countries have expressed the need for training on feeds and feed utilisation, socio-economics and policy issues, and for animal health research, particularly incorporating the use of biotechnologies. Existing courses available in Asia will be surveyed to ensure that ongoing training is not duplicated. An important product from the courses will be the development of training materials, using Asian case studies, to be used in national and regional training programmes."},{"index":2,"size":22,"text":"ILRI is also looking to establish links with key universities in Asia for the co-supervision of Asian students within ILRI research projects."}]},{"head":"Information services and knowledge products","index":53,"paragraphs":[{"index":1,"size":68,"text":"The consultations have shown that many NARS institutes in Asia lack access to current literature. ILRI has already completed the first phase of a global review of libraries that have literature on animal agriculture. This survey will be extended to cover more libraries in Asia and then it will be possible to plan how to network libraries together to share resources and better serve livestock research in Asia."},{"index":2,"size":95,"text":"ILRI has also started work on a bibliographic database of Asian literature on animal agriculture. So far over 10,000 documents have been identified. The database, to be published on CD-ROM, will provide researchers with a consolidated source of the literature on regional animal agriculture. The first version of this bibliographic database will be ready by early 1998. Secondly, ILRI is developing a library of ILRI publications on a disk that will include all ILRI technical publications complete with references and graphics, and which will be fully searchable. This will also be ready by early 1998."}]},{"head":"South-south technology transfer","index":54,"paragraphs":[{"index":1,"size":28,"text":"ILRI can play an important role in encouraging the sharing of experiences and transfer of technologies between scientists in Asian countries, and between those in Asia and Africa."},{"index":2,"size":64,"text":"There are many areas where these exchanges will have wide value and benefit. For example, with smallholder dairy production, scientists in India have world-wide recognised expertise in this area, and many scientists in other Asian countries, and in Africa, who are also working on smallholder dairy research, have much to share with colleagues elsewhere. There need to be opportunities for this sharing to occur."},{"index":3,"size":54,"text":"A series of well-structured extended seminars and workshops is envisaged that will bring together experts from different countries and regions for discussions that will lead to a cross-fertilisation of ideas, experiences and research methods ultimately leading improved research and technology development, and the publication of these to reach as wide an audience as possible."}]}],"figures":[{"text":" model of the food-economic plants-feed stuff agricultural patterns and production model of feed stuff to meet animal needs 200 300 Exploitation of grassland resources and the model of crop-animal production, including improvement of the grasslands and pasture production technique 200 300 Nutrient requirements and feeding standards of ruminants in South China 180 580 Study of the dynamic environment change for animal production in South China 240 400 Improvement of the production and utilisation of feed stuff resources, including by-products and forages in agriculture in South China 300 800 Control of the main diseases, including the production of vaccine for foot-and-mouth disease and the control of helminthiasis in cattle and sheep 220 600 Nutrient recycling and crop-animal production systems 400 2000 Exchange and training of researchers and information exchange 400 400 "},{"text":"• Proposed activities should be clearly focused and reflect ILRI's comparative advantage and mandate • Project activities should be developed which complement the indigenous capability in many Asian countries and that of ILRI in complementary ways • ILRI must become better aware of what research has already been conducted in the region and of the key players in this research, both within Asia and from outside • ILRI should articulate clearly what expertise it can offer Asia • Partnerships should be developed with both NARS and relevant ARIs to tap existing knowledge and expertise, and to develop collaborative research On the above bias, the following areas may be appropriate for consideration within the context of ILRI's AHIP: • Improved diagnostics, especially for babesiosis, anaplasmosis and T. evansi, including technology transfer • Strengthening veterinary immunology, especially linking to appropriate veterinary research institutes • Quantitative epidemiology and economic impact of disease, in collaboration with relevant NARS • Biotechnology, including recombinant vaccine technology (e.g. for T. annulata) • Genetic characterisation of indigenous breeds (cattle, sheep and goats) • Genetics of helminthiasis resistance in specific farming systems • Theileriosis in small ruminants "},{"text":" ILRI's training courses are typically for up to 15 people and last two to three weeks. They are based on ILRI research expertise and are targetted at technical or early-career scientific staff, and are intended to strengthen existing NARS research capacity.Training materialsILRI is giving increasing emphasis to the development of training materials that are based on ILRI's research and the use of examples relevant to students and scientists in developing countries. The institute's training materials are also designed for self-instruction and distance learning. "},{"text":"Nguyen Cong Tan, Minister of Agriculture and Rural Development, Vietnam On behalf of the Vietnamese Government, I would like to welcome you, the representatives from the International Livestock Research Institute (ILRI), and the delegates from 18 countries and international organisations to participate in the ILRI Conference on 'Development of Livestock Research Priorities in Asia' which is being held for the first time in Vietnam. I wish the conference every success. Appendix I  Appendix I Speech by H.E. Dear Chairmen, Speech by H.E. Dear Chairmen, Distinguished representatives,  Distinguished representatives, • socio-economics and policy issues • socio-economics and policy issues • research/extension/user linkages for technology transfer • research/extension/user linkages for technology transfer Task force for building partnerships Task force for building partnerships Malaysia Abd Aziz Jamaluddin MalaysiaAbd Aziz Jamaluddin Nepal Upendra Mishra NepalUpendra Mishra Thailand to be confirmed Thailandto be confirmed FAO Regional office Denis Hoffmann FAO Regional officeDenis Hoffmann ILRI Michael Smalley ILRIMichael Smalley  "},{"text":"Appendix II Programme for ILRI's Conference on Development of Livestock Research Priorities in Asia 13-15 May 1997 Tuesday, 13 May  0830-0900 Registration 0830-0900Registration 0900-1000 Official welcome 0900-1000Official welcome  Le Viet Ly, Vice Director, NIAH Le Viet Ly, Vice Director, NIAH  Introduction to participants Introduction to participants  Nguyen Dang Vang, Director, NIAH Nguyen Dang Vang, Director, NIAH  Hank Fitzhugh, Director General, ILRI Hank Fitzhugh, Director General, ILRI  Official opening Official opening  H.E. Nguyen Cong Tan, Minister of Agriculture and Rural Development H.E. Nguyen Cong Tan, Minister of Agriculture and Rural Development 1000-1030 Coffee/tea break 1000-1030Coffee/tea break Session 1: Assessment of livestock research development priorities Session 1: Assessment of livestock research development priorities 1030-1045 ILRI-International livestock research for Asia. Hank Fitzhugh 1030-1045ILRI-International livestock research for Asia. Hank Fitzhugh 1045-1100 Conference organisation and outcomes. Shaun Coffey 1045-1100Conference organisation and outcomes. Shaun Coffey 1100-1145 ILRI in Asian livestock development. An assessment of Asian animal 1100-1145ILRI in Asian livestock development. An assessment of Asian animal  agriculture. John Vercoe agriculture. John Vercoe 1145-1230 Improvement of livestock production in crop-animal systems in rainfed 1145-1230Improvement of livestock production in crop-animal systems in rainfed  agro-ecological zones of South East Asia. C. Devendra agro-ecological zones of South East Asia. C. Devendra 1230-1300 General discussion 1230-1300General discussion 1300-1400 Lunch break 1300-1400Lunch break  "},{"text":"Session 2: Country reports and key issues  0910-0930 Vietnam 0910-0930Vietnam 0930-0950 China 0930-0950China 0950-1020 Coffee/tea break 0950-1020Coffee/tea break 1020-1040 Indonesia 1020-1040Indonesia 1040-1100 Malaysia 1040-1100Malaysia 1100-1120 Philippines 1100-1120Philippines 1120-1140 Thailand 1120-1140Thailand 1140-1220 General discussion 1140-1220General discussion 1220-1330 Lunch break 1220-1330Lunch break Session 3: ILRI vision, mission and goals Session 3: ILRI vision, mission and goals 1330-1400 Introduction, Hank Fitzhugh 1330-1400Introduction, Hank Fitzhugh 1400-1430 Ruminant genetics, Tony Irvin 1400-1430Ruminant genetics, Tony Irvin 1430-1500 Health improvement, Tony Irvin 1430-1500Health improvement, Tony Irvin 1500-1530 Crop-livestock systems, including policy, Hugo Li Pun 1500-1530Crop-livestock systems, including policy, Hugo Li Pun 1530-1600 Feed resources, Jean Hanson 1530-1600Feed resources, Jean Hanson 1600-1630 Strengthening partnerships with NARS, Michael Smalley 1600-1630Strengthening partnerships with NARS, Michael Smalley Thursday, 15 May Thursday, 15 May Session 4: Workshops-ILRI and the major issues Session 4: Workshops-ILRI and the major issues 0830-0945 Plenary identification of key issues 0830-0945Plenary identification of key issues 0945-1115 Workshop discussion groups on key issues in South-East Asia, South Asia and on key 0945-1115Workshop discussion groups on key issues in South-East Asia, South Asia and on key  cross-cutting issues cross-cutting issues 1115-1215 Group reports to 1115-1215Group reports to 1400-1420 Bangladesh 1400-1420Bangladesh 1420-1440 Bhutan 1420-1440Bhutan 1440-1500 India 1440-1500India 1500-1520 Coffee/Tea break 1500-1520Coffee/Tea break 1520-1540 Nepal 1520-1540Nepal 1540-1600 Pakistan 1540-1600Pakistan 1600-1620 Sri Lanka 1600-1620Sri Lanka 1620-1640 Cambodia 1620-1640Cambodia 1640-1715 General discussion 1640-1715General discussion 1930-2100  1930-2100 0830-0850 Laos 0830-0850Laos 0850-0910 Myanmar 0850-0910Myanmar  "},{"text":"plenary session Session 5: Identifying the way ahead  1215-1230 Formulation of new working groups 1215-1230Formulation of new working groups 1230-1330 Lunch break 1230-1330Lunch break 1330-1700 Working groups 1330-1700Working groups 1730-1930 Visit to National Institute of Animal Husbandry 1730-1930Visit to National Institute of Animal Husbandry Friday, 16 May Friday, 16 May 0830-1145 Reports from working groups and discussion of major outcomes and draft actions 0830-1145Reports from working groups and discussion of major outcomes and draft actions 1145-1230 Official closing of the Consultation 1145-1230Official closing of the Consultation 1230-1800 Field trip to the Ba Vi Cattle Research Centre and Goat and Rabbit Research Centre 1230-1800Field trip to the Ba Vi Cattle Research Centre and Goat and Rabbit Research Centre 2000 Dinner hosted by the Ministry of Agriculture and Rural Development 2000Dinner hosted by the Ministry of Agriculture and Rural Development  "},{"text":"the quick and efficient diagnosis of livestock diseases Bhutan Major issues confronting the future development of the livestock sector  • Geophysical conditions of the country. Tremendous variations in climate and access to markets lead to •Geophysical conditions of the country. Tremendous variations in climate and access to markets lead to  -Wild range of production systems with specific research and development needs -Wild range of production systems with specific research and development needs  -Problems in setting research and development priorities -Problems in setting research and development priorities  -Difficulties in identifying suitable technologies for the prevailing conditions -Difficulties in identifying suitable technologies for the prevailing conditions • Economic issues •Economic issues  -Market for livestock products -Market for livestock products  -Opportunities for rural population other than agriculture and livestock will influence the economic -Opportunities for rural population other than agriculture and livestock will influence the economic  threshold for livestock production threshold for livestock production  -Sustainability of extension programmes in animal health, fodder production and use -Sustainability of extension programmes in animal health, fodder production and use • Social resistance against culling of animals •Social resistance against culling of animals  -The Buddhist religion inhibits the taking of life. In many parts of the country, there is a strong -The Buddhist religion inhibits the taking of life. In many parts of the country, there is a strong  resistance by the community against selling animals for slaughter. A large percentage of livestock resistance by the community against selling animals for slaughter. A large percentage of livestock  population is unproductive population is unproductive • • • Mithun crossbreeding Increasing the availability and improving the quality of conventional and non-conventional feeds for -Traditional crossbreeding programmes optimise heterosis effect but do not allow for selection and livestock and maximising their utilisation Determination of the epidemiology and development of effective control measures of the most serious development of stable and productive dairy breeds • • •Mithun crossbreeding Increasing the availability and improving the quality of conventional and non-conventional feeds for -Traditional crossbreeding programmes optimise heterosis effect but do not allow for selection and livestock and maximising their utilisation Determination of the epidemiology and development of effective control measures of the most serious development of stable and productive dairy breeds infectious livestock diseases Areas for collaborative research • Development of potent local vaccines for newly emerged, as well as for existing, livestock diseases • • Description of traditional livestock breeds and realistic methods for their preservation Evaluation of production efficiency of dairy cattle types for urban and rural systems and designing appropriate breed improvement programmes for Bangladesh • Development of socio-economic and monitoring research methodologies for existing development infectious livestock diseases Areas for collaborative research • Development of potent local vaccines for newly emerged, as well as for existing, livestock diseases • • Description of traditional livestock breeds and realistic methods for their preservation Evaluation of production efficiency of dairy cattle types for urban and rural systems and designing appropriate breed improvement programmes for Bangladesh • Development of socio-economic and monitoring research methodologies for existing development • Breed improvement programme for buffaloes and selective breeding for Black Bengal goats programmes in animal health and fodder •Breed improvement programme for buffaloes and selective breeding for Black Bengal goats programmes in animal health and fodder • Draft power improvement •Draft power improvement • Development of suitable scavenger chickens and ducks for village use •Development of suitable scavenger chickens and ducks for village use • Generation of technologies for storage, preservation and processing of livestock products to improve •Generation of technologies for storage, preservation and processing of livestock products to improve  quality standards determined by consumer preference and competition for products quality standards determined by consumer preference and competition for products • Livestock production and industry economics •Livestock production and industry economics • On-farm livestock research •On-farm livestock research • The development of multiple ovulation embryo transfer technique, and establishment of molecular •The development of multiple ovulation embryo transfer technique, and establishment of molecular biological techniques in • Controversy and issues around biodiversity biological techniques in • Controversy and issues around biodiversity  -Preservation of existing breeds: which animals/breeds warrant preservation, how can they be best -Preservation of existing breeds: which animals/breeds warrant preservation, how can they be best  preserved? preserved?  -Preservation of wild animal species: how can we combine a large population of wild animal species -Preservation of wild animal species: how can we combine a large population of wild animal species  with livestock and agricultural production? with livestock and agricultural production? • Access to resources and stability of resource bases •Access to resources and stability of resource bases  -Rules and regulations on land and forest resources -Rules and regulations on land and forest resources  -Increasing cattle, yak and wild animal populations puts high pressure on resource base and threatens -Increasing cattle, yak and wild animal populations puts high pressure on resource base and threatens  its stability its stability  -Credit facilities -Credit facilities  -Growing interest from other sectors such as parks/wild life sanctuaries, hydro-power projects and -Growing interest from other sectors such as parks/wild life sanctuaries, hydro-power projects and  forestry which infringe on the traditional resources for livestock production forestry which infringe on the traditional resources for livestock production  "},{"text":"Cambodia Main constraints to livestock production   ILRI contribution Matching funds from China ILRI contributionMatching funds from China Name of project ('000 USD) ('000 USD) Name of project('000 USD)('000 USD) Protection and utilisation of animal resources, including 200 200 Protection and utilisation of animal resources, including200200 buffaloes, yellow cattle, sheep, goats and geese  buffaloes, yellow cattle, sheep, goats and geese Study of household crop-animal sustainable systems and  Study of household crop-animal sustainable systems and economic analysis in different agro-ecological and economic  economic analysis in different agro-ecological and economic zones of South China  zones of South China • High rate of mortality caused by some contagious diseases  •High rate of mortality caused by some contagious diseases  -For cattle and buffaloes (haemorrhagic septicaemia, blackleg, foot-and-mouth disease and anthrax) -For cattle and buffaloes (haemorrhagic septicaemia, blackleg, foot-and-mouth disease and anthrax)  -For pigs (swine fever, pasteurellosis and salmonellosis) -For pigs (swine fever, pasteurellosis and salmonellosis)  -For chickens (Newcastle disease and cholera)  -For chickens (Newcastle disease and cholera)  -For ducks (cholera)  -For ducks (cholera) • Feeds (quantity, quality and relatively long dry season)  •Feeds (quantity, quality and relatively long dry season) • Poor quality breeding animals  •Poor quality breeding animals • Shortage of funds  •Shortage of funds • Inadequate materials, equipment and transportation for vaccination campaigns •Inadequate materials, equipment and transportation for vaccination campaigns • Inadequate staff in the field  •Inadequate staff in the field • Communication difficulties  •Communication difficulties • Limited government support services, research and extension •Limited government support services, research and extension • Lack of mass media information systems  •Lack of mass media information systems • Limited access to credit for small farmers  •Limited access to credit for small farmers Research priorities  Research priorities  "},{"text":"Areas of national strength Method of setting up priority areas relevant to commodity-species-disciplines • Relevance of the Central Research Institute for Animal Sciences (CRIAS) priorities with ILRI priorities for the Asian region -Feed resources: fodder, legumes, rumen microbes manipulation -Animal health: disease-resistant breeds, vaccine development -Identification of superior local genotypes and composite breeds -Environmental protection and sustainability-starbio, bioplus and residues detection in animal products -Classification of agro-ecological zone for different production systems -Scientific exchange, training and recruitment of staff -Exchange of information-internet, web site, catalogue The Central Research Institute for Animal Sciences co-ordinates two research institutes: the Research Institute for Animal Production (RIAP) and Research Institute for Veterinary Science (RIVS). Indonesia Indonesia Research priorities Research priorities •  • • Institute of Animal Science •Institute of Animal Science • Institute of Agro-Economy •Institute of Agro-Economy • The Institute of Rice Science •The Institute of Rice Science  "},{"text":"issues and priorities for livestock development Mineral deficiency and supplementation in Xiengkhoung Province•Selection and introduction of grasses, legumes and fodder trees for different agro-ecological zones • Cut-and-carry fodders for smallholders and pasture development for commercial livestock owners • Introduction of selected acid tolerant grass cultivars Integrated livestock (ruminants and non-ruminants) with crop production (rice, maize, millet and wheat) including vegetables and fruits and agroforestry particularly in the mid-hill regions -Rice/wheat-based livestock (cattle and buffalo) production systems particularly in the Terai region -Dry and upland crop with small ruminant and non-ruminant production system -Smallholder mixed farming systems Pricing and credit policy of breeding animals, animal products and value-added products such as carpets -Quality control of animal products, feeds and feeding, biological products -Environmental issues -Drug manufacturing, export, import, storage, supply, sales and distribution• Strengthening of research capability -The Nepal Agricultural Research Council (NARC) was recently established as an autonomous organisation. NARC wants to urgently develop divisions and commodity programmes with subjectmatter specialists who can use newly developed technologies to boost livestock/fish production in the country. The following suggestions are made. °ILRI does not yet have a well-established regional livestock research station in the Asian region. Nepal would appreciate if ILRI establishes a regional livestock research station in Nepal to build up research capability °Strengthening livestock research capabilities at regional research stations as a multipurpose farming system °Presently ODA, the World Bank, the Advanced Technology Support Program (ATSP), Japan International Cooperation Agency (JICA), the International Service for National Agricultural Research (ISNAR), the German Agency for Technical Cooperation (GTZ) and the ADB are helping through financial, training expertise and logistic support °Post-graduate study programme for scientists °Collaboration with international research institutes for post-doctoral fellowship, laboratory establishment and for basic research  °Livestock production modelling and simulation °Livestock production modelling and simulation  °Heat stress management °Heat stress management • • • °Nutritional manipulation to improve production efficiency Buffalo development Supply of superior germplasm and breeding strategies for improvement in livestock Training and information exchange • • •°Nutritional manipulation to improve production efficiency Buffalo development Supply of superior germplasm and breeding strategies for improvement in livestock Training and information exchange • Malaysia Germplasm processing and semen freezing technology Nepal • Reproductive biotechnology (ET, IVM and IVF) • Rural livestock management and productivity • Co-operative movement for smallholder farmers Research priorities • Research priorities • Feed resources and nutrition • Animal and crop agriculture as mixed farming systems -Production of local feed crops -Transhumance animal-keeping system (yak, chauries, sheep, goats, musks) in the mountains and • Semi-intensive poultry production including backyard poultry development -Improvement of oil palm and rice by-products as feeds the Himalayan rangeland supported by horticultural pastures, buckwheat, millet, potato and wheat • Malaysia Germplasm processing and semen freezing technology Nepal • Reproductive biotechnology (ET, IVM and IVF) • Rural livestock management and productivity • Co-operative movement for smallholder farmers Research priorities • Research priorities • Feed resources and nutrition • Animal and crop agriculture as mixed farming systems -Production of local feed crops -Transhumance animal-keeping system (yak, chauries, sheep, goats, musks) in the mountains and • Semi-intensive poultry production including backyard poultry development -Improvement of oil palm and rice by-products as feeds the Himalayan rangeland supported by horticultural pastures, buckwheat, millet, potato and wheat • • • • Laos -Utilisation of forages for integrated and semi-intensive systems production systems Nutrient requirements and germplasm evaluation Straw enrichment and urea-molasses blocks Resource management Human resource development including degree programmes and specialised vocational training Present constraints -Feeding strategies for efficient feed utilisation °Feed budgeting °Feed additives °Nutrient (protein and energy) and mineral supplementation -Nutrient partitioning -Rumen ecology for improved feed utilisation -Determination of nutrient requirements • Animal genetic resources and breeding -Breed evaluation for suitability to tropicalised environment °Development of national breeding schemes for ruminants °Early selection using molecular techniques -Improvement in fertility rates and multiplication of superior breeding stock through reproductive biotechnological techniques -agro-°Molecular approach to identification of superior stock ecological zones °Overcoming reproduction problems -Development of unexploited potential meat sources • Biodiversity and animal breeding • • • • Laos -Utilisation of forages for integrated and semi-intensive systems production systems Nutrient requirements and germplasm evaluation Straw enrichment and urea-molasses blocks Resource management Human resource development including degree programmes and specialised vocational training Present constraints -Feeding strategies for efficient feed utilisation °Feed budgeting °Feed additives °Nutrient (protein and energy) and mineral supplementation -Nutrient partitioning -Rumen ecology for improved feed utilisation -Determination of nutrient requirements • Animal genetic resources and breeding -Breed evaluation for suitability to tropicalised environment °Development of national breeding schemes for ruminants °Early selection using molecular techniques -Improvement in fertility rates and multiplication of superior breeding stock through reproductive biotechnological techniques -agro-°Molecular approach to identification of superior stock ecological zones °Overcoming reproduction problems -Development of unexploited potential meat sources • Biodiversity and animal breeding • • • • • • • • Livestock production in different agro-ecological zones Animal health Promote livestock production for smallholders Forage improvement -Research on grass-legumes for different agro-ecological zones Genetic improvement -Cross-breeding Production systems -Characterise prevailing production systems -Improve production to commercial sector -Genetic improvement and maintenance of genetic diversity of different breeds of livestock, poultry Animal health and diseases and fish -Epidemiology and control of diseases -Heat synchronisation and controlled breeding -Disease diagnosis -Crossbreeding through artificial insemination (AI) for determination of appropriate blood levels °Development of novel diagnostic techniques and diagnostic kits -Ex situ and in situ conservation of animal genetic resources °Development of improved diagnostic test kits by molecular methods and biotechnology -Selection within indigenous breeds -Disease monitoring and surveillance -Development of new breeds or strains of different domestic animals and birds °Epidemiological study of diseases by conventional and molecular methods Animal health improvement °Epidemiological modelling of economically important diseases -Improve disease diagnosis and treatment of prevailing diseases (khari, setariasis, mastitis, infertility, -Disease control and eradication foot-and-mouth disease, RP, PPR, tuberculosis, brucellosis and parasitic diseases) °Development of local and improved (hybrid) vaccines -Vaccine production and distribution °Development of therapeutic medicaments for parasitic diseases -Evaluation of herbal drugs and traditional remedies • • • • • • • •Livestock production in different agro-ecological zones Animal health Promote livestock production for smallholders Forage improvement -Research on grass-legumes for different agro-ecological zones Genetic improvement -Cross-breeding Production systems -Characterise prevailing production systems -Improve production to commercial sector -Genetic improvement and maintenance of genetic diversity of different breeds of livestock, poultry Animal health and diseases and fish -Epidemiology and control of diseases -Heat synchronisation and controlled breeding -Disease diagnosis -Crossbreeding through artificial insemination (AI) for determination of appropriate blood levels °Development of novel diagnostic techniques and diagnostic kits -Ex situ and in situ conservation of animal genetic resources °Development of improved diagnostic test kits by molecular methods and biotechnology -Selection within indigenous breeds -Disease monitoring and surveillance -Development of new breeds or strains of different domestic animals and birds °Epidemiological study of diseases by conventional and molecular methods Animal health improvement °Epidemiological modelling of economically important diseases -Improve disease diagnosis and treatment of prevailing diseases (khari, setariasis, mastitis, infertility, -Disease control and eradication foot-and-mouth disease, RP, PPR, tuberculosis, brucellosis and parasitic diseases) °Development of local and improved (hybrid) vaccines -Vaccine production and distribution °Development of therapeutic medicaments for parasitic diseases -Evaluation of herbal drugs and traditional remedies  °Development of biological control -Identification of toxicological plants and their remedies °Development of biological control -Identification of toxicological plants and their remedies Priority projects °Development of immune enhancers and novel delivery systems for vaccines -Study of residual effects of various drugs Priority projects °Development of immune enhancers and novel delivery systems for vaccines -Study of residual effects of various drugs  "}],"sieverID":"e4ff6eac-e2ac-4907-9b0e-547adf76d227","abstract":"Feed resources: quantification and characterisation of feed resources, utilisation of feeds and the interaction of genotype × feeds, feed conservation, feeding strategies and feed budgeting, adverse consequences of grazing and migratory livestock."}

data/part_2/018c93d229b2064851487c7cae4fb46d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"018c93d229b2064851487c7cae4fb46d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3848e474-8467-46ee-97b1-431fb260e6bb/retrieve"},"pageCount":10,"title":"Do logging concessions decrease the availability to villagers of foods from timber trees? A quantitative analysis for Moabi (Baillonella toxisperma), Sapelli (Entandrophragma cylindricum) and Tali (Erythrophleum suaveolens) in Cameroon","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":232,"text":"The humid forests of Africa cover about 236 million ha, of which 203 million ha are located in the Congo Basin of Central Africa, a region important for its extent, natural resources, biodiversity and endemism (Mayaux et al., 2004). Cameroon has more than 18.6 million ha of lowland moist forest, of which 6.4 million ha were under concession in 2009. Timber production is an important sector of the Cameroonian economy. The formal timber sector, oriented towards the export market, employs more than 13,000 people and contributes 6% of the nation's GDP, worth 47 billion FCFA in 2004 (about 90.24 million USD; Bayol et al., 2012), mostly from sales of lumber to Europe (Eba'a Atyi, 2009in Eba'a Etyi et al., 2013). The population of Cameroon is estimated at 20 million, with a growth rate of 2.5% in 2015 (The World Bank, 2016a). Forty-six percent of Cameroonians live in rural areas, many within or near forests (The World Bank, 2016b;Tieguhong et al., 2012). Studies have revealed that some rural people in Cameroon obtain 50% or more of their household income (cash and subsistence) from forest products (Van Dijk, 1999;Sunderland et al., 2003) although a more recent study estimated this ratio as less than 30%, as compared to approximately 50% obtained from farming (Levang et al., 2015). Many of these wild-gathered forest species are nutritionally important complements to their agricultural staples (Fungo et al., 2015)."},{"index":2,"size":69,"text":"The Cameroonian forests include almost 300 species of commercial timbers of which about 60 are extracted on a regular basis. More than 61% of the commercial timber species also produce nontimber forest products (NTFPs) that are important for communities that live within or close to the concessions, as sources of food, building materials, traditional medicines and other products (Ndoye and Tieguhong, 2004;Tieguhong and Ndoye, 2007;Guariguata et al., 2010;Laird, 1999)."},{"index":3,"size":128,"text":"Since 1994 the management of concession forests in Cameroon has been governed by Forest Law No. 94-01, which mandates that logging companies prepare detailed forest management plans (FMPs) to ensure the ecological, economic, and socially sustainable management of their forests (Cerutti et al., 2008). This law also provides for communities to obtain licenses to harvest timber in community concessions of up to 5000 ha, an innovation that was implemented in 1998 (FAO, 2005). Article 8 of the law recognizes the rights of local people to exploit NTFPs within the concessions for their personal use, as long as they are not protected species (Republic of Cameroon, 1994). However, the implementation of this Article does not give communities the right to harvest forest resources in large quantities or for sale."},{"index":4,"size":189,"text":"The importance of timber and non-timber forest resources to both concessionaires and communities means that forest management needs to consider the value of and access to products from these species for both sets of stakeholders. Forest exploitation can have a positive impact, a negative impact, or no impact on the availability of or access to NTFPs, depending on the species, the resource, and management practices (Rist et al., 2012). Timber concessions can reduce the availability of NTFPs through three mechanisms: restriction of access to forest resources, logging of timber species that are also important sources of NTFPs and indirect impacts of logging activities on other forest resources (Newing, 2007). In most cases information about the use, value and ecology of these species is insufficient to provide a foundation for forest management guidelines and practices (Guariguata et al., 2010; but see Vermeulen and Doucet, 2004); and it has been noted that few quantitative studies have been carried out to evaluate the impact of selective logging on the ability of local populations to obtain non-timber forest products (Rist et al., 2012). This study was carried out to help fill these gaps."},{"index":5,"size":69,"text":"The study focuses on three species that have both timber and non-timber values, specifically as food sources. The objective was to quantify these species within an accessible radius of nearby villages and within the neighboring concession and to evaluate the impact of logging on their abundance, to determine whether or not villagers were being deprived of access to these resources as a result of timber harvesting on industrial concessions."}]},{"head":"Methods","index":2,"paragraphs":[]},{"head":"Sample species","index":3,"paragraphs":[{"index":1,"size":198,"text":"Focus groups and socioeconomic and nutritional surveys carried out in a parallel study (Levang et al., 2015;Fungo et al., 2016) were used to guide the choice of three priority tree species that met the following criteria: they are harvested for timber by the concessionaires and they produce or host important NTFPs that are of nutritional value to local populations. The tree species selected were Moabi (Baillonella toxisperma Pierre), Sapelli (Entandrophragma cylindricum Sprague), and Tali (Erythrophleum suaveolens Guill. and Perri). Moabi, limited to the lowland rainforest of West and Central Africa, is tenth in ranking on the list of timber species exported from Cameroon (Ndoye and Tieguhong, 2004). It reaches very large sizes, up to 70 in height, and has a fine-grained, hard and durable wood (Vivien and Faure, 1985). Sapelli is one of the most valuable and important timber species in Cameroon, accounting for 377,254 m 3 of exports/year, the most of any species. Tali is the third most exploited timber species in Cameroon, exported to European and Asian markets (Cerutti et al., 2008). The minimum cutting diameter varies among species. For Moabi it is 80 cm, for Sapelli 100 cm and for Tali 60 cm (Medinof, 2004)."},{"index":2,"size":189,"text":"Moabi is very important to local communities for multiple purposes (Schneemann, 1995;Plenderleith and Brown, 2004) and was quantified as accounting for the most plant biomass (47%) collected from the forest (Vermeulen and Doucet, 2004). It produces edible fruits as well as oil-rich seeds. Local women carry out a time-consuming, multistage process to extract from Moabi seeds a high-value and nutritious oil which is consumed, bartered and sold (Ngueguim et al., 2011;Fungo et al., 2016). For generations this has been the only source of edible oil for local populations, its importance reflected in the fact that individuals acquire lifetime rights to gather fruits from particular Moabi trees by marking them and clearing around them (Schneemann, 1995). In the early 20th century, these seeds were imported into Europe for their fats and oils, which can also be used for making soap (Plenderleith and Brown, 2004). Moabi bark is used in traditional medicine and traditional rites (Schneemann, 1995;Veuthey and Julien-François, 2009;Ngueguim et al., 2011). Moabi, in the Sapotaceae family, is a monoecious species that commonly produces abundant fruit every three years, during the short dry season. Its seeds are dispersed by elephants."},{"index":3,"size":85,"text":"Both Sapelli and Tali host edible caterpillars (Imbrasia oyemensis and Cirina forda, respectively) that are an important food for local populations (Ndoye and Tieguhong, 2004;Tieguhong and Ndoye, 2007). I. forda caterpillars contain 62% protein and 25% fat and C. forda 74% protein and 14% fat (Rumpold and Schluter, 2013), higher proportions than beef. In addition to producing a durable wood, Tali bark and roots are high in alkaloids and are used in traditional medicine. Its roots are also used as a fish poison (Okeyo, 2006)."}]},{"head":"Study sites","index":4,"paragraphs":[{"index":1,"size":230,"text":"Cameroon's forest is humid semi-evergreen in the south and semi deciduous in the east. It is characterized by low densities of Caesalpinaceae (including Tali) and relatively high proportions of Euphorbiaceae and Oleaceae. Meliaceae (including Sapelli), Sterculiaceae and Ulmaceae are well represented among the largest trees (Letouzey, 1968). The studies were carried out within and near two forest concessions in Cameroon, Fabrique Camerounaise de Parquet (FIPCAM) in the south (referred to as concessionaire S), which has held the concession since 2000, and Societé Camerounaise de Transformation du Bois (SCTB) in the east, referred to as concessionaire E. FIPCAM, concessionaire S, is funded by external capital while SCTB, concessionaire E, is owned by Cameroonians. Neither one is certified. SBCT harvests 24 species and FIPCAM 38 species. The concessions were chosen based on multiple criteria: the presence of the selected species; easy access; willingness of the concessionaires to collaborate with the research project; an approved management plan or a plan in process of being approved; the presence of villages within or near the concession, preferably representing different ethnic groups; the existence of inventory and harvest data from the annual cutting area; and social responsibility contracts between the villages and the concession ('cahiers de charges'). Data was collected in early 2013 in the 5000 ha annual cutting area of 2012 in each concession and also in and around two villages located near each concession."},{"index":2,"size":305,"text":"In 2004 the population around the SCTB concession in the East Region numbered about 25,783 people who lived in 41 villages and hamlets and were mainly of the Kako, Pol, and Maka (Bantu) and Baka (pygmy) ethnic groups (Medinof, 2004). The population around the FIPCAM concession in the South Region in 2009 was estimated at 79,353, living in 29 villages and hamlets (Enviro Consulting, 2009in Levang et al., 2015), nearly all of the Bulu (Bantu) ethnic group. Population density around the concessions is low, with 7.1 inhabitants/km 2 in the East and 13.4 inhabitants/ km 2 in the South (Levang et al., 2015) Sample villages were chosen based on several criteria: compact layout, proximity to the concession and their selection for parallel socioeconomic studies. Around concession E, village Nkolbikon ('Nn') is inhabited by Baka, who depend to a very high degree on forest resources, as they have not traditionally practiced agriculture (Tieguhong and Ndoye, 2007; but see Levang et al., 2015). The village is located inside a formally established community forest that is located less than 5 km from the concession's annual cutting area of 2012. Community forests in Cameroon are managed under an arrangement whereby the community -or groups within the community -have the rights to harvest and sell the timber and the revenues are supposed to be distributed to the whole community (WRI, 2005). Another sample village, Ndembo, ('No'), inhabited by Kako and Pol people (Bantu), is located 15 km from the concession (Fig. 1). The two sample villages near concession S, Ngone ('Ne') and Meyos ('Ms'), are inhabited by Bulu people (Bantu). Their principal activities are agriculture, hunting and informal timber production. These two villages are very near the concession; many of their fields and plantations of cocoa and plantain are actually located within the current concession boundaries (Noumbissi, 2012) (Fig. 1)."}]},{"head":"Field sampling","index":5,"paragraphs":[{"index":1,"size":252,"text":"To determine whether local communities had access, on foot, to the three species of interest in the vicinity of their villages, we evaluated the density of trees within walking distance of the center of each village (Maukonen et al., in press) along three transects towards the concession, oriented 45°apart. Each transect extended 10 km from the village, subdivided into 4 strata: A, from the village center to 1.99 km distance; B, from 2 km to 3.99 km distance; C, from 4 km to 6.99 km and D, from 7 km to 10 km (Fig. 2). Sample plots of 5 ha (100 m  500 m) were laid out alternately on one side of the transect or the other. The number of sample plots was distributed among strata to maintain a constant sampling intensity of 0.5%. A total of 21 five-hectare plots were established around each of the 4 sample villages, as illustrated in Table 1 and Fig. 2. To determine whether the density of these species was affected by timber harvesting, sampling was carried out in both concessions on the 5000 ha annual cutting areas of 2012 shortly after the harvest, in UFA 10060 of SCTB, East Cameroon and UFA 09017 of FIPCAM, South Cameroon. Sampling was stratified using the companies' 25 ha inventory plots: five 25-ha inventory plots were selected at random within each of four quadrants. Within each selected inventory plot, five 5 ha sample plots were established at random, for a total of 20 five ha plots per concession."}]},{"head":"Data collection and analysis","index":6,"paragraphs":[{"index":1,"size":62,"text":"Within each 5 ha sample plot all individuals P20 cm diameter at breast height (dbh) of the three sample species were identified and their diameters measured at 1.3 m height or 10 cm above buttresses. In addition, stumps of these species, revealing the impact of the 2012 harvest in the timber concessions or of felling around the villages, were identified and noted."},{"index":2,"size":95,"text":"Because of a high number of zeros in the results, average density values per plot were compared using nonparametric tests (Kruskal-Wallis ANOVA H-test and Wilcoxon test). Statistical analyses were carried out using 'R' (R Core Team, 2013) to compare: (1) the density of individuals of harvestable and precommercial sizes around different villages and at different distances from the villages; (2) the density of individuals remaining compared to the density of stumps on the 2012 cutting area within the concession; and (3) the density of trees around the villages compared to the density on neighboring concessions."}]},{"head":"Results","index":7,"paragraphs":[{"index":1,"size":41,"text":"Densities of individuals are expressed per 100 ha except where indicated otherwise. Individuals are described as 'harvestable' if their diameters are larger than or equal to the minimum cutting diameter for that species; 'pre-commercial' is used for individuals below those sizes."}]},{"head":"Densities around the villages","index":8,"paragraphs":[{"index":1,"size":359,"text":"Individuals of Moabi occurred at lower densities than the other two species. The density of individuals of precommercial and harvestable sizes was significantly different among villages (P = 1.934eÀ05 and P = 0.014, respectively). For both size classes, the densities were higher around 'Ms' reaching 13.4 ± 4.4/100 ha for harvestable sizes and 51.4 ± 7.8/100 ha for precommercial sizes. The precommercial sizes were more abundant around the villages than the harvestable sizes: (22.8 ± 3.3/100 ha and 5.0 ± 1.4/100 ha, respectively) (Table 2). The density of precommercial individuals of Sapelli varied significantly among villages (P = 2.6eÀ08), but the density of harvestable Sapelli trees did not, averaging 9.5 ± 2.2/100 ha (P = 0.33). The density of precommercial Sapelli was higher than the density of those of harvestable size (32.6 ± 3.8/100 ha and up to 62.8 ± 8.0/100 ha around 'No'; and 9.6 ± 2.3/100 ha, respectively). Precommercial-sized Tali trees were poorly represented, and their density did not vary significantly among villages (P = 0.111). However, the density of individuals of harvestable size did vary significantly among villages (P = 0.001); densities around 'No' were significantly lower than around the other 3 villages. Around the villages, the density of harvestable Tali trees (56.0 ± 5.1/100 ha) was higher than the density of individuals of pre-commercial size (3.8 ± 0.9/100 ha). Stumps of Moabi, Sapelli and Tali were also found in plots around the villages. The density of stumps was not significantly different among villages (for Moabi, P = 0.2889; Sapelli, P = 0.5674; Tali, P = 0.2623), but the highest density of stumps was found near the village 'Ms': (2.8 ± 0.7/100 ha of Tali; Table 2). This represents only a small fraction of the number of harvestable Tali trees on the same area (54.2 ± 10.8/100 ha). Differences in density of trees at different distances from the villages were not statistically significant (Moabi, P = 0.8039; Sapelli, P = 0.4776; and Tali, P = 0.2514; Tables 3-5). The density of stumps varied with distance only for Sapelli (P = 0.024447) (Tables 6-8). All Sapelli stumps were found within 2 km of two of the villages."}]},{"head":"Densities in the concessions and the effect of logging","index":9,"paragraphs":[{"index":1,"size":395,"text":"Differences between concessions in the density of precommercial Moabi trees (E, 6.0 ± 2.3/100 ha; S, 9.0 ± 2.6/100 ha) were not statistically significant (P = 0.463), nor was the difference in harvestable Moabi trees, which occurred at very low densities (E, 2.0 ± 1.4/100 ha; S, 0 ± 0/100 ha; P = 0.317). The density of Sapelli varied between the two concessions, both for precommercial individuals (E, 54.0 ± 6.0/100 ha; S, 21.0 ± 3.4/100 ha; P = 0.002) and  13.4 ± 5.8 a 2.8 ± 1.6 a 6.6 ± 2.6 a 15.2 ± 2.2 a Sapelli-stumps 0.9 ± 0.4 a 0.9 ± 0.4 a 0.0 ± 0.0 a 0.0 ± 0.0 a Sapelli-precommercial 8.6 ± 3.6 a 14.2 ± 3.8 a 62.8 ± 8.0 b 15.2 ± 7.6 a Tali-harvestable 54.2 ± 10.8 a 55.2 ± 7.8 a 29.6 ± 6.8 b 84.8 ± 11.4 a Tali-stumps 2.8 ± 0.7 a 0.9 ± 0.4 a 0.0 ± 0.0 a 0.9 ± 0.4 a Tali-precommercial 0.0 ± 0.0 a 4.8 ± 2.0 a 5.8 ± 2.4 a 4.8 ± 2.0 a  for those of harvestable size (E, 11.0 ± 1.9/100 ha; S, 1.0 ± 0.7/100 ha; P = 0.001). Among the three sampled species, Tali occurred at the highest densities. The density of precommercial Tali trees varied significantly between concessions (E, 21.0 ± 3.7/100 ha; S, 2.0 ± 0.9/100 ha; P = 0.0007), but the densities of harvestable Tali trees did not (E, 64.0 ± 8.9/100 ha; S, 48.0 ± 4.9/100 ha; P = 0.63). On concessions, harvestable individuals occurred at higher densities than precommercial individuals (averaging 56.0 ± 7.2/100 ha and 11.5 ± 3.1/100 ha, P = 0.0007, respectively) (Table 9). Stump densities did not differ significantly between concessions: for Sapelli, 3.0 ± 1.5/100 ha on E and 1.0 ± 0.7/100 ha on S (P = 0.534) and for Tali 8.0 ± 2.5/100 ha on E and 3.0 ± 1.1/100 ha on S (P = 0.371). The proportion of harvestable trees extracted did not differ for Tali (11% on E and 6% on S, P = 0.63), but it did for Sapelli, where on concession E 21% of harvestable trees were extracted as compared to 50% on concession S (P = 0.001). No Moabi stumps were found on sample plots in the 2012 cutting area of either of the two concessions (Table 9)."}]},{"head":"The density of species around villages compared to their density in concessions","index":10,"paragraphs":[{"index":1,"size":120,"text":"The relative density of individuals on concessions and around villages varied between concessions and among species (Table 10). The density of Moabi trees was significantly lower on concession S as compared to its neighboring villages for both harvestable trees (0.0 ± 0.0/100 ha and 7.6 ± 1.7/100 ha, respectively; P = 0.018) and precommercial sizes (9.0 ± 2.6/100 ha and 34.7 ± 3.7/100 ha, respectively, P = 0.002). There were no significant differences in densities of Moabi between concession E and its neighboring villages: 2.0 ± 1.4/100 ha and 2.3 ± 0.8/100 ha respectively, of harvestable trees (P = 0.576); and 6.0 ± 2.3/100 ha and 10.9 ± 2.2/ 100 ha, respectively, for precommercial sizes (P = 0.273; Table 10)."}]},{"head":"Table 9","index":11,"paragraphs":[{"index":1,"size":102,"text":"Average density of stumps and of harvestable trees per 100 ha (cutting diameters: Moabi P 80 cm, Sapelli P 100 cm, Tali P 60 cm) on concessions and percentage extracted. Different subscripts indicate statistically significant differences between concessions.  0.0-1.99 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.0-3.99 0 ± 0 0 ± 0 0 ± 0 6.6 ± 1.2 1.6 ± 0.6 4.0-6.99 0 ± 0 0 ± 0 3.3 ± 0.8 3.3 ± 0.8 1.6 ± 0.6 7.0-10.0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0"}]},{"head":"Table 7","index":12,"paragraphs":[{"index":1,"size":12,"text":"Density of stumps of Sapelli/100 ha by stratum in the different villages."},{"index":2,"size":70,"text":"Villages/strata Ms Ne No Nn Average 0.0-1.99 6.6 ± 1.2 6.6 ± 1.2 0 ± 0 0 ± 0 3.3 ± 0.8 2.0-3.99 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 4.0-6.99 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 7.0-10.0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0"}]},{"head":"Table 8","index":13,"paragraphs":[{"index":1,"size":12,"text":"Density of stumps of Tali/100 ha by stratum in the different villages."},{"index":2,"size":130,"text":"Villages/strata Ms Ne No Nn Average 0.0-1.99 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0 2.0-3.99 13.3 ± 1.2 6.6 ± 1.2 0 ± 0 0 ± 0 5.0 ± 0.9 4.0-6.99 3.3 ± 0.8 0 ± 0 0 ± 0 0 ± 0 0.8 ± 0.4 7.0-10.0 0 ± 0 0 ± 0 0 ± 0 2.2 ± 0.7 0.5 ± 0.3 Fig. 3. Density per 100 ha of individuals of Moabi, Sapelli and Tali, harvestable and precommercial, on concessions and around villages. The minimum cutting diameter varies among species (Moabi P 80 cm, Sapelli P 100 cm, Tali P 60 cm). Different letters indicate statistically significant differences between densities on concessions and densities around villages for each size category and species."}]},{"head":"Table 10","index":14,"paragraphs":[{"index":1,"size":138,"text":"Tree densities/100 ha (harvestable and precommercial) on concessions and the averages between their neighboring villages. Different subscripts indicate statistically significant differences between villages and their neighboring concessions (a, b, c, d) or between concessions (w, x, y, z). Moabi 10.9 ± 2.2 a 2.3 ± 0.8 b 6.0 ± 2.3 a,x 2.0 ± 1.4 b,y 9.0 ± 2.6 c,x 0.0 ± 0.0 e,y 34.7 ± 3.7 d 7.6 ± 1.7 f Sapelli 53.8 ± 3.9 a 10.9 ± 2.3 b 54.0 ± 6.0 a,x 11.0 ± 1.9 b,z 21.0 ± 3.4 c,y 1.0 ± 0.7 d,w 11.4 ± 1.6 e 8.0 ± 2.2 f Tali 5.2 ± 1.0 a 57.1 ± 5.5 c 21.0 ± 3.7 b,x 64.0 ± 8.9 c,z 2.0 ± 0.9 d, y 48.0 ± 0.9 e,z 2.3 ± 0.7 d 54.7 ± 4.6 e"}]},{"head":"Species","index":15,"paragraphs":[{"index":1,"size":123,"text":"The density of precommercial Sapelli trees was not significantly different on concession E as compared to the surrounding villages (54.0 ± 6.0/100 ha and 53.8 ± 3.9/100 ha, respectively, P = 0.951). However, the density of precommercial Sapelli was significantly higher on concession S than around the nearby villages (21.0 ± 3.4/100 and 11.4 ± 1.6/100 ha, respectively, P = 0.073). Densities of harvestable Sapelli trees on concession E were not significantly different from densities around the surrounding villages (11.0 ± 1.9/100 ha and 10.9 ± 2.3/100 ha, respectively; P = 0.251). However, the density of harvestable Sapelli trees on concession S (1.0 ± 0.7/100 ha) was significantly lower than around its neighboring villages (8.0 ± 2.2/100 ha; P = 0.048) (Table 10)."},{"index":2,"size":115,"text":"Densities of harvestable Tali trees on concessions S and E and their neighboring villages did not vary significantly (for concession S, 48.0 ± 4.9/100 ha and 54.7 ± 4.6/100 ha respectively, P = 0.672; for concession E, 64.0 ± 8.9/100 ha and 57.1 ± 5.5/100 ha, respectively P = 0.619). Similarly, the density of precommercial Tali trees was not significantly different between concession S and its surrounding villages (2.0 ± 0.9/100 ha and 2.3 ± 0.7/100 ha, respectively, P = 0.826). However there was a significantly higher density of precommercial Tali trees on concession E as compared to surrounding villages (21.0 ± 3.7/100 ha and 5.2 ± 1.0/100 ha, respectively, P = 0.002) (Table 10)."},{"index":3,"size":173,"text":"Considering all villages and both concessions together, the density of Moabi trees was higher, on average, around the villages than in the concessions: 5.0 ± 1.3/100 ha and 1.0 ± 0.9/100 ha, respectively, for harvestable trees (P = 0.026); and 22.5 ± 3.3 individuals/100 ha as compared to 7.5 ± 2.4/100 ha, respectively, for precommercial sizes (P = 0.003; Fig. 3). The density of harvestable and precommercial trees of Sapelli did not vary significantly between concessions and villages: 6 ± 1.6/100 ha and 9.5 ± 2.2/100 ha for harvestable trees (P = 0.823); and 37.5 ± 5.5/100 ha and 32.6 ± 3.8/100 ha, respectively, for precommercial sizes (P = 0.342). For Tali trees, there was no significant difference between densities of individuals of harvestable sizes on concessions and around villages (56.0 ± 7. 2/100 ha and 55.9 ± 5.1/100 ha, respectively, P = 0.95). However, for precommercial trees the average densities were higher on concessions than around villages (11.5 ± 3.1/100 ha and 3.8 ± 0.9/100 ha, respectively, P = 0.02) (Fig. 3)."}]},{"head":"Discussion","index":16,"paragraphs":[]},{"head":"Species density around villages","index":17,"paragraphs":[{"index":1,"size":141,"text":"The density of tree species of interest varied among villages: some had two to three times more individuals of a species within 10 km than did others (Table 2). This could reflect the size of the village, the topography around it, past logging activities and the extent of agricultural activities, as well as variation in past ecological circumstances favoring regeneration of various species. It had been expected that density of trees would increase with distance because villagers establish fields in the vicinity of the villages. The fact that density did not change in a significant way with distance reveals either that trees have not been felled in the vicinity of villages; or that trees have been felled throughout this area, at a consistent rate. Agricultural fields and evidence of artisanal felling and sawing were found the full length of the transects."},{"index":2,"size":201,"text":"The lower densities of Moabi trees as compared to those of Sapelli and Tali may reflect the inhibition of regeneration over the years as the result of ecological factors including the collection of fruits (Van Dijk, 1997 in Plenderleith andBrown, 2004). Low densities of both Moabi and Sapelli trees of harvestable size around villages may also reflect logging. In 'Ms', less than 2 km from the concession, and 'Ne', practically within the concession, the stumps of Tali and Sapelli resulted from felling by the concessionaire, with permission from the local people. Stumps of Moabi and Tali were found around the villages of 'No' and 'Nn', located 8-10 km from the concession. Apparently these trees were felled by local people. In the community forest established formally around one of these villages, logging of commercial species was ongoing at the time of this study. Felling trees to sell their timber is one of the best options local people have to obtain relatively large sums of cash in case of urgent need, for example for a health emergency (Cerutti et al., 2008;Levang et al., 2015;Noumbissi, 2012). The legal framework for community forestry was established within the most recent forestry law to formalize this option."},{"index":3,"size":123,"text":"Other studies have found densities of Moabi to be even lower than the 7-64 trees P20 cm dbh per 100 ha we found around villages and the 8-9 trees P20 cm dbh per 100 ha we found on concessions. In two different areas of Cameroon, Schneemann (1995) and Nef (1997 in Plenderleith andBrown, 2004) found between 1 and 8 Moabi trees/100 ha. Vermeulen and Doucet (2004) documented 1.9 Moabi trees greater than 100 cm diameter/100 ha in the agroforestry zone around villages near the Dja forest (as compared to the 1-13 greater than 80 cm per 100 ha, depending on the village, in our study). They calculated that this density would be enough to meet the needs of the villagers in the area."},{"index":4,"size":325,"text":"According to Debroux (1998), Moabi attains sexual maturity between 50 and 70 cm diameter, at which size it produces flowers and fruits. With densities of 1-13 Moabi trees greater than 80 cm dbh per 100 ha within 10 km of their villages on the side toward the concession, the different villages had access to 157-2045 large, fruit-producing Moabi trees within those 15,730 ha. If the density were the same on the other side of the village, they would have about 315-4090 Moabi trees P80 cm within that distance of the village, in addition to productive trees below that diameter. Based on their quantitative analysis of consumption in a village near the Dja forest in southwest Cameroon, Vermeulen and Doucet (2004) determined that the village consumed 107,000 Moabi seeds/year as oil, about 2745 seeds/household. Using Debroux's (1998) estimation that an average mature Moabi (70-240 cm diameter) produces 6000 seeds every 3 years, Vermeulen and Doucet calculated that a village of 300 people (39 households) required 50 fruit-bearing Moabi trees to meet their household needs for fruit and oil. These estimates imply that the four villages we sampled would have enough harvest-size Moabi trees within 10 km of their villages to provide for between 1890 and 24,540 people, or about 237-3067 households, depending on the village. In addition, trees between 50 cm and 80 cm, below the minimum felling diameter, also produce fruit, and occur at even higher densities around the villages. It has also been documented that villagers travel even further, as far as two days' walk (50 km) from the village to obtain Moabi fruits, camping in the forest during the fruiting period (Schneemann, 1995). However, current densities of harvestable trees within the logging concessions we studied were found to be so low that on one concession none were registered in our sample plots. It will be important that villagers sustain the trees around their villages to ensure their future access to this important resource."},{"index":5,"size":153,"text":"The average density of 3-15 harvestable Sapelli trees per 100 ha, and 30-85 harvestable Tali trees per 100 ha, depending on the village, meant that villagers had access to approximately 472-2359 harvestable Sapelli and 4719-13,371 harvestable Tali trees in the 15,730 ha within 10 km of their villages towards the concession. If the same densities were found on the other side of the village, they would have access to double that number. Muvatsi et al. (in press) estimated that Sapelli trees P 80 cm dbh yield 10.9 kg/tree each season of I. oyemensis caterpillars while Tali trees P 60 cm dbh yield 8.2 kg of C. forda caterpillars/tree/season, so these trees could be expected to provide between about 5145 kg and 25,713 kg of I. oyemensis and between 38,696 kg and 109,642 kg of C. forda caterpillars/season, just from the half circle of land within 10 km of the village, towards the concession."},{"index":6,"size":248,"text":"Precommercial Sapelli trees (20-100 cm dbh) were found at densities of 9-63 individuals per 100 ha, depending on the village, or 1416-9910 individuals over the 15,730 ha within 10 km of the villages towards the concessions, possibly double that if the density on the other side of the village is similar. Each one could be expected to produce an average of 1.14 kg/tree of I. oyamelensis caterpillars/season (Muvatsi et al., in press), an additional 1614 kg to 11,297 kg from that area. However, because harvestable Sapelli trees produce more than 9 times more caterpillars per tree than do precommercial sizes, the extraction of these large trees would have a significant impact on the availability of this important food resource. In the case of Tali, it's notable that around the sample villages the density of precommercial trees (0-6 trees/100 ha) was lower than the density of trees of harvestable size. This may reflect poor regeneration under closed canopy in the past, as suggested by Doucet et al. (2009). It may also reflect felling of small trees by villagers, as revealed by the presence of stumps. Tali is appreciated for its durability and is used for local construction as well as artisanal logging. These precommercial trees could be expected to produce 5.5 kg of C. forda caterpillars/tree/season (Muvatsi et al., in press), a total of up to 5190 kg/season over the 15,730 ha of the area sampled (or twice that over the 31,460 ha within 10 km of the village)."}]},{"head":"Species density in the concessions and the effect of logging","index":18,"paragraphs":[{"index":1,"size":237,"text":"On one concession no Moabi P 80 cm dbh were found, and on the other, only 2/100 ha. The densities found in this study are quite similar to the 3 Moabi P 70 cm dbh/100 ha recorded in the Dja district (Doucet et al., 2009). Moabi has been logged for export for decades, most of it from eastern Cameroon. It has been suggested that logging has led to a decrease and even the disappearance of Moabi in areas that have been logged over long periods. As a result, the World Conservation Monitoring Centre has classified Moabi in Cameroon as ''vulnerable\" (Plenderleith and Brown, 2004). A survey around four villages in the Mbang subdistrict showed that as of 1993, logging companies had extracted about 37% of the initial number of Moabi trees (as many as 86% around one village). As early as the 1990s, communities were asking logging companies to stop felling this species, in some cases attaching boards on trees indicating the name of the individual entitled to collect its fruits and in other cases arming themselves with bows and arrows to defend the trees (Schneemann, 1995). It is noteworthy that neither of the concessionaires studied harvested Moabi trees on their 2012 cutting areas, respecting an agreement with the communities who harvest the fruits for their seed oil, but the densities of commercial sized trees on concession S, were already much lower than around the neighboring villages."},{"index":2,"size":258,"text":"Sapelli trees were found at lower densities (1-11/100 ha of commercial size; 22-65/100 ha P 20 cm dbh) than those reported from other logged forests in Cameroon. Garcia et al. (2001) reported 146 sapelli/100 ha P 20 cm dbh on a 100 ha plot in Ndama in the absence of harvesting while Lourmas et al. (2007) reported 152 sapelli P10 cm dbh before and 113/100 ha after the 2002 logging operation, on the same plot. Dubois (1998 in Garcia et al., 2001) reported 36 sapelli P20 cm dbh/100 ha on a 400 ha plot in Dimako after harvesting. The low density we found probably reflects not only the regeneration ecology of this shadeintolerant species (Hall et al., 2003;Hall, 2008) but also the high level of demand for its timber, not only now but in the past (ATIBT, 2007). Selective timber harvesting began in Cameroon in the 1880s and increased starting in the 1920s. Sapelli is one of the species that was most appreciated from the beginning (Topa et al., 2010). The areas managed by these two concessionaires have a history of prior exploitation by other companies. In the case of Concessionaire S, timber harvests had been carried out at least since 1998 by ECAM-PLACAGE and COCAM (1998-1999) and WIJMA (2000À2001). Concession E had also been harvested by previous concession holders, since at least 1969since at least , by EFC (1969since at least -1989)), SFID (1971-1975) and SEBC (1969-1998)  (Medinof, 2004). Before the 1990s, timber harvesting was carried out under licenses that did not require management plans (ATIBT, 2007)."},{"index":3,"size":192,"text":"The more than 10-fold difference in density of harvestable Sapelli trees between the two concessions may reflect the intensity of past harvesting or the frequency and distribution of past regeneration opportunities. The proportion of harvestable trees extracted in 2012 varied between Sapelli and Tali: 21--50% of Sapelli trees compared to 6-11% of Tali trees, depending on the concession. Sapelli has practically unlimited demand while Tali is harvested only in response to orders. The low level of extraction of Tali means that timber harvesting has not, so far, had a significant impact on the densities of this species on concessions. The removal of half, or fewer, of harvest-size individuals, even of Sapelli, was explained by the concessionaires as reflecting high quality standards for logs and limited access to some portions of the concession due to flooding in lowlands or steep slopes, both of which were observed during sampling. These areas are protected from harvesting by regulation, but they are also inaccessible for logging machinery. Furthermore, regulations require that seed trees of commercial species be left standing (ATIBT, 2007). The commercial-sized trees remaining after harvesting operations represent an important resource base for edible caterpillars."},{"index":4,"size":127,"text":"It's noteworthy that the density of precommercial Sapelli trees (20-99.9 cm dbh; 21 ± 3.4/100 ha on concession S and 54.0 ± 6.0/100 ha on concession E) was twice to almost five times higher than the density of harvestable trees. These trees can be expected to produce caterpillars each year, though at considerably lower rates than larger trees. Those that survive and grow to harvestable size might be extracted in a subsequent cutting cycle (to reoccur in 30 years), but only if they are accessible and meet quality standards. The relatively high density of Tali of harvestable size compared to its density in precommercial size classes may reflect the fact that the commercial demand for Tali is limited, and that past regeneration opportunities have also been limited."}]},{"head":"Comparison between densities on villages and concessions","index":19,"paragraphs":[{"index":1,"size":120,"text":"The density of Moabi trees (both harvestable and precommercial), was higher around villages than on concessions, on average, and specifically on concession S (Fig. 3). This may reflect favorable regeneration conditions in the past; however it is more likely to reflect past logging events and the protection of these trees by villagers for their fruits and oil, as revealed in their negotiations with concessionaires to prevent their felling. The higher density of precommercial sized individuals of Tali on concessions than near villages may reflect the fact that villagers who fell trees for artisanal purposes do not respect the high diameters required by the international export market. These trees are used for local construction as well as for crafts and carpentry."}]},{"head":"Conclusion","index":20,"paragraphs":[{"index":1,"size":158,"text":"This study showed that the 2012 harvesting operation on the sampled concessions had not significantly reduced the density of the commercial-sized trees of these three species as compared to their density around neighboring villages. After logging, 50-79% of commercial Sapelli trees and 89-94% of commercial Tali trees were left standing on the cutting areas of the concessions. These trees may not meet quality standards or be extractable for timber, but they can continue to provide caterpillars at high annual rates, with no opportunity cost to timber production. At the same time, they represent important seed sources for regenerating these tree species. Nonetheless, the density of sapelli was found to be somewhat low as compared to the densities reported in the literature. This probably reflects harvesting that took place in the sampled regions before the current concessions were granted. The spatial extent of these prior operations may well have included the areas sampled within 10 km of the villages."},{"index":2,"size":98,"text":"Caterpillars can also be obtained from trees smaller than the commercial felling diameter, which are not the target of timber harvesting in concessions that respect high diameter limits for export products. Precommercial trees of Moabi and Sapelli were more abundant on concessions than trees of commercial size. However, Moabi trees don't produce fruits or seeds until they reach 50 cm, so some of these smaller trees would not yet be productive of NTFPs. In the case of Sapelli, it would take about 9 precommercial trees to produce the number of caterpillars yielded by a tree of harvestable size."},{"index":3,"size":176,"text":"Because local people most commonly collect NTFPs while traveling on foot through the forest, conservation of trees that produce food products should be prioritized within a reasonable walking distance of their villages. It is noteworthy that in this case villagers had successfully negotiated with neighboring timber concessions to refrain from felling commercial-sized Moabi trees because of their value to villagers for fruit and oil. This sort of negotiation between concessionaires and villagers represents a constructive initiative reflecting the country's 1994 Forestry Law, in which it is provided that timber exploitation must not hinder villagers' use of resources (Article 61, section 2). The Forest Law provides a mechanism, the 'Cahiers de Charge', for this sort of negotiation between villagers and concessionaires (Ndoye and Tieguhong, 2004). These should be promoted and supported. It is noteworthy, however, that these negotiations typically take place between industry and Bantu villagers. Pygmies are often excluded, although they are most dependent on forest resources. Approaches are needed to enhance their options for negotiating their interests, with both concessionaires and Bantu villagers (Nguiffo, 2007)."},{"index":4,"size":177,"text":"However, tree felling occurs even around villages, carried out not by concessionaires but by villagers. We learned from parallel socioeconomic studies (Levang et al., 2015;Noumbissi, 2012) that individual villagers periodically sell trees for timber, even if these trees yield fruits or other non-timber products used by others. We were told by Baka people that the harvesting of timber by their neighbors in the community forest meant that they had to travel further to obtain fruits and other non-timber products. This represents a significant opportunity cost to them. Typically it is women who seek to retain access to these food resources (Ngueguim et al., 2011) while men choose to fell the tree for timber. Felling to sell the timber yields a one-time benefit from Moabi trees, but it has been calculated that their value is higher for oil production: at 7.5 years, the Net Present Value of discounted oil revenues exceeds the timber value (Schneemann, 1995). Even within villages, it is important to promote the capacity to negotiate among individuals who use different resources from the same trees."},{"index":5,"size":131,"text":"There is considerable potential to manage these forests for the production of both timber and non-timber resources through spatial zoning, inventories, production analyses and negotiation of priorities and uses for each priority species, size class, resource and area, combined with the implementation of silvicultural practices to safeguard and sustain trees that produce both timber and non-timber resources. Our quantitative analyses reveal that the tradeoffs and opportunity costs involved may be relatively low. To date, silviculture is not implemented even to sustain timber species, calling into question future harvests of both timber and non-timber resources from timber concessions (Hall et al., 2003;Karsenty and Gourlet-Fleury, 2006;Cerutti et al., 2008;Duminil et al., 2016). Implementing management for the full spectrum of forest resources would increase the benefits and the beneficiaries of the Congo Basin forests."}]}],"figures":[{"text":"Fig. 1 . Fig. 1. Location of SCTB and FIPCAM concessions and associated sample villages in Cameroon. "},{"text":"Fig. 2 . Fig. 2. Layout of sample plots between villages and concessions, indicating distance strata A, B, C, and D (not to scale). "},{"text":"Table 2 Average density (per 100 ha) of trees and stumps around villages, with standard errors. Minimum cutting diameter: Moabi P 80 cm; Sapelli P 100 cm; Tali P 60 cm. Comparisons were made within rows, where different subscripts reveal statistically significant differences. Villages Ms Ne No Nn VillagesMsNeNoNn Species/size     Species/size Moabi-harvestable 13.4 ± 4.    Moabi-harvestable13.4 ± 4.  "},{"text":"Table 1 Sampling scheme across distance strata. Distance/stratum A: 0-1.99 km B: 2-3.99 km C: 4-6.99 km D: 7-10 km Distance/stratumA: 0-1.99 kmB: 2-3.99 kmC: 4-6.99 kmD: 7-10 km Stratum area 6 km 2 (600 ha) 18 km 2 (1800 ha) 51 km 2 (5100 ha) 82 km 2 (8200 ha) Stratum area6 km 2 (600 ha)18 km 2 (1800 ha)51 km 2 (5100 ha)82 km 2 (8200 ha) Sample plot area (0.5%) 3 ha 9 ha 26 ha 41 ha Sample plot area (0.5%)3 ha9 ha26 ha41 ha Number of 5 ha plots 3 a 3 a 6 a 9 Number of 5 ha plots3 a3 a6 a9  "},{"text":"Table 3 Density of Moabi trees/100 ha by distance stratum in the different villages. Villages/distance (km) Ms Ne No Nn Average Villages/distance (km)MsNeNoNnAverage 0.0-1.99 20.0 ± 11.5 20.0 ± 0.0 13.4 ± 13.2 13.4 ± 6.7 16.6 ± 8.3 0.0-1.9920.0 ± 11.520.0 ± 0.013.4 ± 13.213.4 ± 6.716.6 ± 8.3 2.0-3.99 60.0 ± 19.9 20.0 ± 11.5 6.6 ± 6.7 33.4 ± 17.6 30.0 ± 17.4 2.0-3.9960.0 ± 19.920.0 ± 11.56.6 ± 6.733.4 ± 17.630.0 ± 17.4 4.0-6.99 60.0 ± 13.6 20.0 ± 9.3 13.4 ± 6.7 26.6 ± 16.0 29.6 ± 13.3 4.0-6.9960.0 ± 13.620.0 ± 9.313.4 ± 6.726.6 ± 16.029.6 ± 13.3 7.0-10.0 84.4 ± 19.4 20.0 ± 9.4 0.0 ± 0.0 13.4 ± 6.6 29.8 ± 15.3 7.0-10.084.4 ± 19.420.0 ± 9.40.0 ± 0.013.4 ± 6.629.8 ± 15.3  "},{"text":"Table 4 Density of Sapelli trees/100 ha by stratum in the different villages. Villages/distance (km) Ms Ne No Nn Average Villages/distance (km)MsNeNoNnAverage 0.0-1.99 20.0 ± 11.6 13.4 ± 13.3 46.6 ± 24.0 33.4 ± 17.7 28.4 ± 16.6 0.0-1.9920.0 ± 11.613.4 ± 13.346.6 ± 24.033.4 ± 17.728.4 ± 16.6 2.0-3.99 6.6 ± 6.9 26.6 ± 17.7 40.0 ± 0.0 86.6 ± 33.4 40.0 ± 24.1 2.0-3.996.6 ± 6.926.6 ± 17.740.0 ± 0.086.6 ± 33.440.0 ± 24.1 4.0-6.99 10.0 ± 6.9 22.8 ± 5.6 80.0 ± 16.3 33.4 ± 6.70 36.0 ± 14.1 4.0-6.9910.0 ± 6.922.8 ± 5.680.0 ± 16.333.4 ± 6.7036.0 ± 14.1 7.0-10.0 35.6 ± 17.3 10.0 ± 12.2 80.0 ± 10.0 77.8 ± 15.1 52.0 ± 15.2 7.0-10.035.6 ± 17.310.0 ± 12.280.0 ± 10.077.8 ± 15.152.0 ± 15.2  "},{"text":"Table 5 Density of Tali trees/100 ha by stratum in the different villages. Villages/distance (km) Ms Ne No Nn Average Villages/distance (km)MsNeNoNnAverage 0.0-1.99 46.6 ± 20.1 46.6 ± 17.6 6.6 ± 20.1 33.4 ± 20.1 33.4 ± 17.7 0.0-1.9946.6 ± 20.146.6 ± 17.66.6 ± 20.133.4 ± 20.133.4 ± 17.7 2.0-3.99 73.4 ± 46.6 60.0 ± 11.5 40.0 ± 19.9 106.6 ± 20.1 70.0 ± 26.6 2.0-3.9973.4 ± 46.660.0 ± 11.540.0 ± 19.9106.6 ± 20.170.0 ± 26.6 4.0-6.99 56.6 ± 22.7 57.2 ± 15.9 40.0 ± 13.6 103.4 ± 24.9 64.0 ± 20.8 4.0-6.9956.6 ± 22.757.2 ± 15.940.0 ± 13.6103.4 ± 24.964.0 ± 20.8 7.0-10.0 48.8 ± 16.4 67.5 ± 13.8 40.0 ± 12.4 93.4 ± 18.8 62.2±16.4 7.0-10.048.8 ± 16.467.5 ± 13.840.0 ± 12.493.4 ± 18.862.2±16.4  "},{"text":"Table 6 Density of stumps of Moabi/100 ha by stratum in the different villages. Villages/strata Ms Ne No Nn Average Villages/strataMsNeNoNnAverage  "}],"sieverID":"16ae7f6b-99c9-4b5c-8cdd-d158ec036a79","abstract":"Many species of timber trees in Cameroon are exploited by logging companies for timber and by forestdependent communities for non-timber forest products (NTFPs). Quantitative analyses were conducted within and near forest concessions in Cameroon to determine the density of multiple use tree species that provide both timber for industry and foods consumed by local populations (fruit and oil or edible caterpillars), and how this has been affected by logging. Individuals of the three species (Moabi, Baillonella toxisperma; Sapelli, Entandrophragma cylindricum; and Tali, Erythrophleum suaveolens), including their stumps, were identified and measured on 5 ha (100 m  500 m) sample plots around 4 villages and in 2 concessions. Around each village 21 sample plots, stratified by distance, were laid out along three transects extending 10 km towards the concession, each oriented 45°from the other. In concessions, 20 plots were established within the 2012 cutting unit after timber harvesting, using a stratified random system. Moabi trees occurred at the lowest densities: around villages, 22.8 ± 3.3/100 ha of precommercial individuals and 5.0 ± 1.4/100 ha of individuals of harvestable size (P80 cm dbh); on concessions, 7.5 ± 2.4 precommercial trees/100 ha, and 0-2.0 ± 1.4/100 ha harvestable individuals. Densities of Sapelli trees were not significantly different between villages and concessions, averaging 32.6 ± 3.8/100 ha and 37.5 ± 5.5/100 ha, respectively, for precommercial sizes and 9.5 ± 2.2/100 ha and 6 ± 1.6/100 ha, respectively, for harvestable trees (P100 cm dbh). Pre-commercial Tali trees occurred at lower densities (3.8 ± 0.9/100 ha) around villages, as compared to 11.5 ± 3.1/100 ha on concessions. Harvestable Tali trees (P60 cm dbh) occurred at the same densities around villages and on concessions (56.0 ± 7.2/100 ha). Half, or more, of commercial-sized trees of caterpillar-hosting species were left standing after harvest on concessions (89-94% of Tali; 50-79% of Sapelli), reflecting constraints due to timber quality, market demand and inaccessibility. No harvestable Moabi trees were logged from the 2012 cutting areas, reflecting agreements between communities and concessionaires to leave them for fruit and oil, but densities were so low it will be important that villagers conserve those around their villages. Stumps of all three species were found around villages, revealing that mechanisms for negotiation are also needed among villagers with interests in either timber or non-timber resources obtained from the same tree species."}

data/part_2/01aa4508a3f899c2c0f9c407cf3de269.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01aa4508a3f899c2c0f9c407cf3de269","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/fee2b3a0-f7d6-4410-bde7-0d29aa267400/retrieve"},"pageCount":70,"title":"ASSESSMENT OF MICROBIOLOGICAL HAZARDS ALONG THE MILK VALUE CHAIN IN KILOSA AND MVOMERO DISTRICTS, TANZANIA ERNESTA JOSEPH A DISSERTATION SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN PUBLIC HEALTH AND FOOD SAFETY OF SOKOINE UNIVERSITY OF","keywords":[],"chapters":[{"head":"Background Information","index":1,"paragraphs":[{"index":1,"size":104,"text":"Milk is one of the most nutritious food; it is also the most perishable product known to favour growth of several microorganisms (Hempen et al., 2004). The liquid nature makes milk a highly vulnerable food to microbial contamination and an efficient vehicle for transmission of diseases to humans (Kivaria et al., 2006). It is an excellent culture and protective medium for certain microorganisms, particularly bacterial pathogens (Hempen et al., 2004). The presence of food-borne pathogens in milk is due to direct contact with contaminated sources in the dairy farm environment and to excretion from the udder of an infected animal (Oliver et al., 2005)."},{"index":2,"size":65,"text":"Traditionally, raw or unpasteurized milk has been a major vehicle for transmission of pathogens (Mubarack et al., 2010). Some of the microbial contaminants of milk cause milk spoilage while others are pathogenic to humans which may cause milk-borne and zoonotic diseases (Yirsaw, 2004). Pathogenic organisms in milk can be derived from the cow itself, from human handlers and/or from the environment (Hempen et al., 2004)."},{"index":3,"size":83,"text":"Pathogenic organisms commonly isolated from cow's milk include Staphylococcus, Streptococcus, Mycobacterium, Brucella, Escherchia and Corynebacterium (Yirsaw, 2004). These bacteria pose a serious threat to human health, and constitute about 90% of all dairy-related diseases (Donkor et al., 2007b). Some of these foodborne pathogens like Listeria, Campylobacter, Yersinia and Condria ruminantia, can cause life-threatening diseases to humans and animals (Lei et al., 2007). Diseases that commonly spread from the milk to human beings are tuberculosis, brucellosis, salmonellosis, listeriosis, campylobacteriosis, yersinoses and Q-fever (Yirsaw, 2004)."},{"index":4,"size":160,"text":"In the dairy sector, zoonotic pathogens such as Brucella and E. coli may be present in dairy animals, raw milk, milk products, and the farm environment but are often difficult to diagnose (Mosalagae et al., 2011). E. coli 0157:H7 is a causative agent for haemorrhagic diarrhea and kidney damage, especially in young and old individuals with weak immunity, and is highly acknowledged as an important animal origin food-borne zoonosis (Omore et al., 2004). Ingestion of contaminated raw unpasteurized milk is considered as the most possible way of contracting milk-borne zoonoses such as brucellosis (Mosalagae et al., 2011). Human brucellosis on the other hand is a severely debilitating disease that requires prolonged treatment which results to considerable medical expenses in addition to loss of income due to loss of working hours (John et al., 2010). Therefore detection of microbial pathogens in milk is the solution to the prevention and recognition of problems related to healthy and safety (Velusamy et al., 2009)."},{"index":5,"size":88,"text":"The use of molecular-based diagnostic methods provides an alternative approach for identification of specific pathogens in milk (Lei et al., 2007). Polymerase chain reaction (PCR) involves DNA analysis and can be superior to culture for detecting the main pathogens in food samples and results can be obtained at relatively shorter times compared to most conventional method (Lopez-Campos et al., 2012). In spite of advantages of using PCR for detection of microbes, it is expensive and complicated, requiring skilled workers to carry out the test (Velusamy et al., 2009)."},{"index":6,"size":182,"text":"Conventional methods for the detection and identification of microbial pathogenic agents mainly rely on specific microbiological and biochemical identification (Velusamy et al., 2009). Conventional detection methods of milk-borne pathogens are common and may seem to be cheap but they are cumbersome, time consuming, invariably non-specific and sometimes inaccurate (AlAll et al., 2012). Conventional culture methods remain the most reliable and accurate techniques for food-borne pathogen detection. Traditional methods, to a large extent, depend on using suitable culture media, where the culture and colony counting methods involve counting of bacteria. (Ge and Meng, 2009;Velusamy et al., 2009). Selective media are used to enhance the growth of the target organism(s) and suppress the growth of the rest (Ge and Meng, 2009). Although the culture based methods are found to be standard microbiological techniques to detect the single bacteria, amplification of the signal is required through growth of a single cell into a colony (Velusamy et al., 2009). Therefore PCR is used for more advanced techniques for accurate diagnosis of brucellosis that can overcome the draw backs of traditional diagnostic techniques (Moussa et al., 2010)."}]},{"head":"Problem Statement and Justification","index":2,"paragraphs":[{"index":1,"size":132,"text":"Consumption of raw milk is a common practice in Tanzania particularly among pastoral and agro-pastoral communities who keep traditional livestock with limited or no diseases control programme such as those found in Kilosa and Mvomero districts. Such behaviour of consumption of raw milk predisposes consumers to risk of contracting zoonotic and other milk-borne diseases. Milk supply is high in Kilosa and Mvomero districts where some of it is consumed at home while some is sold to the milk processing factories such as Shambani Milk Enterprises in Morogoro, Tanga fresh factory in Tanga Region and DESA milk factory of Dar es Salaam. Due to the fact that milk is a perishable commodity, poor handling can exert both a public health and economic toll, thus requiring hygienic vigilance throughout the production to consumer chain."},{"index":2,"size":210,"text":"Most of the milk consumed in rural areas is consumed raw. It is also known that even in town, despite the fact that most people use milk for tea or coffee or feeding children for which the milk is boiled, there are a lot of people who prefer drinking sour milk prepared from raw un-boiled milk. It was observed that most people prefer consumption of raw to boiled milk and they associate their preference with the good taste of raw milk (Karimuribo et al., 2005). This tradition therefore poses public health risk to consumers in relation to milk-borne diseases. The consumption of raw milk has been recognized as a major cause of food borne diseases (Oliver et al., 2005). The informally marketed raw milk in Kilosa and Mvomero districts could be an important source of infection with a wide range of bacteria if effective control measures including improved hygienic handling of milk along the milk value chain and milk pasteurization are not practiced. Educational efforts should be aimed at making the rural population aware of the health risks associated with consumption of raw unpasteurized milk as well as reducing the potential for contamination during harvesting of milk which will result in a reduction of food borne pathogens in raw milk."},{"index":3,"size":62,"text":"The rapid and sensitive nature of PCR gives a chance of testing multiple microorganisms in a short time for accurate detection (AlAll et al., 2012). Therefore rapid and effective detection and identification of food borne pathogens is important not only in controlling and investigating food-borne diseases but also in improving food safety and management in the food industry (Oh et al., 2009)."}]},{"head":"Objectives","index":3,"paragraphs":[]},{"head":"General objective","index":4,"paragraphs":[{"index":1,"size":21,"text":"To carry out assessment of microbiological hazards that pose risk to consumers of milk produced in Kilosa and Mvomero districts, Tanzania."}]},{"head":"Specific objectives","index":5,"paragraphs":[{"index":1,"size":19,"text":"1. To assess milk quality along the milk value chain based on total viable counts and total coliform counts."},{"index":2,"size":15,"text":"2. To identify factors influencing contamination of milk with microorganisms along the milk value chain."},{"index":3,"size":19,"text":"3. To identify zoonotic pathogens (Brucella abortus and E.coli 0157:H7) present in milk produced by pastoral and smallholder farmers."}]},{"head":"CHAPTER TWO","index":6,"paragraphs":[]},{"head":"LITERATURE REVIEW","index":7,"paragraphs":[]},{"head":"Milk Production System in Tanzania","index":8,"paragraphs":[{"index":1,"size":91,"text":"The dairy industry in Tanzania has a great potential for improving the living standards of the people, and contributing towards reduction of poverty through improved nutrition, arising from consumption of milk and incomes raised from sale of milk and milk products (Njombe et al., 2011). The bulk of milk produced in the country originates from traditional cattle and is consumed at the household level as well as marketed to reach other consumers (TAMPA, 2011). Total annual milk production in Tanzania is currently estimated at 1.65 billion litres (Njombe et al., 2011)."},{"index":2,"size":222,"text":"Milk production in Tanzania is out under the traditional and commercial improved dairy production systems and about 70% of the milk produced comes from the traditional sector (indigenous cattle) kept in rural areas, while the remaining 30% comes from improved dairy cattle mainly kept by smallholder producers (Njombe et al., 2011). Smallholder farmers in pastoral and agro-pastoral production systems account for about 99% of the total livestock population and support the livelihoods of approximately 80% of the population (Swai and Schoonman, 2010). Smallholder dairy farming in Tanzania is a relatively recent undertaking, initiated and developed either through bilateral agency support or through private farmers buying dairy cattle to supplement their incomes (Karimuribo et al., 2005). In Tanzania a farmer operating less than 50 heads of cattle is considered to be smallholder (Tulahi, 2010). Smallholder farmers are still the leading keepers for dairy cattle in Morogoro region whereby Kilosa district is reported to have most organizations involved in dairy production, followed by the Mvomero district which was having the largest proportion of dairy crossbred cows in the region making 49.72 % of all dairies in Morogoro (Morogoro profile, 2007). The dairy cattle are kept by smallholder farmers and few medium and large scale farms. The indigenous cattle are kept by traditional livestock keepers in the pastoral and agro-pastoral systems (Njombe et al., 2011)."}]},{"head":"Factors that Influence Food Safety in Dairy Production System","index":9,"paragraphs":[{"index":1,"size":149,"text":"In many countries of sub-Saharan Africa, significant post-harvest milk losses are incurred along the supply chain, largely due to lack of adequate markets and spoilage (Lore et al., 2005). Milk is mainly produced by indigenous cattle which are widely distributed in different areas including remote villages where the road infrastructure is poor and having inadequate provision of utilities such electricity (Njombe et al., 2011). Its quality is influenced significantly by adulteration, spoilage from poor storage and contamination during and after milking (Mdegela et al., 2009), stocking and transport method, poor cooling/refrigeration conditions leading to the growth of bacteria (Pistocchin et al., 2009;Afzal et al., 2011). These problems contribute to inefficiency in milk collection and addition of cost for milk collection as well as milk processing. Non-existence of producer societies not only makes collection and marketing of raw milk difficult but also discourage introduction of innovations (Njombe et al., 2011)."}]},{"head":"Concepts of Food Safety and Risk Analysis","index":10,"paragraphs":[{"index":1,"size":182,"text":"Zoonotic diseases associated with dairy farming can be transmitted from animals to humans through various routes including ingestion of cow-derived foods such as milk, beef as well as milk and beef products. Possible means of transmission may also include direct contact as a consequence of contamination of wider environment due to spread of organic wastes/effluents from dairy farms (Andreoletti et al., 2009). A primary route of pathogen transmission in milk is faecal contamination during milking (Oliver et al., 2009). As regular inhabitants of the intestine, enterococci may serve as indicators for faecal or soil contamination and implies a risk that other enteric pathogens may be present in the milk (Kivaria et al., 2006). Due to the low dose of E. coli O157:H7 needed to cause infection, sensitive and rapid detection methods for E. coli O157:H7 in food samples are necessary in order for the food industry to ensure a safe supply of foods (Lopez-Campos et al., 2012). Unpasteurized milk and processed dairy foods from infected animals have been considered a source of Brucella infection for the general population (John et al., 2010)."},{"index":2,"size":163,"text":"Informal milk markets involve milk sale through unregulated channels (Donkor et al., 2007b). It account for over 80% of milk sales in most of sub-Saharan African countries, and earlier studies have shown that consumers enjoy convenient delivery and lower prices from such informal markets (Donkor et al., 2007a). Informal milk marketing is the dominant channel through which milk produced by smallholder farmers reaches consumers in urban centres in Tanzania (Kilango et al., 2012). Informal dairy industry in Tanzania plays a dominant role in milk marketing, handling over 80%-90% of all milk sold (Swai and Schoonman, 2011). Unhygienic handling of milk at the farm influences spoilage of milk at the processor level (Lore et al., 2005). Since there is little or no quality control for milk handling practices in the informal channels, there is potential for presence of zoonotic pathogens, adulterants and antimicrobial drug residues in informal markets and these are of public health risks to consumers (Swai and Schoonman, 2011;Kilango et al., 2012)."},{"index":3,"size":91,"text":"Most developing countries lack affordable testing methods to monitor for food-borne hazards and to ensure that highly perishable products remain safe from a health standpoint, as the product moves through the value chain (Narrod et al., 2011). In developing countries such as Tanzania, outlets for the purchase of milk are numerous but most operate under unsanitary conditions and are not adequately monitored or regulated; such conditions pose risk to food-borne zoonoses (Swai and Schoonman, 2011). In milk, risk factors leading to the growth of pathogenic bacteria occur throughout the value chain:"},{"index":4,"size":19,"text":"at the farm, at the collection center and at the consumption stage of the chain (Narrod et al., 2011)."}]},{"head":"Food Quality Control Systems in Dairy Production Systems","index":11,"paragraphs":[{"index":1,"size":245,"text":"Proper management of dairy farm operations is not only essential in animal welfare terms but also significantly reduces the likelihood of dairy cows transmitting food-borne zoonotic diseases to humans (Andreoletti et al., 2009). To protect public health against milk-borne infections, there are regulations that require proper hygienic handling of milk and its pasteurization (Donkor et al., 2007a). Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labelling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches (Oliver et al., 2009). Many countries have milk quality regulations, including limits on the total number of bacteria in raw milk, to ensure the quality and safety of the final product (Worku et al., 2012). Tanzania Food, Drugs and Cosmetics Acts 2003, states that; 'Milk from diseased dairy animals not to be used for human consumption'. The total bacterial counts of cooled raw milk, produced under good hygienic conditions, should be lower than 10 000 bacteria/ml, and if the bacterial counts of milk increase significantly, e.g. to over 3 million/ml this could lead to significant degradation of fat, protein or lactose causing off-flavours and would significantly reduce the flexibility the processor has with respect to storage and use of milk (Oliver et al., 2005). A harmonized trade standards agreed by EAC and COMESA Member States recognize three grades of milk and set upper limits on total bacteria count in processed products and raw milk (EAC, 2007)."},{"index":2,"size":81,"text":"The maximum level agreed /recognized grades of pasteurazed milk include 30 000 cfu/ml for total plate count, 10 cfu/ml for total coliforms and absent for Escherichia coli while the standard set for raw milk for total plate count includes, grade I 0r A <200 000 cfu/ml, grade II or B > 200 000-1 i000 000, grade III or C > 1 000 000-2 000 000. For coliform plate count grades are; very good 0-1 000, good 1 000-50 000 (EAC, 2007)."}]},{"head":"Milking Practices that Can Affect Milk Quality","index":12,"paragraphs":[{"index":1,"size":230,"text":"Quality deterioration of milk starts just after milking, when it is carried out under unhygienic conditions (Afzal et al., 2011). Milking hygiene influences the overall hygienic status of the farm including cleanliness of premises, animals, equipment and personnel which, in turn, determine the level of the risk of contamination of raw milk (Andreoletti et al., 2009). The major practices and factors that affect the quality of milk at the farm are animal mishandling, unhygienic milking, transportation equipment's and poor storage conditions (Yirsaw, 2004;Kurwijila, 2006;Pistocchin et al., 2009;Afzal et al., 2011). Microorganisms adhere to surfaces of the milking equipment and milk residues remain in the equipment after the cleaning cycle (Vissers and Driehuis, 2008). Milk drops left on the surface of milking equipments act as excellent media for the growth of a variety of bacteria that can then contaminate the milk of subsequent milking (Afzal et al., 2011;Worku et al., 2012). All such practices results in poor quality of milk in terms of its compositional and bacterial load. Microorganisms may contaminate milk at various stages of milk procurement, processing and distribution (Yirsaw, 2004;Lore et al., 2005). The use of soap and good quality water for cleaning the equipment could be expected to remove milk remains, including microorganisms, thereby affecting the microbial quality of the milk (Kivaria et al., 2006). Processed milk must be handled hygienically to avoid post-processing contamination (Kurwijila, 2006)."}]},{"head":"Methods of Detecting Microbiological Hazards in Milk","index":13,"paragraphs":[{"index":1,"size":88,"text":"Numerous technologies have been developed to enumerate the total and groups of microorganisms and to detect and identify specific pathogens and toxins present in foods (Ge and Meng, 2009). Polymerase Chain Reaction technology has successfully shortened analysis time and has been widely applied for the detection of food-borne pathogens (AlAll et al., 2012). The rapid increase in the number of copies of the target sequence that can be achieved with PCR-based methods makes them ideal candidates for the development of faster microbiological detection systems (Lopez-Campos et al., 2012)."},{"index":2,"size":41,"text":"Methods linking PCR detection to samples enriched for pathogen proliferation (usually overnight) are available for the majority of food-borne pathogens. Other method like ELISA which is antibody-based assay, is useful for detecting pathogens and toxins in food (Ge and Meng, 2009)."},{"index":3,"size":127,"text":"Traditional culture methods for detecting bacterial pathogens in food are based on the incorporation of food sample into a nutrient medium in which the bacteria can multiply, thus providing visual confirmation of their growth (Lopez-Campos et al., 2012). It relies primarily on direct plating methods and biochemical tests which are time-consuming, labour-intensive, and expensive due to the necessity of separate cultivation of each target species (Oh et al., 2009). It provides essential benefits, such as diluting the effects of inhibitors, allowing the differentiation of viable from non-viable cells, and allowing for the repair of cell stress or injury that may have resulted during food processing, therefore it would be difficult to completely eliminate enrichment culture from the process of pathogen detection in foods (Lopez-Campos et al., 2012)."}]},{"head":"Qualitative Methods for Assessing Quality and Safety of Milk along the Milk","index":14,"paragraphs":[]},{"head":"Value Chain","index":15,"paragraphs":[{"index":1,"size":90,"text":"Qualitative procedures are used when it is not necessary to know the amount of a microorganisms present in a sample but only its presence or absence (López-Campos et al., 2012). The detection of pathogen-specific DNA via PCR addresses the issues of presence of the microbes without the need for culture (Oh et al., 2009). Qualitative detection tests are used if information concerning the presence of an organism in a specified quantity of food is required and sensitive quantitative detection is usually achieved by traditional culture methods (López-Campos et al., 2012)."},{"index":2,"size":101,"text":"There are four simple tests for milk quality:sight-and-smell (organoleptic) test, clot-onboiling test, alcohol test and lactometer test. These tests are routinely carried out at milk collection points to ensure that only milk of acceptable quality is received (Lore et al., 2006). Organoleptic test is the simplest test as it requires only use of the senses of smell and sight (Kurwijila, 2006). The milk quality is judged by the use of a person's senses view, smell, and taste if necessary. (Pandey and Voskuil, 2011). Milk which contains objectionable smell or particles or has an abnormal colour can easily be detected (Kurwijila, 2006)."},{"index":3,"size":70,"text":"Clot on boiling is quick and simple test which allows one to reject milk that has developed high acidity or colostral milk that has a very high percentage of whey proteins, which do not withstand heating at high temperatures (Kurwijila, 2006). If the milk is sour or if the milk is abnormal (colostrum or mastitis milk) the milk will clot and does not pass this test (Pandey and Voskuil, 2011)."},{"index":4,"size":143,"text":"Alcohol test is carried out when acid levels are high enough, the addition of an equal amount of 68 per cent alcohol to milk will lead to further dehydration and destabilization of casein and cause the milk to clot (Kurwijila, 2006). In case there is any reason to suspect that milk is sour, the alcohol test is used for rapid determination of an elevated acidity of milk (Pandey and Voskuil, 2011). The alcohol test can detect milk whose pH is 6.4 or lower (Kurwijila, 2006). Moreover, the lactometer test serves as a quick method to determine adulteration of milk by water (Pandey and Voskuil, 2011). The test is based on the fact that the density of whole milk ranges from 1.026 to 1.032 g/ml, therefore adding water to milk lowers its density, while addition of solids increases the density of milk (Kurwijila, 2006)."},{"index":5,"size":121,"text":"To confirm the identity of the desired microorganism in qualitative tests, various bacteriological, biochemical and/or serological tests need to be carried out with pure cultures obtained from these presumptive colonies (López-Campos et al., 2012). Culture methods depend on using suitable media to detect specific microorganisms, which often are a small proportion of the total microorganisms present in food. Selective media are used that enhance the growth of the target organism(s) and suppress the growth of the rest (Ge and Meng, 2009). The detection of pathogenic bacteria is a fundamental objective of food microbiology ensuring food quality, regarding this, PCR technology has successfully shortened analysis time and has been widely applied for the detection of food borne pathogens (AlAll et al., 2012)"}]},{"head":"Conclusion from the Literature Review","index":16,"paragraphs":[{"index":1,"size":110,"text":"Hygienic milk production, proper handling and storage of milk, and appropriate heat treatment can reduce or eliminate pathogens in milk (Kurwijila, 2006). Establishment of a well coordinated milk collection network could be a kick start towards successful milk processing and marketing (Njombe et al., 2011). One best way to prevent raw milkassociated food-borne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk (Oliver et al., 2009). Improved detection methods with better sensitivity and speed will be a valuable tool in defining the problems and outlining solutions to ensure the safety and quality of our food supplies (Ge and Meng, 2009)."}]},{"head":"CHAPTER THREE","index":17,"paragraphs":[]},{"head":"MATERIALS AND METHODS","index":18,"paragraphs":[]},{"head":"Study Area","index":19,"paragraphs":[{"index":1,"size":70,"text":"This study was carried out in Kilosa and Mvomero districts which are dominated by pastoral and agro-pastoral communities. Kilosa District is presently divided into nine divisions, 37 wards and 164 villages; its population was estimated to be 438 175 in the year 2012 (URT, 2012). It is situated between latitude 6° 00\" and 7 0 50\" South of equator and longitude 35° 00\" and 36 0 59\" East of Greenwich."},{"index":2,"size":112,"text":"Kilosa district is divided into three ecological zones which are the flat plain, the plateau and mountainous or upland zone (URT, 2012). In Kilosa district, this study was conducted within the flat plain ecological zone in five wards including Kimamba, Rudewa, Madoto, Dumila and Magomeni (Figure 1). The altitude of this area ranges from 300 m to 600 m above sea level, with an average rainfall between 700 mm and 1200 mm per annum. The average annual temperature of this zone is 18 0 C. The zone is densely populated due to its suitability for agriculture and livestock keeping. Most cattle are indigenous kept by agropastoralists and few farmers keep cross-bred cattle."},{"index":3,"size":78,"text":"Mvomero district is located between latitude 6º 13\" and 6 0 46\" South of equator and longitude 37º53\" and 37 0 64\" East of Greenwich. It has a population of 312 109 (URT, 2012). It is bordered to the north by Tanga region, to the northeast by Pwani region, to the east and southeast by Morogoro rural district and Morogoro Urban district and to the west by Kilosa district. The district varies greatly in its topography and climate."},{"index":4,"size":22,"text":"Mountains and highlands are located in the northwest, lowland rainforest in the north and central areas, and drier woodlands in the south."},{"index":5,"size":44,"text":"In Mvomero district, this study was conducted in five villages belonging to three wards, include Diongoya, Mtibwa and Dakawa (Fig. 1). This area receives bimodal rainfall with a long wet season from March to May and a short wet season from October to December."},{"index":6,"size":61,"text":"The rainfall ranges between 600 and 1200 mm per annum. The animals kept are also indigenous Tanzania shorthorn Zebu cattle and crossbred cattle. The study area was selected by MoreMilkIT project, and for the purpose of this study, villages were selected from the list of identified villages by the project based on availability of various actors along the milk value chain."}]},{"head":"Study Design and Selection of Villages","index":20,"paragraphs":[{"index":1,"size":9,"text":"An observational cross-sectional study design was adopted whereby questionnaire  "}]},{"head":"Sample Size Determination and Sampling","index":21,"paragraphs":[{"index":1,"size":23,"text":"The sample size was obtained as described by Fisher et al. (1991) using the following formula: N = z 2 pq/d 2 ."},{"index":2,"size":1,"text":"Where;"},{"index":3,"size":58,"text":"N= the desired sample size z = the standard normal deviate, usually set at 1.96 which corresponds to the 95 percent confidence level. p = proportion in the target population estimated to have a particular characteristics (which was approximated to be 0.5) q = 1.0-p d= degree of accuracy desired set at 0.1 N = (1.96) ²(0.5) (0.5)/0.1²"}]},{"head":"=96","index":22,"paragraphs":[{"index":1,"size":9,"text":"Using this formula, the required sample size was 96."}]},{"head":"Data Collection","index":23,"paragraphs":[]},{"head":"Questionnaire survey to identify factors influencing milk quality","index":24,"paragraphs":[{"index":1,"size":95,"text":"A standardized questionnaire with closed and open ended questions was administered by face to face interview to collect information on risk factors influencing milk quality from 52 farmers, 22 vendors and 16 operators of milk selling centres in Kilosa and Mvomero Districts (Table 1). The questionnaire captured participant's knowledge on hygienic practices during milk handling along the milk value chain, habit and practices such as washing of milk equipments, hand washing before and after milking, sources of water used for household activities and means of milk transport to the selling and collection centres (Appendix 1-3)."}]},{"head":"Sample collection, transport and storage","index":25,"paragraphs":[{"index":1,"size":141,"text":"Sample collection was done in early morning around 6-7 a.m. by using sterile containers into which approximately 50 ml of bulk milk taken from the storage container was sampled. In case there was more than one container of milk, sample was taken from each of the container. After sampling, the milk samples were stored in a cool box packed with ice packs and thereafter transported to field-based refrigerator and stored at 4 0 C for a maximum of four days before being transported to the laboratory for analysis. Storage refrigerators were used for temporary storage of milk sample collected in remote areas of Kilosa and Mvomero districts. The samples collected at Dumila and Dakawa were transported immediately to Sokoine University of Agriculture (SUA) laboratory at the Faculty of Veterinary Medicine, where the samples were stored at -80 o C before analysis."}]},{"head":"Laboratory Sample Processing","index":26,"paragraphs":[]},{"head":"Total viable count and Coliform count","index":27,"paragraphs":[{"index":1,"size":225,"text":"Milk samples were processed to quantify total viable count and coliform count. All procedures were carried out in biosafety cabinet to ensure sterility. Briefly, ten-fold serial dilutions of each sample from 10 -2 to 10 -5 for raw milk and 10 0 to 10 -3 for pasteurized were prepared in normal saline (BDH AnalaR ® , BDH Limited Poole England) which was prepared according to the manufacturer's instructions. The wide range of dilutions was selected due to expected wide variation in bacterial counts. By using disposable pipette, 1,350 µl of normal saline was pipetted into each tube. Then 150 µl of milk was pipetted into the first tube and serial dilution was carried out by transferring 150 µl of the diluents to each tube. From 10 -2 to 10 -5 dilution of raw milk and each dilution of pasteurized milk, a 1000 µl of milk sample was placed onto sterile petri dish followed by the addition of 15-20 ml of sterilized of MacConkey agar (HiMedia Laboratories PVT. LTD, Mumbai, India) for total coliform count and Nutrient agar (Oxoid LTD, Basingstoke, Hampshire, England) for total viable count, whereby media were prepared according to manufactures instruction. The sample and agar were then mixed and left to solidify after which the plates were incubated in inverted position at 37 0 C for 24 hours to allow bacterial growth."},{"index":2,"size":17,"text":"Enumeration of bacterial was done by taking consecutive plates with countable number of colonies and counted manually."}]},{"head":"Calculations of Mean Number of Colonies","index":28,"paragraphs":[{"index":1,"size":19,"text":"The mean numbers of colonies were calculated from two successive dilutions as described by ISO 7218:2007(E), using the formula:"},{"index":2,"size":1,"text":"("},{"index":3,"size":21,"text":"Where by ∑c = is the sum of the colonies counted on the two dishes retained from the two successive dilutions."},{"index":4,"size":9,"text":"V=volume of inoculums placed in each dish in millilitres."},{"index":5,"size":9,"text":"d=is the dilution corresponding to the first dilution retained"}]},{"head":"Microbial Contaminants of Milk","index":29,"paragraphs":[{"index":1,"size":56,"text":"The microbial contaminants of milk was defined by total viable count (TVC) and total coliform count (TCC), which are colony forming units (CFU) per ml of the milk sample based on bacteriological counts of raw and pasteurized milk samples' quality was graded as acceptable or unacceptable according to East Africa Standard specification (EAC, 2007) (Table 1). "}]},{"head":"Polymerase Chain Reaction","index":30,"paragraphs":[{"index":1,"size":36,"text":"Molecular analysis was carried to investigate the presence of E. coli 0157:H7 and Brucella abortus using uniplex PCR. Milk collected from the two districts were analysed for the presence of E. coli 0157:H7 and Brucella abortus."}]},{"head":"Extraction of DNA from milk samples","index":31,"paragraphs":[{"index":1,"size":148,"text":"DNA extraction from milk samples was carried out at the Genome Science Centre of the Faculty of Veterinary Medicine. Milk samples were boiled for 30 minutes to precipitate proteins. Protein precipitates were pelleted by centrifugation at 17 000 g for 5 minutes and the supernatant used for DNA extraction using the QiAmp kits (Qiagen, Maryland, USA) according to the manufacturer's instructions. DNA was also isolated from a known isolate of E. coli 0157:H7 and B. abortus isolates (kindly obtained from the Faculty of Veterinary Medicine). DNA extraction from E.coli 0157:H7 and B. abortus bacteria cultures was done by boiling the isolates at 80 0 C for 30 minutes in a thermal cycler (Applied Biosystems) followed by centrifugation at 17 000 g for 5 minutes. The pellet was discarded and the supernatant containing DNA was used for optimizing PCR and served as a positive control for all PCRs performed."}]},{"head":"Amplification","index":32,"paragraphs":[{"index":1,"size":14,"text":"Polymerase chain reaction was used for the amplification of the 16S-23S rDNA of B."},{"index":2,"size":47,"text":"abortus and the hlyA gene of E. coli 0157:H7 using BRU-P5/BRU-P8 and 0157-3/ 0157-4 primers respectively (Table 2). The reagents for PCR were prepared by pipetting appropriate volumes of 2x reaction buffer, RNase free water, primers, DNA polymerase and template in tubes as presented in Table 3. "}]},{"head":"Agarose gel electrophoresis","index":33,"paragraphs":[{"index":1,"size":107,"text":"Agarose gel was prepared by mixing 1.5g of agarose powder with 100 ml of 0.5x TBE buffer to obtain a 1.5% concentration of the agarose gel. Agarose was dissolved by heating the solution on a hot plate followed by cooling. A volume of 1µl of gel red (Biolithenix, USA) solution was added to every 100 ml of cooled molten agarose before casting and solidification. Separation and analysis of PCR products was carried out by adding 5 µl of amplicons to 1 µl of loading dye (Promega, USA). The products were run on 1.5% agarose stained with gel red for 30 minutes at a constant voltage of 50V."},{"index":2,"size":17,"text":"Imaging of separated PCR product was done using a gel doc machine (BioDock-It TM Imaging System, USA)."}]},{"head":"Data entry and Analysis","index":34,"paragraphs":[{"index":1,"size":67,"text":"Data collected through questionnaire and those obtained from laboratory analysis were coded and analyzed by SPSS version 20. Laboratory data, obtained from TVC and TCC were first transformed into natural log to normalize them before analysis for statistical difference of means using analysis of variance, whereby the analysis of variance was used to examine the differences in variable along the milk value chain in the two districts."},{"index":2,"size":38,"text":"Descriptive statistics were computed to get frequencies and proportions of different variables. Chi-square test was used to establish statistical differences between proportions of different variables of which were compared for statistical significance at a critical probability of P<0.05."}]},{"head":"CHAPTER FOUR","index":35,"paragraphs":[]},{"head":"RESULTS","index":36,"paragraphs":[]},{"head":"Milk sampling and administration of questionnaire","index":37,"paragraphs":[{"index":1,"size":50,"text":"A total of 109 samples were collected from Kilosa and Mvomero Districts whereby 49 samples were from Kilosa and 60 samples from Mvomero district. Milk samples were collected from farmers, vendors, selling centres and at the collection canters while questionnaire administration involved farmers, vendors and selling centres only (Table 4). "}]},{"head":"Respondent Characteristics","index":38,"paragraphs":[{"index":1,"size":14,"text":"The majority of respondents (62.2%) were from Mvomero district as shown in Table 5."},{"index":2,"size":51,"text":"Most of respondents (62.0%) were males. Farmers constituted the majority of actors along the milk value chain who participated in this study. Large percentage (44.4%) of cattle owned was crossbred. It was also observed that only 16.5% of the interviewed farmers had attended the training on basic hygiene practices (Table 5). "}]},{"head":"Farmers in Kilosa and Mvomero Districts","index":39,"paragraphs":[{"index":1,"size":33,"text":"The microbiological contaminants of milk produced were total bacteria and coliform bacteria count. The microbiological contaminants were examined across the two districts (Kilosa and Mvomero) as well as along the milk value chain."}]},{"head":"Bacteria contaminants across the districts","index":40,"paragraphs":[{"index":1,"size":70,"text":"The findings indicated that there was no significant difference in terms of coliform counts between Kilosa and Mvomero (Table 6). For total viable counts, Kilosa District had significantly (p=0.015) higher TVC than Mvomero district. Based on EAC milk standard (2007), 54% of the milk produced in Kilosa and Mvomero district had TCC above the recommended standards, where by Kilosa district had higher percentage (72.7%) of TCC than Mvomero district (39.3%)."},{"index":2,"size":32,"text":"In comparison with TVC, 50% of the milk produced in both districts had TVC above the recommended standard whereby each district had 50% of its milk with bacteria load beyond the recommendations. "}]},{"head":"Bacteria contaminants along the milk value chain","index":41,"paragraphs":[{"index":1,"size":87,"text":"When bacteria counts were examined along the milk value chain, it was found that there was significant difference in terms of number of bacteria at different nodes. The results indicated that for both total bacteria counts and coliform counts the difference along the chain was highly significant (p=0.000) (Table 7). The result indicated that the number of TVC and TCC was increasing progressively from the farmer's level to vendors' level and up to collection centres. However the number of both TVC and TCC declined at selling centres.   "}]},{"head":"Factors Influencing Contamination of Milk with Bacteria along the Milk Value","index":42,"paragraphs":[]},{"head":"Chain","index":43,"paragraphs":[{"index":1,"size":164,"text":"A number of factors which could influence milk contamination along the milk value chain were assessed. These included sources of water used to wash milking utensils, water used to wash the udder or teats and knowledge of farmers and vendors on hygienic practices during milk handling. The findings show that tap water had significant (p=0.02) influence on milk contamination with coliform bacteria. It was also observed that normal water used to wash the udder (not used for drinking) significantly (p=0.005) influence the number of coliform count in milk. On assessment of the participants attendance to training on milk hygiene the findings showed that those who did not attend had significantly (p=0.02) higher bacterial counts than those who did not attend training. When investigated on material used those who do not dry the teats after washing had influence on total bacteria count with large percentage (70%) been not in acceptable level at a significance of p=0.005. ). However, such difference was not statistically significant (p=0.092)."}]},{"head":"Prevalence of Brucella along the milk value chain","index":44,"paragraphs":[{"index":1,"size":170,"text":"The prevalence of Brucella along the milk value chain was high at collection centres (50.0%) and vendors (30.3%) shown in Figure 3, whereby Kilosa district had (25.8%) higher prevalence of Brucella than Mvomero district (11.8%). There was no statistical significance (p=0.06) of the prevalence of Brucella along the milk value chain.  The study found that there were poor hygienic practices of washing of udder before milking whereby Kilosa district had higher percentage of farmers with poor hygiene practice during milking than Mvomero district which result to contamination of milk during milking and handling. Due to the use of unclean water for cleaning milk equipments, unclean personnel hands and insufficient washing of udder might have contributed to the increased bacteria counts (Worku et al., 2012). Personal hygiene constitutes a significant preventive measure alongside the use of potable water (Kivaria et al., 2006). Teats are often not washed prior to milking because of the belief that allowing the calves to drink milk before manual milking cleans the teats (Addo et al., 2011)."},{"index":2,"size":78,"text":"The study showed that large percentage of farmers milks their cows in the kraal. This is similar with study conducted by Mosalagae et al. (2011), most of the farmers' milk cows in open kraals, which constitutes one of the direct methods of milk contamination. A typical kraal consists of an enclosure of varying size surrounded by wooden or bamboo sticks with a bare ground covered with thick layer of fresh and dried cow dung (Addo et al., 2011)."},{"index":3,"size":101,"text":"The study showed that there was low level of knowledge on hygienic practices along the milk value. The low level of knowledge observed in this study is influenced by inadequacy of information due to remoteness of study areas, poor extension and lack of health programmes to educate disadvantaged communities such as the pastoralists (Karimuribo et al., 2005;Mosalagae et al., 2011). However, people with less than a high school education are more likely to consume raw milk than those who had completed high school, suggesting that level of education may influence a person's choice to consume raw milk (Olive et al., 2005)."},{"index":4,"size":104,"text":"The present study showed that the quality of milk in study areas was poor based on high values of TVC and TCC observed in milk samples. A study by Karimuribo et al. (2005) showed that most farmers (94.5%) reported to ferment milk from raw unboiled milk. This habit can predispose consumers to the health risk of contracting milk-borne zoonoses as most of them use raw fermented milk (Mosalagae et al., 2011). The improper milking hygiene practices by farmers may be due to poor or lack of knowledge on proper hygiene practices which may result to lowering the quality of milk (Karimuribo et al., 2005)."},{"index":5,"size":134,"text":"The results indicated that the number of bacteria counts and coliform counts was increasing progressively from the farmer's level to vendors' level and up to collection centres. The presence of food-borne pathogens in bulk tank milk is directly linked to fecal contamination that occurs primarily during the harvesting of raw milk, however, some food-borne pathogens can cause mastitis in which case the organism can be directly excreted into milk (Oliver et al., 2005). Hence, this contributes to high bacteria counts in milk which is reported to increase milk contamination with Staphylococcus species which may result to udder infection (Mdegela et al., 2004). Introduction of raw milk contaminated with food-borne pathogens into processing plants represents an important risk of post-pasteurization contamination that could lead to exposure of consumer to pathogenic bacteria (Oliver et al., 2005)."},{"index":6,"size":98,"text":"This study has revealed that there were significantly increase of contamination along the milk value chain. Contamination occurs during milk handling due to lack of cooling facilities and absence of any test to screen for abnormal milk (Worku et al., 2012). When milk is produced under poor hygienic conditions and is not cooled, the main contaminants such as Lactobacilli organisms are produced which cause rapid souring (Mosalagae et al., (2011). A study by Lore et al. (2005) showed that poor handling of milk at the farm and long distances to market result in significant losses due to spoilage."},{"index":7,"size":97,"text":"In this study milk contamination with Brucella was recorded in Kilosa and Mvomero Districts, whereby the prevalence was higher in Kilosa than in Mvomero District. This is similar to study conducted by Swai and Schoonman (2010) that the prevalence of brucellosis is higher in indigenous cattle than in crossbred kept by smallholder dairy farmers. The differences between traditional and crossbred animals are possibly attributed to increased contacts of infected herds/animals and non-infected ones in the indigenous traditional production system, as a result of communal grazing and watering, which become more apparent and acute during the dry period."},{"index":8,"size":62,"text":"The findings of this study on milk contamination with Brucella are comparable to the study conducted by Mdegela et al. (2004) which showed that there was Brucella contamination of milk by 1% in Kibaha and 1.9% in Morogoro. Milk sample collected from vendors in both districts had higher bacterial count compared to those samples from the farmers and at the selling points."},{"index":9,"size":40,"text":"exposure to B. abortus varies by bulking if milk is consumed raw. A study by John et al. (2010) showed that brucellosis occurs widely in livestock keeping populations in Tanzania where by 7.7% prevalence has been reported in northern Tanzania."},{"index":10,"size":57,"text":"The results of the present study indicate that milk in Kilosa and Mvomero were not contaminated with E.coli 0157:H7. This was similar to study conducted by Swai and Schoonman (2011). The absence of E.coli 0157:H7 can be explained by the fact that the bacterium is not shed in milk but arises from contamination arising from sick handlers."},{"index":11,"size":26,"text":"Though in this study E.coli 0157: H7 was not detected in milk tested, the practise of drinking raw milk could expose the communities to milk-borne zoonoses."}]},{"head":"CHAPTER SIX","index":45,"paragraphs":[]},{"head":"CONCLUSIONS AND RECOMMENDATIONS","index":46,"paragraphs":[{"index":1,"size":42,"text":"It can be concluded that raw marketed milk in the study area is of poor bacteriological quality and hazardous for human consumption. This highlights the need to implement good hygiene practices and effective monitoring from production through the delivery chain to consumer."},{"index":2,"size":59,"text":"Cattle owners should be aware of milk-borne zoonoses that are prevalent in their areas and the risks they pose and how they are transmitted for them to make informed decisions on their control. Creation of awareness about brucellosis to farmers, milk vendors and milk consumers is also useful in order to reduce the health hazards associated with milk consumption."},{"index":3,"size":57,"text":"It is recommended that concerted efforts should be made to safeguard health of consumers through adopting various interventions that will reduce risks at each node along the milk value chain in the study area. Further studies are needed for detection and quantification of health risks associated with Brucella infections in production animals as well as in humans."}]},{"head":"Cattle keeping","index":47,"paragraphs":[{"index":1,"size":4,"text":"Type of cattle owned:"},{"index":2,"size":2,"text":"(I)indigenous/ (C)crossbred/Other"},{"index":3,"size":4,"text":"Housing system for cattle:"},{"index":4,"size":4,"text":"Feeding system for cattle"}]},{"head":"Housing system","index":48,"paragraphs":[{"index":1,"size":4,"text":"Feeding system for cattle "}]}],"figures":[{"text":"1. 0 Figure 1: A map of Kilosa and Mvomero districts showing the study area .................... "},{"text":"Figure 2 : Figure 2: Mean number of bacteria count along the milk value chain ........................... "},{"text":"Figure 3 : Figure 3: Trends of milk contaminated with Brucella along the milk value chain ........ "},{"text":"Figure 4 : Figure 4: Agarose gel showing the detection of B.abortus 16S-23S rDNA by "},{"text":" administration and sampling was done once. Study villages in Kilosa and Mvomero districts were purposively selected from the list of MoreMilkIT project, based on the availability of farmers, vendors, milk selling centres and collection centres. The selected villages included Madizini, Manyinga, Wami Sokoine, Wami Dakawa and Wami Luhindo in Mvomero district, and Mbwade, Twatwatwa, Dumila, Kimamba A and B and Manzese/Uhindini in Kilosa district. Since the study was conducted at time when milk was insufficient, all households that had lactating cows during field visit were included in the study. Samples were collected from all lactating cows in a households, at the collection centres milk were collected from the cooling tanks while for Vendors samples were collected from vendors milk container at the selling centre and at the collection centres. In the selling centre sample collected was the boiled and raw milk from the owner of the selling unit. "},{"text":"Figure 1 : Figure 1: A map of Kilosa and Mvomero districts showing the study area. "},{"text":"Figure 2 Figure 2 shows trends of TVC and TCC along the milk value chain. The figure shows that "},{"text":"Figure 2 : Figure 2: Mean number of bacteria count along the milk value chain. "},{"text":"Figure 3 : Figure 3: Trends of milk contaminated with Brucella along the milk value chain. "},{"text":"Figure 4 : Figure 4: Agarose gel showing the detection of B.abortus 16S-23S rDNA by PCR "},{"text":"Table 1 : Microbiological limits  Type of milk Bacteriological grade Milk grade Cfu/ml Type of milkBacteriological grade Milk gradeCfu/ml Raw milk Total plate count I or A <200 000 Raw milkTotal plate countI or A<200 000   II or B >200 000-1 000 000 II or B>200 000-1 000 000   III or C >1 000 000-2 000 000 III or C>1 000 000-2 000 000  Coliform plate count Very good 0-1 000 Coliform plate count Very good0-1 000   Good 1 000-50 000 Good1 000-50 000 Pasteurized milk Total plate count Maximum level 30 000 Pasteurized milkTotal plate countMaximum level30 000  Coliform plate count Maximum level 10 Coliform plate count Maximum level10  "},{"text":"Table 2 : Primer sequences for the detection of Brucella abortus and E. coli 0157:H7  Organisms Primer sequence 5'-3' Target Expected Organisms Primer sequence 5'-3'TargetExpected   gene fragment genefragment    size size B. arbortus F: BRU-P5 TCGAGAATTGGAAAGAGGTC 16S-23S B. arbortus F: BRU-P5 TCGAGAATTGGAAAGAGGTC16S-23S    726 bp 726 bp  R: BRU-P8 GCATAATGCGGCTTTAAGA 16S-23S R: BRU-P8 GCATAATGCGGCTTTAAGA16S-23S E. coli F: 0157-3GTAGGGAAGCGAACAGAG hlyA E. coliF: 0157-3GTAGGGAAGCGAACAGAGhlyA 0157:H7   361 bp 0157:H7361 bp  R: 0157-4 AAGCTCCGTGTGCCTGAA hlyA R: 0157-4 AAGCTCCGTGTGCCTGAAhlyA Note: F-forward primer and R-reverse primer  Note: F-forward primer and R-reverse primer  "},{"text":"Table 3 : Composition of a single PCR reaction for B. abortus and E. coli 0157:H7 PCRfor the detection of B. abortus was performed as previously described byRijpens et al (1996). The cycling conditions included an initial incubation at 95 o C for 1 minute to denature the template and activate the DNA taq polymerase. Then 30 cycles each consisting of denaturation for 15 seconds at 95 o C, annealing at 55 o C for 30 seconds and extension for 1 minutes at 72 o C. The last stage included a final extension step for 10 minutes at 72 o C. The amplification conditions for E. coli 0157:H7 were performed as previously described byWang et al. (1997). Briefly, the amplification started by one cycle at 95 o C for 10 minutes followed by 35 cycles at 95 o C for 30 seconds, 50 o C for 30 seconds, 72 o C for 30 seconds and a final extension at 72 Reagent Reagent  "},{"text":"Table 4 : Sources of data collection for questionnaire survey (n=90) and milk samples (n=109) in Kilosa and Mvomero district  Source  Kilosa Mvomero Total SourceKilosaMvomeroTotal   Milk samples Milk samples Milk samples Milk samplesMilk samplesMilk samples   (Questionnaires) (Questionnaires) (Questionnaires) (Questionnaires)(Questionnaires)(Questionnaires) Farmers  10 (10) 44 (42) 54 (52) Farmers10 (10)44 (42)54 (52) Milk vendors 27 (18) 4 (4) 31 (22) Milk vendors27 (18)4 (4)31 (22) Milk selling centers 8 (6) 10 (10) 18 (16) Milk selling centers8 (6)10 (10)18 (16) Milk collection 4 (-) 2 (-) 6 (-) Milkcollection4 (-)2 (-)6 (-) centers     centers Total  49 (34) 60 (56) 109 (90) Total49 (34)60 (56)109 (90)  "},{"text":"Table 5 : Characteristics of interviewed participants (n=90)  Variable Category Number Percentage VariableCategoryNumberPercentage District Mvomero 56 62.2 DistrictMvomero5662.2  Kilosa 34 37.8 Kilosa3437.8 Type of actor Farmers 52 58.0 Type of actorFarmers5258.0  Vendors 22 24.0 Vendors2224.0  Selling centres 16 18.0 Selling centres1618.0 Sex Male 56 62.0 SexMale5662.0  Female 44 48.0 Female4448.0 Type of cattle owned Indigenous 21 38.9 Type of cattle ownedIndigenous2138.9  Crossbreed 24 44.4 Crossbreed2444.4  Both breed 9 16.7 Both breed916.7 Attended training on milk hygienic Yes 14 16.5 Attended training on milk hygienicYes1416.5 practices    practices  No 71 83.5 No7183.5 4.3.    4.3.  "},{"text":"Microbiological Contaminants of Milk Produced by Pastoral and Smallholder   "},{"text":"Table 6 : Bacterial contaminants of milk identified   District Number Mean ± std. deviation P value DistrictNumberMean ± std. deviationP value Natural log TVC Mvomero 29 9.73±3.277 Natural log TVCMvomero299.73±3.277  Kilosa 22 12.03±3.183 0.015 Kilosa2212.03±3.1830.015 Natural log TCC Mvomero 25 7.20±4.090 Natural log TCCMvomero257.20±4.090  Kilosa 20 8.66±4.995 0.289 Kilosa208.66±4.9950.289  "},{"text":"Table 7 : Microbiological contamination along the milk value chain   Level Number Mean ± std.deviation P value LevelNumberMean ± std.deviationP value Natural log TVC Farmer 22 9.72±3.078 Natural log TVCFarmer229.72±3.078  Vendor 15 12.18±2.821 Vendor1512.18±2.821  Collection centre 6 14.56±1.593 Collection centre614.56±1.593  Selling centre 8 7.88±2.670 0.000 Selling centre87.88±2.6700.000 Natural log TCC Farmer 23 8.98±2.956 Natural log TCCFarmer238.98±2.956  Vendor 7 12.23±2.392 Vendor712.23±2.392  Collection centre 2 14.68±4.327 Collection centre214.68±4.327  Selling centre 13 2.44±1.149 0.000 Selling centre132.44±1.1490.000  "},{"text":"Table 8 : Factors influencing large number of total bacterial count in Milk   Variable Level Mean ± P value VariableLevelMean ±P value    std. deviation  std. deviation Natural log TCC Source of Tap water 9.11±4.07 0.02 Natural log TCCSource ofTap water9.11±4.070.02  water    water   dams 9.07±1.15  dams9.07±1.15   Underground shallow 6.40±3.35  Underground shallow6.40±3.35   wells   wells  Water used Warm water 6.76 ±1.395  Water usedWarm water6.76 ±1.395  to wash    to wash  teats/udder    teats/udder   Water used for 8.91 ± 3.143  Water used for8.91 ± 3.143   drinking   drinking   Water not suitable for 9.91±2.843 0.005 Water not suitable for9.91±2.8430.005   drinking   drinking Natural log TVC Attended Yes 13.28±1.07  Natural log TVCAttendedYes13.28±1.07  training    training   No 10.22±3.22 0.02 No10.22±3.220.02 Other factors which influenced milk contamination were place for milking and material Other factors which influenced milk contamination were place for milking and material used to dry teats/udder after washing. Milking at kraal significantly (p=0.052) influenced used to dry teats/udder after washing. Milking at kraal significantly (p=0.052) influenced total coliform count with large percentage (83.3 %) of milk graded not as acceptable. total coliform count with large percentage (83.3 %) of milk graded not as acceptable.  "},{"text":"Table 9 : Factors influencing milk contamination with coliform bacteria  Variable Level Acceptability Percentage P value VariableLevelAcceptabilityPercentageP value   of milk No. (%)  of milkNo. (%)   microbial level   microbial level Place for milking (TCC) Kraal Yes 1 (16.7) 0.052 Place for milking (TCC) KraalYes1 (16.7)0.052   No 5 (83.3)  No5 (83.3)  Cattleshed/banda Yes 7 (77.8)  Cattleshed/banda Yes7 (77.8)   No 2 (22.2)  No2 (22.2)  Outside Yes 3 (37.5)  OutsideYes3 (37.5)  kraal/banda    kraal/banda   No 5 (62.5)  No5 (62.5) Material used to dry Clean dry cloth Yes 0 (0.0)  Material used to dryClean dry clothYes0 (0.0) udder (TVC)     udder (TVC)   No 2 (100)  No2 (100)  Do not dry Yes 6 (30.0)  Do not dryYes6 (30.0)   No 14 (70.0) 0.050 No14 (70.0)0.050 4.5 B     4.5 B  "},{"text":". abortus and E. coli 0157:H7 Present in Milk It   "}],"sieverID":"e9316e66-962f-4e26-a784-6cc5d26b8827","abstract":"The consumption of raw milk is a common practice among pastoral and agro-pastoral communities of Tanzania. This behaviour predisposes consumers to the risk of contracting milk-borne and zoonotic diseases. This study was carried out to assess milk quality based on identification of bacterial contaminants indicated by total viable count (TVC), total coliform count (TCC) and contamination with Brucella and E .coli 0157: H7 microorganisms. The study was carried out along the milk value chain (MVC) in Kilosa and Mvomero Districts of Morogoro Region in Tanzania. A total of 109 milk samples were collected along the MVC from farmers (54), milk vendors (31), milk collection centres (6) and milk selling points (18). Collected milk samples were subjected to TVC, TCC and polymerase chain reaction (PCR) to identify the presence of microorganisms in the milk. Laboratory findings indicate that milk from Kilosa district had significantly (p=0.015) higher TVC than milk from Mvomero district. The TVC varied significantly (p=0.00) along the MVC in the two districts. Using PCR, the overall prevalence of Brucella was 17.1% (n=82 out of 109), with the prevalence of 25.8% and 11.8% recorded in Kilosa and Mvomero districts, respectively. The E. coli 0157:H7 was neither isolated nor detected in all 109 milk samples processed. Such findings suggest that milk marketed along the MVC is contaminated with Brucella organisms, thus posing public health risks to consumers. It is recommended that concerted efforts should be made to safeguard health of consumers through adopting various interventions that would reduce risks at each node along the MVC in the study area. iii DECLARATION I, Ernesta Joseph, do hereby declare to the Senate of Sokoine University of Agriculture that this dissertation is my own original work done within the period of registration and that it has neither been submitted nor being concurrently submitted in any other institution."}

data/part_2/01c1fcbeed46d4c729a7ca21c3cbd91e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01c1fcbeed46d4c729a7ca21c3cbd91e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/04d9c509-ecad-4dd5-b153-b8b2ea304400/retrieve"},"pageCount":2,"title":"EVALUATION OF MANAGEMENT OF THE INVASIVE RED PALM WEEVIL RHYNCHOPHORUS FERRUGINEUS (COLEOPTERA, CURCULIONIDAE) IN IRAQ: A SEVEN-YEAR STUDY (2015-2022). Samir","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":309,"text":"Seeds of cereals (wheat, barley) and legumes (faba bean, lentil, chickpea, grasspea) are important exchange materials for farming, crop production, and research at national, regional, and international levels, but with the exchanges comes the danger of introducing new pests (fungi, bacteria, viruses, nematodes, and insects). ICARDA's Germplasm Health Unit (GHU) is responsible for the monitoring, clearance, and documentation of safe germplasm movement at the Center. All incoming and outgoing genetic resources and breeding germplasm must pass through a strict quarantine monitoring system, including seed health testing. To confirm the health status of seed samples, the GHU conducts different types of tests based on the crops and the nature of the target pest. These tests can be classified into the following four distinct detection groups: direct inspection, incubation tests, immunoassays, and molecular tests. Ideally, seed health tests should be sensitive, specific, rapid, robust, low-cost, and simple to implement and interpret. Thus, ICARDA's GHU applies different detection assays as part of the monitoring and management system, i.e. (i) visual inspection and floating test for stored insects, (ii) centrifuge washing, agar plate and freezing blotter tests for fungi, (iii) TBIA and ELISA for viruses, (iv) nematode extraction test for nematodes, and (v) agglutination test for bacteria. These tests permit rapid analysis of a large number of samples at a relatively low cost. ICARDA's GHU also developed and applied molecular tools such as high throughput, short lead times, and accurate assays. To fulfill legal and regulatory requirements for certified seed classes and allow for seed movement across international boundaries, ICARDA's GHU processes annually over 50k samples tested for around 650k diagnostic reactions, for the purpose of short-and long-term conservation, distribution to a minimum of 90 countries and elimination of approximately 10-15% of pest-contaminated samples that could not be curated using phytosanitary treatments. The rejected samples were contaminated generally with fungi, nematodes, and viruses."}]}],"figures":[{"text":"‬ ‫الجافة‬ ‫المناطق‬ ‫في‬ ‫اعية‬ ‫الزر‬ ‫للبحوث‬ ‫الدولي‬ ‫لمركز‬ ‫ب‬ ‫المنقولة‬ ‫اض‬ ‫األمر‬ ‫و‬ ‫اآلفات‬ ‫عن‬ ‫للكشف‬ ‫اسطة‬ ‫و‬ ‫الحبوب‬ ‫بذور‬  ‫لبنان‬ ‫زحلة،‬ ‫بل،‬ ‫تر‬ ‫محطة‬ ‫(ايكاردا)،‬ ‫الجافة‬ ‫المناطق‬ ‫في‬ ‫اعية‬ ‫الزر‬ ، ‫باط،‬ ‫الر‬ ‫ايكاردا،‬ ‫المغرب‬ ، ‫اسل:‬ ‫المر‬ ‫للباحث‬ ‫اإللكتروني‬ ‫يد‬ ‫البر‬ ( 2 ) ‫مصابة‬ ‫تكون‬ ‫المستثناة‬ ‫العينات‬ ‫النباتية‬ ‫الصحة‬ ‫معامالت‬ . ‫ب‬ ‫اض‬ ‫األمر‬ ‫الفطر‬ ‫و‬ ‫الفيروسية‬ ‫و‬ ‫ية‬ ‫عام‬ ‫بشكل‬ ‫النيماتودا‬ ، ‫فإن‬ . ‫لبنان‬ ‫زحلة،‬ ‫بل،‬ ‫تر‬ ‫محطة‬ ‫(ايكاردا)،‬ ‫الجافة‬ ‫المناطق‬ ‫في‬ ‫اعية‬ ‫الزر‬ ، ‫باط،‬ ‫الر‬ ‫ايكاردا،‬ ‫المغرب‬ ، ‫اسل:‬ ‫المر‬ ‫للباحث‬ ‫اإللكتروني‬ ‫يد‬ ‫البر‬ ( 2 )‫مصابة‬‫تكون‬‫المستثناة‬ ‫العينات‬‫النباتية‬ ‫الصحة‬ ‫معامالت‬ . ‫ب‬ ‫اض‬ ‫األمر‬ ‫الفطر‬ ‫و‬ ‫الفيروسية‬ ‫و‬ ‫ية‬ ‫عام‬ ‫بشكل‬ ‫النيماتودا‬ ، ‫فإن‬ . [email protected] ‫تع‬ ‫د‬ ‫(الفول‬ ‫البقوليات‬ ‫و‬ ‫الشعير)‬ ‫و‬ ‫(القمح‬ ‫الحبوب‬ ‫بذور‬ ، ‫أهم‬ ‫من‬ ‫الجلبان)‬ ‫و‬ ‫الحمص‬ ‫في‬ ‫اد‬ ‫المو‬ ‫التبادل‬ ‫عمليات‬ ‫اعة‬ ‫للزر‬ ‫العدس،‬ ‫إنتاج‬ ‫و‬ ‫الدولية،‬ ‫و‬ ‫اإلقليمية‬ ‫الوطنية،‬ ‫المستويات‬ ‫على‬ ‫للبحوث‬ ‫باإلضافة‬ ‫المحاصيل‬ ‫ولكن‬ ‫أن‬ ‫بد‬ ‫ال‬ ‫اكب‬ ‫يو‬ ‫التبادل‬ ‫عمليات‬ ‫(فطور،‬ ‫جديدة‬ ‫آفات‬ ‫إدخال‬ ‫خطر‬ ‫ات).‬ ‫وحشر‬ ‫��يماتودا‬ ‫فيروسات،‬ ‫يا،‬ ‫بكتير‬ ‫إن‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ (GHU) ‫الجافة‬ ‫المناطق‬ ‫في‬ ‫اعية‬ ‫الزر‬ ‫للبحوث‬ ‫الدولي‬ ‫للمركز‬ ‫التابعة‬ ‫(ا‬ ‫يكاردا‬ ) ‫لحركة‬ ‫التوثيق‬ ‫و‬ ‫التخليص‬ ‫اقبة،‬ ‫المر‬ ‫عمليات‬ ‫عن‬ ‫مسؤولة‬ ‫تخ‬ ‫حيث‬ ‫المركز،‬ ‫في‬ ‫اآلمنة‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫بية‬ ‫التر‬ ‫اد‬ ‫ومو‬ ٍ ‫لنظام‬ ‫ة‬ ‫الصادر‬ ‫و‬ ‫اردة‬ ‫الو‬ ‫اختبار‬ ‫ذلك‬ ‫في‬ ‫ات‬ ‫تطبق‬ ‫البذور.‬ ‫صحة‬ (GHU) ‫على‬ ً ‫بناء‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫مختلفة‬ ً ‫اعا‬ ‫أنو‬ ‫نوع‬ ‫المحص‬ ‫ول‬ ً ‫عموما‬ ‫المستهدفة.‬ ‫اآلفة‬ ‫وطبيعة‬ ، ‫تصن‬ ‫يمكن‬ ‫الف‬ ‫ئات‬ ‫التالية‬ ‫بع‬ ‫األر‬ ‫حس‬ ‫البذور‬ ‫صحة‬ ‫ات‬ ‫اختبار‬ ‫متخص‬ ‫اسة،‬ ‫يعة،‬ ‫سر‬ ‫صة،‬ ‫قوية‬ ‫و‬ ‫التفسير.‬ ‫و‬ ‫التنفيذ‬ ‫وسهلة‬ ‫التكلفة‬ ً ‫بناء‬ ‫عليه‬ ‫تطب‬ ، ‫ق‬ ( ‫اثية‬ ‫الور‬ (GHU ‫عدد‬ ‫إليكاردا‬ ‫التابعة‬ ً ‫ا‬ ‫ب‬ ‫المنقولة‬ ‫اآلفات‬ ‫و‬ ‫اض‬ ‫األمر‬ ‫اسطة‬ ‫و‬ ٍ ‫كجزء‬ ‫البذور‬ ‫ة‬ ‫اإلدار‬ ‫و‬ ‫اقبة‬ ‫المر‬ ‫نظام‬ ‫من‬ ‫وهي‬ ، ‫ال‬ ‫المثال‬ ‫سبيل‬ ‫على‬ ( ‫الحصر:‬ 1 ( ‫المخازن،‬ ‫ات‬ ‫حشر‬ ‫عن‬ ‫للكشف‬ 2 ‫اخت‬ ) ‫بار‬ ‫ات‬ ‫النشاف‬ ‫اق‬ ‫أور‬ ‫و‬ ‫و‬ ( ‫الفطور،‬ ‫عن‬ ‫للكشف‬ ‫اآلجار‬ ‫أطباق‬ 3 ) ‫المصلية‬ ، ‫مثل‬ ‫إ‬ ‫ا‬ ‫ليز‬ ( ELISA ) ‫النباتي‬ ‫النسيج‬ ‫وبصمة‬ ( TBIA ‫ال‬ ‫عن‬ ( ‫فيروسات،‬ 4 ‫و‬ ( 5 ‫عن‬ ‫للكشف‬ ‫المناعي‬ ‫اص‬ ‫التر‬ ‫اختبار‬ ) ‫البكت‬ ‫ي‬ ‫ات‬ ‫االختبار‬ ‫إ‬ ٍ ‫عدد‬ ‫فحص‬ ‫مكانية‬ ً ‫إضافة‬ ‫السابقة‬ ‫ات‬ ‫لالختبار‬ ، ‫فقد‬ ‫طو‬ ( (GHU ‫اسطة‬ ‫بو‬ ‫ذات‬ ‫كتقنيات‬ ‫البذور‬ ‫كفاءة‬ ‫عالية‬ ‫ب‬ ‫نتائج‬ ‫وحدة‬ ‫ـ‬ ‫ـ‬ ‫ال‬ GHU ‫من‬ ‫أكثر‬ ً ‫سنويا‬ 50 ‫السماح‬ ‫و‬ ‫المعتمدة‬ ‫للبذور‬ ‫التنظيمية‬ ‫و‬ ‫القانونية‬ ‫بتبادل‬ ‫ية‬ ‫البذر‬ ‫العينات‬ ‫هذه‬ ‫تخضع‬ ‫الدولية،‬ ‫ل‬ ‫الي‬ ‫حو‬ 650 ‫ألف‬ ‫اختبار‬ ‫حفظ‬ ‫بغرض‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫الق‬ ‫المدى‬ ‫على‬ ‫يع‬ ‫التوز‬ ‫إلى‬ ‫على‬ 90 ‫األقل‬ ‫على‬ ‫دولة‬ ، ‫و‬ ‫البذور‬ ‫يق‬ ‫طر‬ ‫عن‬ ‫المنقولة‬ ‫اض‬ ‫األمر‬ ‫الي‬ ‫(حو‬ 10 -15 ‫المفحوصة)‬ ‫العينات‬ ‫مكافحتها‬ ‫يمكن‬ ‫ال‬ ‫التي‬ ‫و‬ ‫أ‬ ‫و‬ ‫باستخدام‬ ‫عليها‬ ‫ة‬ ‫السيطر‬ ‫مجمل‬ ‫من‬ % ‫باآلفات‬ ‫المصابة‬ ‫العينات‬ ‫إقصاء‬ ‫و‬ ‫باإلضافة‬ ‫الطويل،‬ ‫و‬ ‫صير‬ ‫تشخيصي‬ ‫الحدود‬ ‫عبر‬ ‫البذور‬ ‫بالمتطلبات‬ ‫للوفاء‬ ‫ية‬ ‫بذر‬ ‫عينة‬ ‫ألف‬ ‫تختبر‬ ‫يعة.‬ ‫وسر‬ ‫دقيقة‬ ‫المنقولة‬ ‫الممرضات‬ ‫عن‬ ‫للكشف‬ ‫يئية‬ ‫الجز‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫العديد‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫رت‬ . ً ‫نسبيا‬ ‫منخفضة‬ ‫بتكلفة‬ ‫العينات‬ ‫من‬ ‫كبير‬ ‫هذه‬ ‫توفر‬ ‫يا.‬ ‫ر‬ ‫النيماتودا،‬ ‫عن‬ ‫للكشف‬ ‫النيماتودا‬ ‫استخالص‬ ‫اختبار‬ ) ‫للكشف‬ ) ‫ات‬ ‫االختبار‬ ‫المركزي‬ ‫بالطرد‬ ‫الغسيل‬ ‫الطفو‬ ‫اختبار‬ ‫و‬ ‫المباشر‬ ‫الفحص‬ ) ، ‫عن‬ ‫للكشف‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫منخفضة‬ ، ‫تكون‬ ‫أن‬ ‫يجب‬ ‫العملية،‬ ‫الناحية‬ ‫من‬ ‫يئية.‬ ‫الجز‬ ‫ات‬ ‫االختبار‬ ‫و‬ ‫المناعية‬ ‫ات‬ ‫االختبار‬ ‫التحضين،‬ ‫ات‬ ‫اختبار‬ ‫المباشر،‬ ‫الفحص‬ : ‫إلى‬ ‫ات‬ ‫االختبار‬ ‫هذه‬ ‫يف‬ ‫المختبر‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫بما‬ ‫الصحي،‬ ‫الحجر‬ ‫اقبة‬ ‫لمر‬ ‫صارم‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫جميع‬ ‫ضع‬ A-6 ‫ائق‬ ‫طر‬ ‫ل‬ ‫التابعة‬ ‫المطبقة‬ ‫التشخيص‬ ‫(ايكاردا)‫البقوليات‬ ‫و‬ ‫لدى‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ (GHU) . ‫صفاء‬ ‫غسان‬ ‫قمري‬ 1 ، ‫مكحل‬ ‫الرحمن‬ ‫عبد‬ 1 ، ‫ياني‬ ‫المز‬ ‫إنعام‬ 2 ‫درويش‬ ‫إيمان‬ ‫و‬ 1 . ( 1 ‫مختب‬ ) ‫للبحوث‬ ‫الدولي‬ ‫المركز‬ ‫البذور،‬ ‫صحة‬ ‫ر‬ A-6 DIAGNOSTIC TOOLS APPLIED BY ICARDA'S GERMPLASM HEALTH UNIT (GHU) FOR DETECTION OF PESTS AND DISEASES TRANSMITTED VIA LEGUME AND CEREAL SEEDS. Safaa G. Kumari 1 , Abdulrahman Moukahel 1 , Inaam El-Miziani 2 and Iman Darwish 1 . (1) Seed Health Laboratory, International Center for Agricultural Research in the Dry Areas (ICARDA), Terbol Station, Zahle, Lebanon; (2) ICARDA, Rabat, Morocco, Email of corresponding author: [email protected] [email protected] ‫تع‬ ‫د‬ ‫(الفول‬ ‫البقوليات‬ ‫و‬ ‫الشعير)‬ ‫و‬ ‫(القمح‬ ‫الحبوب‬ ‫بذور‬ ، ‫أهم‬ ‫من‬ ‫الجلبان)‬ ‫و‬ ‫الحمص‬ ‫في‬ ‫اد‬ ‫المو‬ ‫التبادل‬ ‫عمليات‬ ‫اعة‬ ‫للزر‬ ‫العدس،‬ ‫إنتاج‬ ‫و‬ ‫الدولية،‬ ‫و‬ ‫اإلقليمية‬ ‫الوطنية،‬ ‫المستويات‬ ‫على‬ ‫للبحوث‬ ‫باإلضافة‬ ‫المحاصيل‬ ‫ولكن‬ ‫أن‬ ‫بد‬ ‫ال‬ ‫اكب‬ ‫يو‬ ‫التبادل‬ ‫عمليات‬ ‫(فطور،‬ ‫جديدة‬ ‫آفات‬ ‫إدخال‬ ‫خطر‬ ‫ات).‬ ‫وحشر‬ ‫نيماتودا‬ ‫فيروسات،‬ ‫يا،‬ ‫بكتير‬ ‫إن‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ (GHU) ‫الجافة‬ ‫المناطق‬ ‫في‬ ‫اعية‬ ‫الزر‬ ‫للبحوث‬ ‫الدولي‬ ‫للمركز‬ ‫التابعة‬ ‫(ا‬ ‫يكاردا‬ ) ‫لحركة‬ ‫التوثيق‬ ‫و‬ ‫التخليص‬ ‫اقبة،‬ ‫المر‬ ‫عمليات‬ ‫عن‬ ‫مسؤولة‬ ‫تخ‬ ‫حيث‬ ‫المركز،‬ ‫في‬ ‫اآلمنة‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫بية‬ ‫التر‬ ‫اد‬ ‫ومو‬ ٍ ‫لنظام‬ ‫ة‬ ‫الصادر‬ ‫و‬ ‫اردة‬ ‫الو‬ ‫اختبار‬ ‫ذلك‬ ‫في‬ ‫ات‬ ‫تطبق‬ ‫البذور.‬ ‫صحة‬ (GHU) ‫على‬ ً ‫بناء‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫مختلفة‬ ً ‫اعا‬ ‫أنو‬ ‫نوع‬ ‫المحص‬ ‫ول‬ ً ‫عموما‬ ‫المستهدفة.‬ ‫اآلفة‬ ‫وطبيعة‬ ، ‫تصن‬ ‫يمكن‬ ‫الف‬ ‫ئات‬ ‫التالية‬ ‫بع‬ ‫األر‬ ‫حس‬ ‫البذور‬ ‫صحة‬ ‫ات‬ ‫اختبار‬ ‫متخص‬ ‫اسة،‬ ‫يعة،‬ ‫سر‬ ‫صة،‬ ‫قوية‬ ‫و‬ ‫التفسير.‬ ‫و‬ ‫التنفيذ‬ ‫وسهلة‬ ‫التكلفة‬ ً ‫بناء‬ ‫عليه‬ ‫تطب‬ ، ‫ق‬ ( ‫اثية‬ ‫الور‬ (GHU ‫عدد‬ ‫إليكاردا‬ ‫التابعة‬ ً ‫ا‬ ‫ب‬ ‫المنقولة‬ ‫اآلفات‬ ‫و‬ ‫اض‬ ‫األمر‬ ‫اسطة‬ ‫و‬ ٍ ‫كجزء‬ ‫البذور‬ ‫ة‬ ‫اإلدار‬ ‫و‬ ‫اقبة‬ ‫المر‬ ‫نظام‬ ‫من‬ ‫وهي‬ ، ‫ال‬ ‫المثال‬ ‫سبيل‬ ‫على‬ ( ‫الحصر:‬ 1 ( ‫المخازن،‬ ‫ات‬ ‫حشر‬ ‫عن‬ ‫للكشف‬ 2 ‫اخت‬ ) ‫بار‬ ‫ات‬ ‫النشاف‬ ‫اق‬ ‫أور‬ ‫و‬ ‫و‬ ( ‫الفطور،‬ ‫عن‬ ‫للكشف‬ ‫اآلجار‬ ‫أطباق‬ 3 ) ‫المصلية‬ ، ‫مثل‬ ‫إ‬ ‫ا‬ ‫ليز‬ ( ELISA ) ‫النباتي‬ ‫النسيج‬ ‫وبصمة‬ ( TBIA ‫ال‬ ‫عن‬ ( ‫فيروسات،‬ 4 ‫و‬ ( 5 ‫عن‬ ‫للكشف‬ ‫المناعي‬ ‫اص‬ ‫التر‬ ‫اختبار‬ ) ‫البكت‬ ‫ي‬ ‫ات‬ ‫االختبار‬ ‫إ‬ ٍ ‫عدد‬ ‫فحص‬ ‫مكانية‬ ً ‫إضافة‬ ‫السابقة‬ ‫ات‬ ‫لالختبار‬ ، ‫فقد‬ ‫طو‬ ( (GHU ‫اسطة‬ ‫بو‬ ‫ذات‬ ‫كتقنيات‬ ‫البذور‬ ‫كفاءة‬ ‫عالية‬ ‫ب‬ ‫نتائج‬ ‫وحدة‬ ‫ـ‬ ‫ـ‬ ‫ال‬ GHU ‫من‬ ‫أكثر‬ ً ‫سنويا‬ 50 ‫السماح‬ ‫و‬ ‫المعتمدة‬ ‫للبذور‬ ‫التنظيمية‬ ‫و‬ ‫القانونية‬ ‫بتبادل‬ ‫ية‬ ‫البذر‬ ‫العينات‬ ‫هذه‬ ‫تخضع‬ ‫الدولية،‬ ‫ل‬ ‫الي‬ ‫حو‬ 650 ‫ألف‬ ‫اختبار‬ ‫حفظ‬ ‫بغرض‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫الق‬ ‫المدى‬ ‫على‬ ‫يع‬ ‫التوز‬ ‫إلى‬ ‫على‬ 90 ‫األقل‬ ‫على‬ ‫دولة‬ ، ‫و‬ ‫البذور‬ ‫يق‬ ‫طر‬ ‫عن‬ ‫المنقولة‬ ‫اض‬ ‫األمر‬ ‫الي‬ ‫(حو‬ 10 -15 ‫المفحوصة)‬ ‫العينات‬ ‫مكافحتها‬ ‫يمكن‬ ‫ال‬ ‫التي‬ ‫و‬ ‫أ‬ ‫و‬ ‫باستخدام‬ ‫عليها‬ ‫ة‬ ‫السيطر‬ ‫مجمل‬ ‫من‬ % ‫باآلفات‬ ‫المصابة‬ ‫العينات‬ ‫إقصاء‬ ‫و‬ ‫باإلضافة‬ ‫الطويل،‬ ‫و‬ ‫صير‬ ‫تشخيصي‬ ‫الحدود‬ ‫عبر‬ ‫البذور‬ ‫بالمتطلبات‬ ‫للوفاء‬ ‫ية‬ ‫بذر‬ ‫عينة‬ ‫ألف‬ ‫تختبر‬ ‫يعة.‬ ‫وسر‬ ‫دقيقة‬ ‫المنقولة‬ ‫الممرضات‬ ‫عن‬ ‫للكشف‬ ‫يئية‬ ‫الجز‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫العديد‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫رت‬ . ً ‫نسبيا‬ ‫منخفضة‬ ‫بتكلفة‬ ‫العينات‬ ‫من‬ ‫كبير‬ ‫هذه‬ ‫توفر‬ ‫يا.‬ ‫ر‬ ‫النيماتودا،‬ ‫عن‬ ‫للكشف‬ ‫النيماتودا‬ ‫استخالص‬ ‫اختبار‬ ) ‫للكشف‬ ) ‫ات‬ ‫االختبار‬ ‫المركزي‬ ‫بالطرد‬ ‫الغسيل‬ ‫الطفو‬ ‫اختبار‬ ‫و‬ ‫المباشر‬ ‫الفحص‬ ) ، ‫عن‬ ‫للكشف‬ ‫ات‬ ‫االختبار‬ ‫من‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫منخفضة‬ ، ‫تكون‬ ‫أن‬ ‫يجب‬ ‫العملية،‬ ‫الناحية‬ ‫من‬ ‫يئية.‬ ‫الجز‬ ‫ات‬ ‫االختبار‬ ‫و‬ ‫المناعية‬ ‫ات‬ ‫االختبار‬ ‫التحضين،‬ ‫ات‬ ‫اختبار‬ ‫المباشر،‬ ‫الفحص‬ : ‫إلى‬ ‫ات‬ ‫االختبار‬ ‫هذه‬ ‫يف‬ ‫المختبر‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ ‫بما‬ ‫الصحي،‬ ‫الحجر‬ ‫اقبة‬ ‫لمر‬ ‫صارم‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫جميع‬ ‫ضع‬A-6 ‫ائق‬ ‫طر‬ ‫ل‬ ‫التابعة‬ ‫المطبقة‬ ‫التشخيص‬ ‫(ايكاردا)‫البقوليات‬ ‫و‬ ‫لدى‬ ‫اثية‬ ‫الور‬ ‫األصول‬ ‫صحة‬ ‫وحدة‬ (GHU) . ‫صفاء‬ ‫غسان‬ ‫قمري‬ 1 ، ‫مكحل‬ ‫الرحمن‬ ‫عبد‬ 1 ، ‫ياني‬ ‫المز‬ ‫إنعام‬ 2 ‫درويش‬ ‫إيمان‬ ‫و‬ 1 . ( 1 ‫مختب‬ ) ‫للبحوث‬ ‫الدولي‬ ‫المركز‬ ‫البذور،‬ ‫صحة‬ ‫ر‬ A-6 DIAGNOSTIC TOOLS APPLIED BY ICARDA'S GERMPLASM HEALTH UNIT (GHU) FOR DETECTION OF PESTS AND DISEASES TRANSMITTED VIA LEGUME AND CEREAL SEEDS. Safaa G. Kumari 1 , Abdulrahman Moukahel 1 , Inaam El-Miziani 2 and Iman Darwish 1 . (1) Seed Health Laboratory, International Center for Agricultural Research in the Dry Areas (ICARDA), Terbol Station, Zahle, Lebanon; (2) ICARDA, Rabat, Morocco, Email of corresponding author: [email protected]   ) ( 2023 2 ‫عدد‬ ، )( 20232‫عدد‬ ،  "}],"sieverID":"d07feaef-f390-4790-b385-2bbf44fd3bd9","abstract":"The red palm weevil (RPW), Rhynchophorus ferrugineus (Olivier, 1790), is a highly destructive invasive pest that attacks date palm trees, which are a vital source of income for many farmers in Iraq. It was first detected in Iraq in 2015, in Safwan county, Basrah province. This study presents the results of a seven-year monitoring program aimed at assessing the management protocol of invasive RPW population in Basrah counties. In response to the RPW threat, a chemical control protocol was applied to manage the pest in all date palm orchards of Safwan district. Aerial spraying and injection of two insecticides (Confidor 200 SC and Deltamethrin) were applied semiannually. To assess the effectiveness of the chemical control program, RPW abundance was monitored biweekly using pheromone bait traps, with the number of weevils caught in each trap continuously recorded from 2017 to 2022. The study indicated that the quarantine protocol implemented in Safwan county had successfully controlled the spread of RPW until 2020. No RPW infestations were reported between 2015 and 2020 In Zubair. However, RPW invaded the date palm trees in Zubair county in 2021 and 2022. Overall, the management protocol implemented in Safwan district has been successful in managing infestation rates and keeping them under control."}

data/part_2/024f523eae8df8ddf9bf6031d71d861c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"024f523eae8df8ddf9bf6031d71d861c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/78627fcd-6b68-41aa-9cc5-f82f81568ee5/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":11,"text":"What does sexdisaggregated data say about livestock and gender in Niger?"},{"index":2,"size":73,"text":"Gender issues should be considered in the planning of livestock development programs. Unfortunately, rarely is the data available to show the diverse yet often complementary roles and responsibilities in livestock production and gender differences in terms of access and control of livestock. This challenges policy makers and donors in developing gender friendly policies and identifying investments in the sector that fosters asset build up and income generation for women through the livestock sector."}]},{"head":"Niger: the Census of Agriculture and Livestock","index":2,"paragraphs":[{"index":1,"size":60,"text":"The General Census of Agriculture and Livestock in Niger, undertaken in 2005/07, the first since 1980, provides the most updated comprehensive overview of livestock numbers in the three major production systems in the country: croplivestock, transhumance and pastoralist systems. The survey, however, targets only sedentary livestock and does not allow insights into the role of gender in the pastoral economy. "}]},{"head":"Livestock ownership","index":3,"paragraphs":[{"index":1,"size":108,"text":"This Niger General Census of Agriculture and Livestock initiated the first generation of sexdisaggregated data on looking at the gender dimension in the livestock sub-sector. Nationally, 93 percent of farm households are headed by a man and about 7 percent are headed by a woman. However, while about 10 percent of male-headed households are specialized livestock farmers, almost 26 percent of female-headed households result specialized in livestock production. Despite men heading 94 percent of farm households, they are documented to keep about three quarters of sedentary cattle farming (78%), with women keeping the rest. Sedentary cattle farming, therefore, can no longer be considered a unique activity of men."},{"index":2,"size":46,"text":"Women-headed households have an even higher role in the whole ruminant sector with nearly 40 percent of the national herd in possession of a woman and the remaining 60 percent owned by male-headed households. This is even surpassed by women's ownership of goats at national level."},{"index":3,"size":63,"text":"Poultry raising in Niger is not an activity only for women at national level, as men own 46 percent of chickens, 68 percent of guinea fowl and 57 percent of ducks, against respectively 32, 14 and 22 percent for women. Children are very involved in the rearing of poultry: they have 22, 18 and 21 percent respectively of chickens, guinea fowl and ducks."}]},{"head":"Husbandry practices","index":4,"paragraphs":[{"index":1,"size":19,"text":"A review of husbandry practices indicates that there are no substantial differences between the two heads of households nationally."},{"index":2,"size":36,"text":"About two thirds of households feed their animals using troughs, supported by grazing for cattle, sheep and goats. Almost half of both male and female heads of household use supplemental products as feed supplements and salts."},{"index":3,"size":50,"text":"Female heads of household vaccinate their cattle less than male-headed households, as 56 percent do not vaccinate compared to 46 percent of male heads of household. This disparity exceeds that of the vaccination of sheep and goats which are quite similar at about 30 and 25 percent for all households."},{"index":4,"size":36,"text":"Woman-headed households tend to engage less in cattle fattening (34 percent of women compared to 46 percent of male-headed households) while the difference between male and female headed households is negligible for fattening sheep and goats."}]},{"head":"Development implications and data issues","index":5,"paragraphs":[{"index":1,"size":36,"text":"Ownership of assets in general, and livestock in particular, can translate into positive development outcomes and sex-disaggregated data is the first step towards understanding how to harness opportunities for identifying a livestock development ladder for women."},{"index":2,"size":101,"text":"It seems clear in the case of Niger that investments in the small ruminant sector could potentially have more of a gender impact that other investments, and that women recognize the value of good husbandry practices no less than men. However, explorative data analysis of differences in ownership and husbandry practices between male and female-headed households is a necessary but not sufficient step towards understanding the potential of livestock development to women empowerment and gender equity. In this analysis, for instance, the data may compare a widow-headed household with a male-headed household, comprising husband, wife and children, which makes little sense."},{"index":3,"size":78,"text":"The ultimate relationship between livestock and gender could be only understood in the context of a more comprehensive set of data, such as household and community surveys which include information on a variety of household-related characteristics -e.g. household size, education of head of household, access to public and private services, distance to markets, etc. It is only when accounting for key household characteristics that one can arrive at determine some causality between growth of livestock and women empowerment."},{"index":4,"size":6,"text":"For further information please visit: www.africalivestock.data.org"},{"index":5,"size":13,"text":"Or contact: Nancy Morgan, FAO-World Bank [email protected] Ugo Pica-Ciamarra, Livestock Economist, FAO [email protected]"}]}],"figures":[{"text":"• Do male head of households have larger livestock holdings? • How does livestock ownership affect net household income by male versus female head of households • Where are the data gaps? Livestock Data Innovation in Africa BRIEF Joint brief of the World Bank, FAO, ILRI, AU-IBAR with support from the Gates Foundation Issue 1 • January 2011 Livestock Data Innovation in Africa BRIEF • Issue 1 • January 2011 "}],"sieverID":"4db7b821-3f7c-4c54-84aa-d85f16c55573","abstract":""}

data/part_2/02cbbeb8db1ee290eaaf9e0280d5d780.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02cbbeb8db1ee290eaaf9e0280d5d780","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/36e84817-b6eb-4257-8248-47fc26d5fa2e/retrieve"},"pageCount":11,"title":"Why Look at Nutrition when Considering Sustainable Intensification?","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":88,"text":"The focus of agricultural intensification has historically been on increasing yields of major staple crops, which has resulted in numerous negative environmental, social and nutritional impacts. For example, agriculture has been accredited to over 62% of IUCN Red List Threatened and Near-Threatened species (Maxwell et al. 2016). There is also concern around a number of thresholds and planetary boundaries (e.g. climate change, nitrogen and phosphorus cycles and biodiversity loss) that are being transgressed (Rockström et al. 2009;Steffen et al. 2015), largely due to both agricultural intensification and expansion."},{"index":2,"size":110,"text":"Despite the increases in yield observed with intensification practices, food security and nutrition continue to be burden felt by rural small holder farmers across the world. Sustainable Intensification has been proposed as a means to simultaneously increase yields, reduce environmental impacts, and provide other benefits such as improved ecosystem resilience and nutrition. Using nutrition as an entry point allows for a unique opportunity to identify how to improve the quality of the diets of small holder farmers by identifying what the local dietary gaps, and which locally available (and hence acceptable) foods could be promoted for intensified production to first fill local dietary needs, followed by income generation activities sustainably. "}]},{"head":"The Solomon Islands: A Case Study","index":2,"paragraphs":[{"index":1,"size":40,"text":"The Solomon Islands is a Melanesian archipelago country consisting of over 900 islands spread across the Pacific Ocean with have an increasing population, currently of over 600,000. The majority of the population reside in remote rural villages of varying size."},{"index":2,"size":188,"text":"Agricultural production makes up over 91% of the country's GDP (WTO, 2017), and with 85% of the population relying on subsistence farming to some degree, opportunities to intensify production systems for both income and food and nutrition security are needed (Jansen et al, 2006). With the increasing population and pressures of climate change, over time, more land is being cleared and allocated to agriculture (Figure 2). Despite the increasing productivity trend in the Solomon Islands, poor health and malnutrition continue to be serious issues. The Solomon Islands is rapidly experiencing the nutrition transition -the loss of traditional diets in favour for more modern western style diets -which is contributed as a major drivers for worsening health and nutrition (Parry, 2010). The triple burden of malnutritionthe concurrent existence of energy and protein deficiencies, micronutrient deficiencies and overnutrition (overweight and obesity) -is a reality for many Solomon Islanders and their communities, for which poor diet quality is a major driver. Increasingly, non-communicable diseases such as cardiovascular diseases, diabetes and cancers are also being attributed to insufficient and poor diets in the Solomon Islands (Figure 2) -a similar trend observed globally."},{"index":3,"size":136,"text":"The production of roots, tubers and bananas (RTB) over time has been increasing, however -yields of local species such as banana and taro seem to be stagnant or increasing very slowly (Figure 3). Traditional RTB have been the staple foods for the Solomon Islands, and despite increasing population, these foods have not seen a simultaneous or equal rate increase In fact, it appears that cassava is the dominant RTB being consumed, followed by sweet potatoes (Figure 3). Cassava for consumption appears to be largely imported considering the low production quantities compared to other RTB species. Agricultural practices in Baniata do not include the use of agrochemicals (fertilizers, pesticides, herbicides, or insecticides) as the community have made an agreement to practice organic farming. However, according to the villagers, crop yields have been declining over the past decade."},{"index":4,"size":124,"text":"Drivers towards an increasing need for more sustainably intensified production system in general include: Indigenous Baniata villagers were previously entirely self-reliant for centuries, surviving exclusively from home grown and wild collected foods. However dietary transitions began with the introduction to processed foods and exotic foods (such as white rice, sugar and cassava) via missionaries in the 1920's, soldiers from World War 2 in the 1940's, and loggers in the 1990's. The most dramatic changes in the diet occurred within the past 2-3 decades. These transitions are understood by the villagers to coincide with increased rates of noncommunicable diseases. However due to cost and convenience, most villagers agree that these foods will continue to become more prominent in their diets if no intervention is made."},{"index":5,"size":148,"text":"Homegrown foods currently make up around 60% of local diets, including multiple varieties of coconuts, nuts, RTBs (sweet potato, taro, cassava, and bananas), cabbage and other leafy vegetables, and fruits. Wild foods make up around 10% of local diets, and include fish, seafood, eels, shellfish, ferns, and wild taro. Regionally canned tuna is also increasingly prominent in local diets, often replacing freshly caught seafood. Due to outside influence and globalization, consumption of ultra-processed foods now make up around 30% of indigenous Baniata villager's diets. Ultra-processed foods include white rice, butter biscuits, packaged instant noodles, and sugarsweetened packaged drink mixes. Shifting towards ultra-processed foods and away from local and wild foods is increasing the intake of calories while decreasing intake of essential micronutrients. Without interventions, diets will likely continue the transition towards poorer quality and ultra -processed foods leading to higher rates of NCDs, as seen across the country."},{"index":6,"size":97,"text":"Contribution of Roots Tubers and Bananas to Today's Diet RTB crops have been the staple food of the traditional Solomon Islands diets. These crops provide essential macro nutrients such as fibre and energy as well an array of micronutrients. However, due to diet changes, the diversity and quantity of RTBs being consumed in the diet is declining. Many RTBs are being replaced by white rice, as villagers state rice is inexpensive and easy to cook, with the younger generation preferring the taste. Some women, however, shared that rice does not keep their hunger satiated as well as"},{"index":7,"size":1,"text":"RTBs."},{"index":8,"size":75,"text":"The majority of households still consumed at least one type of RTB daily. Table 1 describes the most commonly consumed varieties of RTB. Only two households utilized the leaves of a RTB (taro) in their meal preparation. It is important to note that this is a snap shot of one period in time (July, 2018) and does not capture seasonal variations in diet related to the seasonal availability of RTB within the local food system."},{"index":9,"size":112,"text":"The average energy contribution of RTBs to the diets was 506 kcal, which constitutes 27% of their daily caloric energy intake. RTBs contributed 32% of the participant's estimated average requirement (EAR) of iron (2.57mg) and 9 grams of dietary fibre, making up 7% of their EAR. There has been a recent trend to peel the skins off from the roots and tubers prior to consumption, which reduces the fibre potential of RTBs. The women expressed that removing the skin is less healthy, but tend to prefer the taste when prepared this way. Most women were significantly below the recommended intakes of numerous essential nutrients, including vitamin A, calcium, protein, thiamine, and riboflavin."},{"index":10,"size":114,"text":"Over 68 varieties of RTBs were documented as being available for use either through production or collection from the wild (Table 2). Only 25% of respondents consumed orange and redfleshed fruits and vegetables -high in beta carotene a pre-cursor to vitamin A synthesis in the body -in the proceeding 24-hour period, despite them being available in the local food system. Quantitative household dietary intake data confirmed the low intake of orange and Women who were the primary household cooks who were sampled and completed dietary assessments had an average BMI of 26 and an average body fat percentage of 30%, both of which are evidence of the nutrition transition, with the population being overweight."},{"index":11,"size":8,"text":"Dietary Diversity & Neglected and Underutilized Species (NUS)"},{"index":12,"size":127,"text":"Dietary diversity of Baniata villagers is declining, as ultra-processed and imported foods replace traditional food varieties. Numerous species of RTB were found to be underutilized within the community (produced and consumed by a small part of the community -Table 2). As example, bright orange-fleshed bananas (Figure 6) are not widely consumed but are likely to contain high amounts of both vitamin A and riboflavin and are a traditional food of the community which is rarely consumed today. Table 2 describes the available varieties of RTB that were reported as being produced locally or collected from the wild within the local food system landscape of Baniata. Just over 10 species were identified as being dark yellow or orange fleshed, which are an indication of high beta-carotene content -."},{"index":13,"size":26,"text":"Consumption of foods high in betacarotenes can increase levels of Vitamin A in the blood, and hence, be a useful foodbased tool against vitamin A deficiency."}]},{"head":"How Sustainable Intensification of RTB Could Improve Nutrition","index":3,"paragraphs":[{"index":1,"size":111,"text":"Throughout the Pacific vitamin A continuous to be a problem nutrient, which is at least partially attributed to the shift away from traditional diets (Parry, 2010). In Baniata, Vitamin A in particular was found to be inadequate. Vitamin A deficiency is serious, and a leading cause of preventable disease such as blindness and reduction immune system function leading to increased risk of serious and sometimes fatal infection. The paradox is that there are multiple varieties of cassava, taro, sweet potato and banana that are dark yellow and orange fleshed that are available within the food system that if were more abundantly available, could be leveraged to help bridge this dietary gap."},{"index":2,"size":26,"text":"Two main pathways are recommended to guide sustainable intensification programs of dark yellow and orange fleshed RTB rich in vitamin A available in the system: 1."},{"index":3,"size":14,"text":"Increases in production for local consumption -more sustainable than current vitamin A supplementation programs."}]},{"head":"2.","index":4,"paragraphs":[{"index":1,"size":42,"text":"Create niche value chains and income generation opportunities, particularly for processing of Vitamin A rich RTB into food products such as complementary baby foods. These foods can be stored for consumption throughout there year, as well as marketed outside of the community."}]},{"head":"Limiting factors of RTB Intensification","index":5,"paragraphs":[{"index":1,"size":93,"text":"Climate change was reported as the most serious limiting factor, with increasing salinity and unpredictable weather patterns, yields are being negatively affected. Villagers also cited the rise of pests (red nose bird, wild pigs, and rats) and diseases on RTB crops that is negatively affecting yields and as a result, varieties susceptible to pests are planted less frequently. Market demand is an additional determinant of which RTB crops villagers choose to grow. When probed, there was also a lack of knowledge between different nutritional properties or benefits of different RTB species or varieties.  "}]}],"figures":[{"text":"Figure 1 - Figure 1-Bundles of sweet potato for sale "},{"text":"•Figure 3 -Figure 2 - Figure 3 -Solomon Island agriculture land use, population and Roots, Tubers and Banana production, food balance and consumption trends. FAO STAT 2019 "},{"text":"Figure 4 - Figure 4 -Young child with local variety of orange-fleshed banana "},{"text":"Figure 6 - Figure 6 -Two local varieties of vitamin A rich bananas fresh (left) and cooked (top right: baked and bottom right: banana pudding and fried banana) "},{"text":"  "},{"text":"Baniata Village and the Local Food System Research was conducted in the indigenous village of Baniata, located in the Western Province on Rendova Island in July of 2018  using a mixed method approach that using a mixed method approach that utilized participatory qualitative focus utilized participatory qualitative focus group discussions (n= 63, mixed gender group discussions (n= 63, mixed gender and age) and repeat quantitative and age) and repeat quantitative household nutrition surveys (n=30 household nutrition surveys (n=30 women). This wider study examined the women). This wider study examined the role of agrobiodiversity in the local food role of agrobiodiversity in the local food system resiliency, transitioning dietary system resiliency, transitioning dietary patterns, anthropometrics, dietary patterns, anthropometrics, dietary diversity, and nutritional intakes of Baniata diversity, and nutritional intakes of Baniata villagers. The results presented here focus villagers. The results presented here focus on the role of RTB in the system. on the role of RTB in the system. Baniata has a population of around 900 Baniata has a population of around 900 villagers, with limited access to electricity villagers, with limited access to electricity (solar panels only) and mobile phone (solar panels only) and mobile phone service (one area on the edge of the village service (one area on the edge of the village received reception). The village is located received reception). The village is located on a coastal peninsula, with access to on a coastal peninsula, with access to ocean foods. The surrounding landscape is ocean foods. The surrounding landscape is a biodiverse and dense mountainous a biodiverse and dense mountainous forest which also provides sources of wild forest which also provides sources of wild edible plants and animal foods. The edible plants and animal foods. The seasons fluctuate between wet and dry, seasons fluctuate between wet and dry, and the temperature is consistently and the temperature is consistently around 29°C. Climate change is resulting around 29°C. Climate change is resulting in stronger storms, rising temperatures, in stronger storms, rising temperatures, and increasing levels of agricultural pests. and increasing levels of agricultural pests.  "},{"text":"Table 1 : Roots, Tubers and Banana consumption rates in Baniata, sourced from repeat multiple-pass 24-hour dietary recalls International/C.Voglianio International/C.Voglianio Bioversity Bioversity Credit: Credit: International/J.Raneri International/J.Raneri Bioversity Bioversity Credit: Credit:  "},{"text":"Table 2 : Roots, tubers, and bananas available through production or wild harvest within the local Baniata food system landscape.    Origin Grown by    OriginGrown by Crop spe-cies Local Varie-ty name Flesh col-our  many or few house- Large or small areas Community Com-ments or Notes Limitations / challenges Crop spe-ciesLocal Varie-ty nameFlesh col-ourmany or few house-Large or small areasCommunity Com-ments or NotesLimitations / challenges     holds    holds Cassava        Cassava Manihot esculenta Pencil Cas-sava White Introduced Many Large Very good all year round  Manihot esculentaPencil Cas-savaWhiteIntroduced ManyLargeVery good all year round Manihot esculenta Underpant White Introduced Few Small Suitable to make puddings  Manihot esculentaUnderpant WhiteIntroduced FewSmallSuitable to make puddings Manihot esculenta Yellow Cur-ry Yellow Introduced Many Large All year round and suitable for both pud-ding & cooking  Manihot esculentaYellow Cur-ryYellowIntroduced ManyLargeAll year round and suitable for both pud-ding & cooking Manihot esculenta Six Months White Local Many Large Available all year round  Manihot esculentaSix Months WhiteLocalManyLargeAvailable all year round Manihot esculenta Green Top - Introduced Few Small All year rounder Too soft when cooked Manihot esculentaGreen Top -Introduced FewSmallAll year rounderToo soft when cooked Manihot esculenta Ranoga - Introduced Many Large High yielding  Manihot esculentaRanoga-Introduced ManyLargeHigh yielding Manihot esculenta Fizi White Introduced Few Small All year round Suitable for pudding only Manihot esculentaFiziWhiteIntroduced FewSmallAll year roundSuitable for pudding only Manihot esculenta Kaiza - Introduced Many Large Suitable for both cooking and making pudding  Manihot esculentaKaiza-Introduced ManyLargeSuitable for both cooking and making pudding Taro        Taro Colocasia esculenta Sisiri - Introduced Many Small Good taste Seasonal Colocasia esculentaSisiri-Introduced ManySmallGood tasteSeasonal Colocasia esculenta Mahio - Local Many Small Good taste Seasonal Colocasia esculentaMahio-LocalManySmallGood tasteSeasonal Colocasia esculenta Fivo/Buini - Introduced Many Small Good taste Seasonal Colocasia esculentaFivo/Buini -Introduced ManySmallGood tasteSeasonal Colocasia esculenta Omu - Local Few Small Good taste  Colocasia esculentaOmu-LocalFewSmallGood taste Colocasia esculenta Ruta - Local Many Large Well adapted and all year round Not preferred as other taros Colocasia esculentaRuta-LocalManyLargeWell adapted and all year roundNot preferred as other taros Colocasia esculenta Sofu - Local Few Small Soft texture  Colocasia esculentaSofu-LocalFewSmallSoft texture  "}],"sieverID":"76a85ff7-b028-4a2d-a18d-9306c21dec4a","abstract":""}

data/part_2/03d394e9c3cf5cec92ec39ce38c86721.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03d394e9c3cf5cec92ec39ce38c86721","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/56223610-fd77-4463-83d6-32fddc6c506e/retrieve"},"pageCount":11,"title":"Capacity development of Kyanamukaaka-Kabonera Pig Cooperative: Report of the business and enterprise management training course","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":89,"text":"This report highlights the outcome of the Business and Enterprise training workshop conducted for pig farmers under the Kyanamukaaka-Kabonera pig cooperative in Masaka district. The training took place from 26 th to 28 th August 2015 at St.Paul Primary School in Bukunda, Masaka district. The report contains information about workshop preparations, objectives, methodology, key events of the training, participants' evaluation of the workshop, summary of conclusion and recommendations. The training team comprised of Enterprise Uganda staff; Daniel Joloba and Sarah Akiteng. A total of 101 farmers attended the training."}]},{"head":"THE WORKSHOP","index":2,"paragraphs":[]},{"head":"Preparation","index":3,"paragraphs":[{"index":1,"size":48,"text":"The association leaders played a big role in identifying and selection of the potential participants. The leaders also assisted on venue identification, invitations, transportation and logistical support to participants. The training department of Enterprise Uganda handled the preparation of training materials and took leadership in delivering the training."}]},{"head":"2.2","index":4,"paragraphs":[{"index":1,"size":95,"text":"Workshop Objectives Overall, the training was aimed at enabling participants become familiar with behavioural competencies of successful entrepreneurs; look for, recognize and adapt those behaviours. Specifically, the workshop was to;  Provide the participants with a frank and comprehensive evaluation of their potential as entrepreneurs;  Increase their capacity to; detect opportunities, establish stimulating goals, make use of multiple sources of information and develop plans of action in form of a business plan;  Provide the participants with a system of support and consulting in the implementation of their plans; and  Reinforce their self-confidence."}]},{"head":"2.3","index":5,"paragraphs":[{"index":1,"size":65,"text":"Training Methodology The workshop was delivered through highly interactive and experiential training methods based on the empretec methodology. Approaches such as brainstorming, group discussions, case studies, games, role-plays and sharing of experiences, self assessments and discovery were used to enhance learning. The training challenged participants about their potential as entrepreneurs and assisted them recognize their abilities, weaknesses and how to improve on the weak areas."},{"index":2,"size":82,"text":"At the centre of the learning were the 10 habits of successful entrepreneurs and the 30 Personal Entrepreneurial Competences (PECs). Exercises and various forms of assignments within and out of class were performed to reinforce learning. Specifically regarding the risk taking exercise, a game involving the \"throw of the ring\" was used to get participants to appreciate calculated risk-taking behaviors. In order to stimulate more participation, the team of trainers reiterated rewarding of outstanding performance for various key exercises during the training."},{"index":3,"size":38,"text":"The two trainers dedicated their time to working with the participants on developing their action plans and specific commitments were made towards this. At the end of the training at least each participant had a draft action plan."}]},{"head":"Training Venue","index":6,"paragraphs":[{"index":1,"size":66,"text":"St.Paul Primary School in Bukunda is slightly off the main road but with the necessary amenities to facilitate a good learning environment. The main hall was big enough to accomodate the large numbers plus the intensity of the activities invloved in the training. The break -away rooms were available for extra activities outside the main hall. Despite all this, the frequent power black-outs caused some disruption. "}]},{"head":"PROFILE OF THE PARTICIPANTS","index":7,"paragraphs":[]},{"head":"Workshop Opening and Closing Ceremonies","index":8,"paragraphs":[{"index":1,"size":93,"text":"The workshop was officially opened on Wednesday 26th August 2015 by the ILRI Monitoring and Evaluation Manager, Robert Ochago. He welcomed the participants and applauded them for the interest they showed in the program through their attendance. He stressed that SPVCD program existed to make the farmers/entrepreneurs grow their enterprises. Mr. Ochago told participants that the training was meant to equip them with entrepreneurial competences necessary to make them successful in business. He encourgaed the participants to make the best out of the training through their active participation and presence in all sessions."},{"index":2,"size":47,"text":"Speaking on behalf of the training team, Daniel Joloba, the Lead Facilitatotor told the participants that Enterprise Uganda is an institution with a track record of building competitive MSMEs in the country and beyond. He reitertaed the various programs run by the organization and the services offered."},{"index":3,"size":78,"text":"During the workshop closing session held on 28th August 2015, the Lead Facilitator, Daniel Joloba congratulated participants upon successfully completing such an intensive and demanding training. The Lead Facilitator challenged participants to create a difference in the way they handle their businesses. He called upon them to be proactive, efficient and practice the habits of successful entrepreneurs in order to transform their behaviours, lives and businesses since the training was meant to make them competitive and business minded."}]},{"head":"The Lead Trainer giving feedback on the results of the risk game to the participants","index":9,"paragraphs":[]},{"head":"Reflections on the previous training.","index":10,"paragraphs":[{"index":1,"size":35,"text":"The participants were also given a chance to reflect on what they have done since the last training held on 13 th -14 th July 2015. Below are some of the sample the excerpts captured."}]},{"head":" I had two pigs but after the training I was able to add 2 more pigs. I now have 4 pigs. The skill to think big as a leader was very touching to me. I intend to extend the same message to my members. -Gorreti Nandawula, Kyamuyimbwa farmers group  I learn't that a group should set stretch targets and should not just be comfortable in existing. We have been saving 20,000= per month per member but after the training we realized we could do better than that so we increased our savings to 50,000= per month. This will give us a comfortable cash base where members can ably borrow and increase their pig farms -Florence Kakeeto, Chairperson of Akwata Empola group  In the last training, I learn't that a leader should be an example to those he/she is leading. I had 3 pigs but after the training, I was able to add more 4 pigs now I have 7 in total.","index":11,"paragraphs":[{"index":1,"size":5,"text":"-Annet Nalule, Akwata Empola group."}]},{"head":"WORKSHOP EVALUATION BY THE PARTICIPANTS","index":12,"paragraphs":[{"index":1,"size":64,"text":"The evaluations indicated that the course was very important to most of the participants and methodology used to deliver sessions was excellent. Participants appreciated the relevance of the course as it so fits into practical application of their businesses and most of their expectations were met. Overall, the workshop was ranked as excellent by 73% and as very good by 23% of the participants."},{"index":2,"size":68,"text":"This shows the value that the participants attached to the training and the attendant effect it will have on their livelihoods. Copies of the filled evaluation forms are attached in appendix 9 ( c) . As will be mentioned later, it will be more important to assess the uptake of the training at intermediate and long term points to adequately judge the systemic changes registered by the participants. "}]},{"head":"Some of the comments mentioned in the evaluation forms were:","index":13,"paragraphs":[]},{"head":" From today I am going to be a different person in planning and putting in action as entrepreneurs do for a betterment of my future life","index":14,"paragraphs":[{"index":1,"size":17,"text":" From this workshop I have learnt how to manage my business especially how to make profits."}]},{"head":"CONCLUSIONS AND RECOMMENDATIONS","index":15,"paragraphs":[{"index":1,"size":130,"text":"The training was successfully completed, giving participants a new outlook on their competences and experience in life from what they had before. It is worth noting that the training was an eye opener to most of the participants who indicated that they should have had this much earlier. The training changed their ways of looking at business and taking decisions that affect their lives. It was a self discovery to themselves and a reflection on how they could behave differently to achieve maximum benefits out of their ventures. The turn up, commitment and efforts to learn exhibited during the training is commendable, save for a few isolated cases. Not only has the workshop enhanced the entrepreneurial competences of the participants, but also given them the opportunity to network among themselves."},{"index":2,"size":7,"text":"Below are the recommendations and action points;"},{"index":3,"size":33,"text":" Follow up on participants to assess application of the behaviours adopted and offer additional support especially on the individual action plan development process for their businesses and offer additional business advisory support."}]},{"head":"","index":16,"paragraphs":[{"index":1,"size":31,"text":"Closely monitor emerging challenges and incorporate them in the subsequent training. Arrange for special sessions to include detailed business coaching like financial management and literacy, marketing and customer care among others."}]},{"head":"","index":17,"paragraphs":[{"index":1,"size":35,"text":"Expose the participants to other like farms to enable the beneficiaries to link the training to the realities on the ground. ILRI may need to explore avenues of committing some resources for this endeavor. ______________________________________"}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"have to pay attention to my projects at all time. No more time for laziness.  I have picked a key lesson that opportunities come when you are doing something and what you consider to be your problems can actually be opportunities  I have learn't that there is only one person who is capable to set limits to my growth and it is me. No one else.  I am going to have as many pigs as possible from the ten I have to have one hundred by 2017 December.  Am going to start practicing successful enterprise behaviors like seeing opportunities where others see problems  I must have hope for success in whatever I do especially as a business  Recording and considering inputs and outputs in a business more so in pig keeping is very important. Am going to start implementing it immediately.   Participant' Evaluation of the Training (%)   Participant' Evaluation of the Training (%) Title     Title Axis     Axis  Excellent Very Good Fair Poor ExcellentVery GoodFairPoor Series1 73 23 4 0 Series1732340  "}],"sieverID":"66a3c525-4052-4c4f-a55e-545c10bb96e0","abstract":""}

data/part_2/0425e1b7c09088dbfda56e5b79d8b902.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0425e1b7c09088dbfda56e5b79d8b902","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7c43b0d9-cd01-43e2-999d-d7d9c1e2712c/retrieve"},"pageCount":7,"title":"Research legitimacy as a precursor to e ectiveness: the role of equitable partnerships in transforming aquatic food systems","keywords":["research-for-development","transformation","partnerships","equity","aquatic food systems"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":195,"text":"The competing-and potentially conflicting-demands for aquatic spaces (including oceans, rivers, lakes) that come with economic development under the banner of the blue economy present challenges for just and equitable development (Cisneros-Montemayor et al., 2021;Schutter et al., 2021). These competing interests, for instance between space for fisheries and shipping lanes, or power struggles over decision making and financial benefits, in turn make it challenging for small-scale food producers to secure their place in the blue economy. In addition to blue economic growth, coastal communities are exposed to effects of climate change and conservation pressures, making aquatic spaces and the people dependent on them particularly vulnerable to potential negative impacts (Gill et al., 2023). Researchfor-development, broadly defined as research done to improve social well-being (Laws et al., 2013), can support these actors and mediate the threat of uneven development, especially when researchers and practitioners promote shared knowledge and recognize patterns of interaction between actors (Metcalfe and Ramlogan, 2008; Anandajayasekeram and Gebremedhin, 2009). However, the legitimacy and effectiveness of research-for-development have been found to be challenging to operationalize (CGIAR ISDC, 2021), compromising the ability of research to truly support transitions to, or reclamations of, sustainable aquatic food systems."},{"index":2,"size":159,"text":"Building on our own experience in research-for-development in aquatic food systems, recognizing the systemic barriers that can challenge our attempts at improving social well-being for people in these systems, we argue that partnerships that involve food actors as meaningful partners can help better embed research in practice. Including a wide range of partners and making sure the right partners are involved can foster the productive interactions and interactive learning needed for solving complex problems. Coproduction-the \"collaborative weaving of research and practice\" (Chambers et al., 2021, p. 1) has the potential to produce the knowledge and action needed for supporting actors in aquatic food systems. For research to be legitimate-defined as an ethical and fair process that genuinely includes and recognizes partners, and effective-defined as research that contributes to addressing problems and generating desired outcomes (CGIAR ISDC, 2021), an adjusted research practice is needed, one that builds on relationships of co-production that elevate local and indigenous control of natural resources."},{"index":3,"size":242,"text":"Finding a suitable \"mode\" for co-production is key to successful relationships, where a balance needs to be struck between risk and opportunities of co-production: for instance, scientific knowledge production can contribute to building capacity, addressing local needs, and influencing policy change, but can also crowd out other expertise such as local ecological and experiential knowledge (Chambers et al., 2021). Indeed, even in partnerships that coproduce knowledge, scientific and expert knowledge [knowledge that can only be produced and challenged by specialists (Ponte and Cheyns, 2013)] have been found prone to assuming a dominant role, thus tipping the balance of co-production (Offermans and Glasbergen, 2015). It cannot be assumed that synergies will automatically arise from collaboration in (aquatic) food systemsthere is no one suitable degree of participation in research, a level of co-production that guarantees optimal outcomes (Sumberg et al., 2003). Moving beyond simplistic views of co-production is necessary, with collaborators that span beyond traditional reaches of \"fisheries\" or \"aquaculture\" to include the wide variety of actors in aquatic food systems, e.g., non-governmental and community organizations, consumers and actors from related agri-food sectors. This wider collaboration is essential for reflection on the role of networks of actors in food systems transformation (Pound and Conroy, 2017;Klerkx and Begemann, 2020). And evaluating the legitimacy and effectiveness of such research should explicitly extend to the equity and justice implications of the research process and the adequacy of participation, to appreciate how outcomes are achieved and for whom."},{"index":4,"size":81,"text":"This paper is structured as follows. In the next section we outline the importance of cultivating partnerships in research, involving the right partners, and building meaningful relationships. We then focus on the role of partnerships in addressing systemic problems rather than achieving incremental change. We finish with a discussion of principles that researchers can use when establishing and maintaining partnerships for research, and how these practices can (and should) translate into reflexivity in research as well as evaluation of that research."}]},{"head":"Relationships in aquatic food systems research","index":2,"paragraphs":[{"index":1,"size":154,"text":"Unpacking the relational aspect of aquatic food systems and their dynamics can help navigate change within them while recognizing them as \"complex adaptive systems\" (CAS)-meaning that no one individual has full control over the system: rather, the patterns of interactions between individual actors are what bring about, or prevent, change (Brouwer et al., 2019). Aquatic food systems have been characterized as complex adaptive systems due to their ability to self-organize, learn and adapt (Mahon et al., 2008). As social-ecological systems, aquatic food systems display resilience when they can absorb human and ecological shocks by adapting while maintaining their function (Holling and Gunderson, 2002;Walker et al., 2004). It has been argued that to improve the capacity of food systems to change and adapt, more attention should be given to relationships and processes that bring about social change, rather than focusing solely on inputs and outputs to increase productivity and efficiency (Brouwer et al., 2019;Darnhofer, 2021)."},{"index":2,"size":197,"text":"Understanding how research-for-development fits into existing political, social, and economic contexts, and how it influences social change in CAS, can contribute to reaching goals of improving these systems and their resilience. However, outcomes of research are currently often measured with disregard for the complexity of relationships that played a role in the design, implementation and achieving results of the research (Douthwaite and Hoffecker, 2017). Indeed, at an ACIAR -hosted food system summit dialogue focusing on the foundations of successful research-for-development partnerships, Prof Andrew Campbell, the CEO of ACIAR, said that \"not enough is invested in the arrows. \" The arrows referred to are the links between building blocks in theories of change. He was arguing that evaluation of research for development programmes tends to focus on the blocks alone (the activities, outputs, and outcomes) ignoring the feedback networks in which they exist. Not investing in, or not investigating the arrows means the relational aspects that enable research to contribute to development outcomes go unsupported and unnoticed. One consequence of this omission is a failure to examine research partnerships and critically assess if they are fitfor-purpose, and under what conditions the desired impact may emerge from these partnerships."},{"index":3,"size":105,"text":"Cultivating equitable partnerships in research-for-development starts with a recognition of the context of the research, which is often colonial and Global North-as well as male-dominated, with associated power asymmetries (Snijder et al., 2023). Critically engaging with this context, along with investment (time, funding) in building and maintaining relationships, helps to place research partnerships within the wider system, which includes historic and contemporary inequities (Fransman et al., 2021). Working in partnerships, then, becomes an attitude or approach: one that embraces complexity caused by uncertainty, ambiguity and conflict inherent to human interaction (Mowles, 2014). Systems thinking and aiming for as much diversity as possible have been argued"},{"index":4,"size":8,"text":"Australian Centre for International Agriculture Research: https://www. aciar.gov.au."},{"index":5,"size":34,"text":"Frontiers in Sustainable Food Systems frontiersin.org to contribute to adequate inclusion of a variety of stakeholders in partnerships, whilst co-creation and shared language can contribute to mediating power asymmetries (Kaner, 2014;Brouwer et al., 2019)."},{"index":6,"size":270,"text":"Various frameworks are in use to assess the quality and outcomes of research-for-development. One example in the context of food systems research is the CGIAR Quality of Research for Development (QoR4D) framework. This evaluative framework uses four criteria to assess the extent to which research is contributing to development outcomes: relevance, scientific credibility, legitimacy, and effectiveness (CGIAR ISDC, 2021). Within this framework, experience of CGIAR leaders surveyed indicated that research legitimacy and effectiveness, key relational dimensions of the links between building blocks in theories of change, are found to be most challenging to operationalize in programs (ibid). The perceived difficulty of operationalising legitimacy and effectiveness indicates a need for practically incorporating notions of co-producing knowledge and paying deeper attention to power over priorities in partnerships. We propose that principles of participatory action research can support greater attention to the relational nature of researchfor-development, as a central dimension across both legitimacy and effectiveness (Apgar and Douthwaite, 2013). We contend that investing in the metaphorical arrows (the processes that tie together activities, outputs and outcomes) can improve the ethics and fairness of research and strengthen the legitimacy of research practices, thus making them more likely to be effective. This oftenoverlooked feature of research practices is foundational in food systems and has been identified as critical for the way that scaling is conceptualized and evaluated (Prain et al., 2020;Sartas et al., 2020). It places an emphasis on individual research behaviors and attitudes, because more equitable collaborations for legitimate programming involve the sharing of both risks and benefits in the partnership, bringing together researchers and other partners to shape the links between building blocks."}]},{"head":"Relationships and systemic problem-solving","index":3,"paragraphs":[{"index":1,"size":232,"text":"Considering the leading role of equitable partnerships in legitimate research, and the perceived challenges of operationalising legitimacy, a key question is how to ensure that the research process recognizes the interests, perspectives and contributions of partners as put forward in the QoR4D framework? Research has a vital role to play in rural development and food security, however, the pathways through which research can contribute to impact are long and complex (Horton and Mackay, 2003;Thornton et al., 2017). Research engages a multitude of actors throughout the knowledge production process-and is therefore inherently relational, whether co-productive or extractive. When the intention is to support outcomes for excluded and marginalized people, then relational approaches should support plural views and alternative pathways to emerge (Leach et al., 2010), including an acceptance of the tinkering process that actors within food systems engage in, with potential outcomes that are outside of conventional research-for-development (Douthwaite et al., 2017;Darnhofer, 2021). This becomes vital in the face of multiple pressures and pre-existing social injustices (such as colonialism, patriarchy, power asymmetries, corruption) facing people in aquatic systems (Gill et al., 2023), where an \"engineering mindset\" of scaling technologies [which tends to consider social problems as technical problems and leaves out politics and power as complicating factors (Laws et al., 2013)] is insufficient for resilience, and indeed when the aim to maintain the status quo could also mean perpetuating existing inequities (Darnhofer, 2021)."},{"index":2,"size":206,"text":"The complex problems of many systems, including aquatic food systems, have origins that go beyond disagreement and uncertainty; their origins include the systemic stability that can cause or perpetuate these problems (Arkesteijn et al., 2015). Systemic stability can take the shape of (formal and informal) rules and social practices, which can reproduce undesirable outcomes, such as poverty (Leeuwis et al., 2021). Because rules are aligned in the wider system, and social practices constitute networks of actors that are mutually dependent, the stability of the system is further entrenched (Arkesteijn et al., 2015). Tackling systemic stability as an avenue for system transformation requires a critical look at oneself and one's own role in partnerships, and partnerships themselves can provide a conducive environment for consideration of the position of the researcher and research organization in the wider landscape of food systems governance (Schwarz et al., 2021). Only through reflexivity of one's own position and the role of that position in maintaining systemic stability (and therefore the continued existence of complex problems) can legitimacy start to take shape, and eventually this may lead to research effectiveness in the sense that it solves the right problems, the origins of which lie in the stability of systems and associated power asymmetries."},{"index":3,"size":213,"text":"Addressing and shifting power relations between different actors in aquatic food systems is central to building partnerships for impact. Even when employing participatory approaches to research, participants may still experience the least benefit from the research. Learning can be bypassed through overreaching research methods by external experts that overlook rural people's experiences and knowledge for solution-oriented research (Chambers, 1994(Chambers, , 2014)). Indigenous researchers have highlighted how research has been exploitative of, and harmful to, the sovereignty and wellbeing of indigenous peoples, calling for use of indigenous methodologies to decolonize (e.g., Smith, 2021). Researchers in aquatic foods systems have pointed to gaps in research and practice related to gender and fisheries (Kleiber et al., 2015) and indigenous rights (Capistrano, 2010;Allison, 2011). More broadly, across development and conservation sectors, there is more explicit recognition of the need for processes like reconciliation, redress, revitalization of local practices and institutions to address power abuse and imbalances in research and practice (Armitage et al., 2019). When striving to improve equity and justice in aquatic food systems, doing research through equitable and just partnerships-the how-is just as important as the outcomes of such work-the what. We suggest that researchers start by examining their positionality whilst continually striving for a reflexive and accountable research practice individually and with their colleagues."},{"index":4,"size":363,"text":"For researchers, shifting research practice into more equitable forms can be challenged by academic definitions of excellent research (globally and academically relevant), which may or may not concur with research that is excellent at creating locally relevant and impactful change. While much research has both academic and practical applications, when the balance tips toward academic outputs it can result in deeply unfair practices that side-line local researchers and is inconsiderate to local partnerships (Braun, 2021;Watson, 2021). At the international level, there is a growing understanding that power imbalances influence the value given to different types of knowledge; \"parachute science\" defines a detached practice that overshadows national or localized research institutions that take subordinate roles in unfair arrangements. This requires active and meaningful collaboration to overcome (Asase et al., 2022), as well as a systemic change in research behaviors and attitudes within international research communities and structures that evaluate them. Whilst activities and outputs might carry scientific and/or policy credibility, it can take more time and effort for information and analysis to translate into impact in the communities or systems where the research takes place. These are the types of arrows that require investment through partnerships that (1) recognize and acknowledge gender, race, institutional and other power asymmetries; (2) actively work to address power asymmetries in both process and representation, and (3) seek to improve equity and justice in practice through policy and research use. However, current evaluation methods for quality of science tend to focus on progress along a linear pathway and against pre-determined quantifiable indicators (Douthwaite et al., 2017;Apgar et al., 2023), which separates legitimacy and scientific credibility. This focus on linear frameworks of evaluation means a lack of recognition of complexity and a lack of attention to the societal embeddedness of problems (Arkesteijn et al., 2015). In addition, short-term funding, and unrealistic expectations on the contribution of science to development have reduced the capacity to conduct strategic and transformative research (Leeuwis et al., 2018). Changes are needed to appreciate long-term investment the arrows of the system in which research and development are taking place, as it contributes to legitimacy, and therefore the quality of research, and should be evaluated as such."}]},{"head":"Equitable partnerships for transforming food systems: principles","index":4,"paragraphs":[]},{"head":"Partnerships that are equitable should allow for deliberation and continuous reflexivity on who decides what credible and legitimate research is. Who should do what, for what reason, and to","index":5,"paragraphs":[{"index":1,"size":100,"text":"what value? Continuously asking these questions is essential when striving to address the issues of legitimacy and effectiveness, and who decides whether these goals are achieved. As such, partnerships demand reflexivity on the role of values, beliefs, and practices (Locke et al., 2013), which is particularly relevant when operating within a results framework that demands (normative) development outcomes. If partnerships are to be helpful for addressing goals and issues that actors would not have been able to deal with on an individual basis (Glasbergen, 2011), then consideration of whose goals and issues are being addressed, and how, is needed too."},{"index":2,"size":264,"text":"Building on earlier research in aquatic food systems, we propose incorporating principles from action research that can help research-for-development to be implemented and understood as research-in-development (Douthwaite et al., 2017). This entails moving from transfer of technology to recognizing and working within the specific political and institutional contexts of aquatic food systems (Klerkx et al., 2012;Douthwaite et al., 2017). These principles are: ownership, equity, shared analysis, and feedback (Apgar and Douthwaite, 2013). Ownership refers to the vital role of participants in the research process, who define the problems to be addressed. Equity refers to recognizing and being mindful of who is in the partnership and who is not, how they participate, and what the power dynamics are. The dimensions of equity (recognition, procedural equity and distributional equity) have received attention in environmental justice research, but in conservation and development research, attention has been lacking, most notably on recognition and procedural equity (Friedman et al., 2018;Bennett et al., 2020). Shared analysis and data collection refers to joint responsibility of those involved, with the aim to improve understanding and action within aquatic food systems. Feedback refers to the process of sharing results to improve the potential of transformative learning. These principles contribute to the legitimacy of research-for-development by fostering genuine inclusion and recognition of partners, and to its effectiveness by improving the focus on real problems and desired outcomes (CGIAR ISDC, 2021). The principles also contribute to reorienting research from an engineering mindset toward an approach that recognizes and incorporates the beliefs, knowledge systems and power dynamics involved in transforming food systems (Leeuwis et al., 2021)."},{"index":3,"size":372,"text":"These principles are not new, and examples of approaches that employ them in aquatic food systems exist: a WorldFish programme ran between 2011 and 2015 in Bangladesh, Cambodia, Philippines, Solomon Islands and Zambia with a view to increase \"capacity to innovate in an equitable way\" for small-scale actors in aquatic agricultural systems (Douthwaite, 2016;Rice et al., 2019). This programme brought into practice principles of ownership, recognition and procedural equity, shared analysis and feedback through developing a shared problem definition and research protocol with small-scale fisheries and aquaculture operators, and through co-developing the capacity for these actors to analyse and interpret results. In addition, evidence from 11 cases in Africa, Asia and Latin America suggests that farmer-led research can increase the capacity to innovate through informal networks, not only by sharing research outcomes but also research approaches, thus applying principles of shared analysis, feedback and ownership in a terrestrial setting (Waters-Bayer et al., 2015). However, experiences from these programmes also suggest a difficult relationship with evaluation standards of research excellence. The science quality evaluation process assessed the WorldFish programme as doing too little to enable the traditional \"pipeline of biophysical technologies\" (Douthwaite, 2016, emphasis added). Similarly, the long-term and self-reinforcing impacts from farmer-led research were found to be missed by conventional impact evaluation (Waters-Bayer et al., 2015). These tensions may be caused by evaluation processes that gloss over social and institutional processes when analyzing technical innovations and practices (Meinzen-Dick et al., 2013). Indeed, this omission can mean that evaluation has a focus on the spread of technological outcomes, rather than the spread of processes and approaches that constitute the capacity to innovate (Waters-Bayer et al., 2015). Without explicit recognition of the research process and relationships, current criteria of research excellence and evaluation approaches miss opportunities for learning. Addressing these limitations, reflexive evaluation approaches scrutinize how research contributes to or fails to challenge systemic stability, e.g., through maintaining or not challenging \"existing, undesirable but normalized practices\" that cause lock-ins and path dependence as underlying causes of development challenges (Arkesteijn et al., 2015, p. 102). Evaluation that allows space for considering the assumptions underlying the representations of problems can contribute to a more culturally responsive evaluation practice and challenge taken-for-granted power configurations (Bacchi, 2009;Archibald, 2020)."}]},{"head":"Discussion: reflexivity and evaluation","index":6,"paragraphs":[{"index":1,"size":549,"text":"Meaningful relationships for research co-production in aquatic food systems require close examination of positionality of researchers and research organizations, but also institutional recognition of the importance of procedures for critically assessing one's own role. Both existing and new networks of relationships can influence power relations, research processes and the distribution of costs and benefits, and evaluation frameworks should recognize these dynamics. In particular, the goals of legitimacy and effectiveness, which were identified as requiring more effort to be truly incorporated into CGIAR research (CGIAR ISDC, 2021), could benefit from reflexivity in partnerships to continuously monitor CGIAR's position in partnership networks more broadly. Adaptive partnerships that evolve toward more equitable forms can contribute to keeping research-for-development fit for purpose, credible and effective, in addition to being meaningful and respectful (Schwarz et al., 2021). Outcomes of co-production have been shown to benefit significantly from collaborative design and practice, expert facilitation, a supportive context, adequate monitoring, and high levels of social cohesion and trust (Chambers et al., 2021). Thus, there are both pragmatic and moral incentives for legitimacy being achieved through focusing on relationships in researchfor-development programmes. By confronting all components of complex problems, from uncertainty to disagreement to the stability that maintains them, research should provide a learning environment that challenges the \"rules of the game, \" thereby opening up pathways for food actors to secure a place in the blue economy.  S., and Cheyns, E. (2013). Voluntary standards, expert knowledge and the governance of sustainability networks. Glob. Netw. 13, 459-477. doi: 10.1111/glob.12011 Pound, B., andConroy, C. (2017). \"Chapter 11-The innovation systems approach to agricultural research and development, \" in Agricultural Systems, 2nd ed., eds S. Snapp andB. Pound (Cambridge, MA: Academic Press), 371-405. doi: 10.1016/B978-0-12-802070-8.00011-6 Prain, G., Wheatley, C., Odsey, C., Verzola, L., Bertuso, A., Roa, J., et al. (2020). Development partnerships for scaling complex innovation: lessons from the Farmer Business School in IFAD-supported loan-grant collaborations in Asia. Agric. Syst. 182, 102834. doi: 10.1016Syst. 182, 102834. doi: 10. /j.agsy.2020.102834 .102834 Rice, M. J., Apgar, J. M., Schwarz, A.-M., Saeni, E., and Teioli, H. (2019). Can agricultural research and extension be used to challenge the processes of exclusion and marginalisation? J. Agric. Educ. Ext. 25, 79-94. doi: 10.1080/1389224X.2018.1529606 Sartas, M., Schut, M., Proietti, C., Thiele, G., and Leeuwis, C. (2020). Scaling readiness: science and practice of an approach to enhance impact of research for development. Agric. Syst. 183, 102874. doi: 10.1016Syst. 183, 102874. doi: 10. /j.agsy.2020.102874 .102874 Schutter, M. S., Hicks, C. C., Phelps, J., and Waterton, C. (2021). The blue economy as a boundary object for hegemony across scales. Mar. Policy 132, 104673. doi: 10.1016/j.marpol.2021.104673 Schwarz, A.-M., Eriksson, H., Ramofafia, C., Masu, R., Boso, D., Govan, H., et al. (2021). Three-decades of research integration-transforming to collaborative aquatic food systems research partnerships in the pacific. Front. Sustain. Food Syst. 5, 757407. doi: 10.3389/fsufs.2021.757407 Smith, L. T. (2021). Decolonizing Methodologies: Research and Indigenous Peoples. London: Zed Books Ltd. Snijder, M., Steege, R., Callander, M., Wahome, M., Rahman, M. F., Apgar, M., et al. (2023). How are research for development programmes implementing and evaluating equitable partnerships to address power asymmetries? Eur. J. Dev. Res. 35, 351-379. doi: 10.1057/s41287-023-00578-w Sumberg, J., Okali, C., andReece, D. (2003). Agricultural research in the face of diversity, local knowledge and the participation imperative: theoretical considerations. Agric. Syst. 76,[739][740][741][742][743][744][745][746][747][748][749][750][751][752][753].1016/S0308-521X(02)00153-1"}]}],"figures":[],"sieverID":"f6e03872-0999-4582-9ae4-cab0f1dd2120","abstract":"Competing interests in aquatic food systems pose challenges for small-scale food producers trying to secure their place in the blue economy. These challenges include development aspirations, pressure from conservation interests, climate and environmental change, and blue growth agendas. Research-for-development can contribute to improving outcomes for small-scale actors in aquatic food systems in the face of uneven development, but the legitimacy and e ectiveness of research have been found di cult to operationalize. An \"engineering mindset\" that prioritizes technical innovations, academic definitions of research excellence, unequal research collaborations, and funding constraints currently inhibit conducting strategic and transformative research. Taking ownership, equity, shared analysis, and feedback as key principles for research-in-development can assist in moving from transfer of technology to recognizing and working within the specific political and institutional contexts of aquatic food systems."}

data/part_2/048c30167f63c87e233a786fb3d5710a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"048c30167f63c87e233a786fb3d5710a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c5ee0a20-332a-45eb-bc88-d3b9292d019f/retrieve"},"pageCount":1,"title":"This policy guides the selection of countries to be included in USAID's Feed the Future initiative. IFPRI developed the three main indicators used for assessing country progress","keywords":[],"chapters":[],"figures":[],"sieverID":"0b59d436-cf4d-49df-9546-2e7f7f6f4647","abstract":""}

data/part_2/04ba59fe677c70d809b70c4d28e0471a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04ba59fe677c70d809b70c4d28e0471a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0c9450c2-e8df-4668-92d4-d2bd333028db/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":65,"text":"Tunisian agriculture has always tried to adapt to the increase in food demand for centuries, and the modes of agricultural production have been gradually transformed. Notably, agriculture was intensified, through productivist orientations, with increased land degradation. The opportunities of a sustainable development are more and more weakened. Focusing only on economically profitable agricultural systems has heavily aggravated the agro-environmental landscapes with increasing risks and uncertainties."},{"index":2,"size":67,"text":"The impact of agricultural activities on the environment and its less favorable consequences on resources such as land support and water resources are more harmful in mountainous areas than in the plains since mountain agriculture has specific characteristics: difficult natural environment related to altitude and climate, fragility of natural resources and land resources, the sharp decline in the number of farms due to social and geographical isolation."},{"index":3,"size":57,"text":"The management of natural resources or the farm management at the local level in the mountainous areas need a deep and specific analysis to study the social system (users, managers and governance institutions using technologies and infrastructures) who manage artificial and natural resources. Analyzing socioecological context allow encompassing the complexity of the social, ecological and socio-ecological interactions. "}]},{"head":"Method","index":2,"paragraphs":[{"index":1,"size":90,"text":"The study took place in the governorate of Siliana, in the delegation of kesra (figure 1), kesra is a part of upper semi-arid bioclimatic stage. The mountain of Kesra is located at an altitude of 1245 m is distinguished by its very uneven relief and soils and water resources (Abaza, 2021). The current vegetation cover of Kesra is a mosaic of plant units composed of floristic groups (rare, endemic and biodiversity-relevant species) of different ecological affinities interwoven into the landscape of the region (Abaza, 2021) and (Mars et al., 2009).   "}]},{"head":"Conclusion","index":3,"paragraphs":[{"index":1,"size":55,"text":"The heterogeneity of socio-ecological contexts in Kesra can make it difficult to develop effective environmental and sustainable development policies that meet local needs. Therefore, it is important to understand the complexity and diversity of socialecological contexts and to take these differences into account when planning and implementing environmental and sustainable development policies, in agroecology transition."},{"index":2,"size":70,"text":"However, it is important to note that the diversity of socioecological contexts can also lead to inequalities and conflicts between different communities and social groups. It is therefore essential to adopt an inclusive and participatory approach to environmental management and sustainable development, involving the various stakeholders in the decision-making and implementation processes. This means that environmental management and sustainable development strategies must be adapted to specific contexts to be effective.  "}]},{"head":"Discussion","index":4,"paragraphs":[]}],"figures":[{"text":" We followed four steps to get functional context socioecological types (fCSET): (I) Used Data, (II) Contextual Socio-Ecological Types identification, (III) Testing the Functionality of CSETs, and (IV) fCSET cartography.ResultsIn the delegation of Kesra, 13 fCSET were identified with a heterogeneous spatial distribution and different types (figure2). Heterogeneity of socioecological contexts refers to the variations that exist between different ecological and socio-economic contexts. These variations can be due to manyfactors, such as geography, climate, history, culture, economic and social structure (Abaza, 2021), (Alary et al., 2022), (Jorry et al.,2003) and (Abaza, 2016), Different contexts socio-ecological types have different characteristics, (figure 3 and 4) for an example of a dominant fCSET Cropland rainfed in marginalized and inaccessible dryland with an area equal to 4800 ha and fCSET Cropland rainfed with herbaceous cover in difficult mountainous sloping land with an equal to 1600 ha. CONTEXTUAL SOCIO-ECOLOGICAL TYPES IN KESRA Authors Zahra Shiri 1,2, Quang Le Bao 1, Aymen Frija 1 , Hichem Rejeb 2 1 International Center for Agricultural Research in the Dry Areas (ICARDA), Tunisia. 2 National Agronomic Institute of Tunisia INRGREF International Scientific Days 2023. 10 and 11 October, 2023 -Sciences City of Tunis, Tunisia. K-mean cluster analysis (K-CA) for classifying multidifference of an indicator (NPP mean and NPP slope) by factor (CSET) using ANOVA The NPP of ecosystems refers to the net content of dry organic matter produced by vegetation NPP = GPP -Ra (gC, surface-1, time-1) NPP = Net Primary Productivity GPP = Gross Primary Productivity Ra = Autotrophic respiration Functional contextual socio-ecologic types cartography using ArcView to represent the spatial distribution of different fCSET within the region. "},{"text":"Figure 1 . Figure 1. Geographical location of the study site (produced by QGIS) "},{"text":"Figure Figure 4. fCSET Cropland rainfed with herbaceous cover in difficult mountainous sloping land "},{"text":"• The landscape is defined by its diversity and complexity (Newman, 2019), many context specific conditions (Biophysical, accessibilities, population pressure, economic , development) impacts the effectiveness of different interventions, therefore identifying these conditions is crucial (Vera et al., 2022) for impact assessment and innovation scaling.• The context of the study area shows a high degree of diversity compared with other zones in the transect of Kef and Siliana which emphasizes the importance of taking into consideration this specificity during interventions' co-design process. • The results showed low net primary productivity (NPP), reflecting the scarcity of resources and the low dynamics of biodiversity. This can be explained by the high level of human appropriation, which creates high pressure on resources in the mountainous lands of Kesra and surroundings. "},{"text":"Figure 2 . Figure 2. Different contexts socio-ecological types in Kesra "},{"text":"Hence becomes the necessity to understand the global  landscape through different types of socio-ecological landscape through different types of socio-ecological context. Understanding these types is important for context. Understanding these types is important for developing effective strategies for sustainable developingeffectivestrategiesforsustainable development, conservation, and adaptation to development,conservation,andadaptationto environmental changes.    environmental changes.  "}],"sieverID":"e774a6c8-d36c-4e28-b9ab-c264b71754b3","abstract":"• This study is done in order to identify the different socio-ecological contextual types (CSETs), in the northwest of Tunisia, Kef and Siliana governorates.• Testing the functionality of these CSETs."}

data/part_2/0544c21a61448e866eba779346b649c5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0544c21a61448e866eba779346b649c5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ca9a523c-a794-4d75-9a86-03348327f1a2/retrieve"},"pageCount":51,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"•• Institut für Parasitologie und Tropenveterinärmedizin • Institut für Lebensmittelsicherheit undhygiene -FAO Zentrum VPH -AG Fleischhygiene -AG Internationale Tiergesundheit • NRL für koagulasepositive Staphylokokken einschließlich Staphylococcus aureus • NRL für Trichinella • NRL für Toxoplasmose • Tierärzte ohne Grenzen e.V. • Deutscher Akademischer Austauschdienst, The world academy of sciences (DFG, UNESCO) Deutsche Partnerinstitutionen: was wir schon tun (am Bsp. Uganda) Proben von rohem Schweinefleisch und Fliegen enthielten am häufigsten mit Salmonella enterica subsp. enterica • 55 Salmonella Isolate wurden in Berlin am FAO Reference Centre for VPH (FU Berlin) serotypisiert: 7 verschiedene Serovare • BfR und Herlinde Irsigler!!! • 98% der Isolate zeigten phänotypsiche Safe Food, Fair Food project IrishAid-funded MorePork project Technologie & Training: Biogas aus Schlachtabfällen Mobile SMS learning for pigs (mPig) • Research into use • Januar 2015 -September 2017 © Flickr/Jeff Haskins "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Tradition VPH in Deutschland & junger Schweinesektor in Ostafrika • Berufskrankheiten (z.B. Rotlauf), die in Deutschland längst kontrolliert sind, in Ostafrika erst auftauchen • Zoonosen, die traditionell wichtig für Deutschland waren (z.B. T. spiralis) und das Schwein in neuem Kontext in Ostafrika (Infektion mit T. nelsoni?) • Emerging infectious diseases mit globaler Wichtigkeit (z.B. Ebola in Hausschweinen, Uganda als Hotspot hämorrhagischer Fiebererkrankungen)  "}],"sieverID":"7c0bda7f-f4c4-46a3-b19e-4a1c5699cb99","abstract":""}

data/part_2/056a87e8973ee0c87f5b3061be8f049c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"056a87e8973ee0c87f5b3061be8f049c","source":"gardian_index","url":"https://apps.worldagroforestry.org/downloads/Publications/PDFS/PB21020.pdf"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":151,"text":"armyworm (Spodoptera frugiperda) is a pest native to the Americas. It was first detected in West Africa in 2016, before spreading rapidly across the continent. In its place of origin, the pest is able to feed on at least 350 plant species but preferentially eats cereals, like maize and sorghum. In Southern Africa, fall armyworm poses a threat to the food security and income of millions of smallholders who depend on these staples. In response to the arrival of fall armyworm, regional governments have spent huge sums of money donating chemical pesticides to poor farmers. These chemicals have been donated without consideration of the impact on human health and the environment and, in many cases, the pesticides are not even effective against fall armyworm. Highly toxic pesticides disproportionately impact natural enemies and, hence, their use risks eliminating natural enemies and creating a dependency on chemical pesticides that smallholders can ill afford."}]},{"head":"Health risks of chemical pesticides","index":2,"paragraphs":[{"index":1,"size":187,"text":"Sub-Saharan Africa is experiencing an epidemic of pesticide abuse1. Smallholders often spray highly toxic chemicals without protective clothing or attention to other safety measures, such as appropriate dilution rates, field re-entry periods, pre-harvest intervals and safe disposal of used containers. A number of highly hazardous chemicals that are banned in the United States or Europe are readily available on agro-dealer shelves throughout the region (Table 1). Farmers frequently apply these and other highly toxic chemicals using backpack sprayers without protective clothing or face-masks. Women and children work in recently sprayed fields, thereby exposing themselves to the risks of inhaling these dangerous chemicals. Sprayers are rinsed out close to wells or boreholes and the containers may even be reused for drinking water. Research in West Africa found that smallholders had high levels of exposure to multiple pesticide components2. A World Health Organisation report3 estimated that in 2016 over 150,000 deaths and over 7 million disability-adjusted lifeyears from pesticide self-poisoning could have been avoided by sound pesticide management. Chronic exposure to these chemicals causes sexual impotence, organ failure and cancers. Many formulae are known to impair development in children."},{"index":2,"size":24,"text":"Government donations of highly toxic chemicals without appropriate safety equipment and training only serves to promote pesticide abuse and exacerbate health and environmental risks. "}]},{"head":"Environmental risks of chemical pesticides","index":3,"paragraphs":[{"index":1,"size":84,"text":"Use of chemical pesticides carries with it serious environmental risks, including impacts on pollinators, insecteating birds and other vertebrates, and aquatic life. Most importantly, numerous studies have shown that highly toxic pesticides kill natural enemies, including parasitoids and predators. Often the impact on natural enemies is greater than on the pest, which can lead to pest populations rebounding after spraying. Long-term pesticide use leads to an impoverishment of the natural enemy community and forces farmers to invest more and more in chemical pest control."},{"index":2,"size":31,"text":"It is essential that control of fall armyworm does not undermine smallholders' pest-control strategies, including for stem borer and other armyworm species, which depend to a large extent on natural enemies."}]},{"head":"Integrated pest management","index":4,"paragraphs":[{"index":1,"size":176,"text":"Integrated Pest Management (IPM) is an approach that promotes preventative steps and reserves the use of chemical pesticides as a measure of last resort. It is based on the concepts embedded in an integrated pest management pyramid (Figure 1). At the base of the pyramid are the preventative steps, including agro-ecological approaches that increase the diversity, abundance and efficacy of natural enemies. These include crop diversification (for example, crop rotation and agroforestry), intercropping -which not only provides more habitat for natural enemies but also disrupts pest host plant selection -and protection of natural and semi-natural habitats on farms and at landscape scale4. Numerous studies have demonstrated that diverse field margins and patches of natural habitat enhance pest control via natural enemies. Also included at the base of the pyramid are measures that promote plant health through integrated soil fertility management, such as crop rotation, minimum tillage and mulching (also known as conservation agriculture), selection of quality seeds, including pest-tolerant varieties, and biological control involving the rearing and release of specific natural enemies to enhance pest control. "}]}],"figures":[{"text":"  "},{"text":"Table 1 : Classification of pesticides in common use in Africa against fall armyworm by hazard to health and efficacySource: Reproduced from Jepson et al1     Efficacy unknown Poor-to-fair efficacy Good-to-excellent efficacy Efficacy unknownPoor-to-fair efficacyGood-to-excellent efficacy   (<70% to <80% control) (80-100% control) (<70% to <80% control)(80-100% control) Highly hazardous pesticides Fipronil, methamidophos, Carbofuran, carbosulfan Beta-cyfluthrin, cyfluthrin, Highly hazardous pesticidesFipronil, methamidophos,Carbofuran, carbosulfanBeta-cyfluthrin, cyfluthrin,  monocrotophos, phorate (obsolete substance), methomyl monocrotophos, phorate(obsolete substance),methomyl   dichlorvos, imidacloprid,  dichlorvos, imidacloprid,   thiamethoxam, trichlor-  thiamethoxam, trichlor-   phon  phon High-risk pesticides to health Cartap hydrochloride Abamectin, benfuracarb, Acephate, gamma-cyhalo- High-risk pesticides to healthCartap hydrochlorideAbamectin, benfuracarb,Acephate, gamma-cyhalo- and environment requiring max-  carbaryl, chlorpyrifos, thrin, lambda-cyhalothrin, and environment requiring max-carbaryl, chlorpyrifos,thrin, lambda-cyhalothrin, imum PPE with engineering and  diazinon, dimethoate, cypermethrin, deltamethrin, imum PPE with engineering anddiazinon, dimethoate,cypermethrin, deltamethrin, behavioural mitigations  fenitrothion, malathion, diflubenzuron, emamectin ben- behavioural mitigationsfenitrothion, malathion,diflubenzuron, emamectin ben-   pirimiphos-methyl, pro- zoate, fenvalerate pirimiphos-methyl, pro-zoate, fenvalerate   fenofos, thiocarb  fenofos, thiocarb High-risk pesticides to health Pyridalyl Acetamiprid Bifenthrin, alpha-cypermethrin, High-risk pesticides to healthPyridalylAcetamipridBifenthrin, alpha-cypermethrin, and environment requiring dou-   beta-cypermethrin, indoxacarb and environment requiring dou-beta-cypermethrin, indoxacarb ble-layer PPE and either eye or    ble-layer PPE and either eye or respiratory protection or both    respiratory protection or both Lower risk pesticides to health ... ... Lufenuron, novaluron, spine- Lower risk pesticides to health......Lufenuron, novaluron, spine- requiring single-layer PPE but   toram, spinosad, teflubenzuron, requiring single-layer PPE buttoram, spinosad, teflubenzuron, high environmental risk   triflumuron high environmental risktriflumuron Lower risk pesticides to health Pyriproxifen Bacillus thuringiensis Azadirachta indica, Bacillus Lower risk pesticides to healthPyriproxifenBacillus thuringiensisAzadirachta indica, Bacillus and environment requiring sin-  serovar kurstaki, Beauve- thuringiensis serovar aizawai, and environment requiring sin-serovar kurstaki, Beauve-thuringiensis serovar aizawai, gle-layer PPE  ria bassiana, Metarhizium chlorantraniliprole, fluben- gle-layer PPEria bassiana, Metarhiziumchlorantraniliprole, fluben-   anisopliae diamide, methoxyfenozide, anisopliaediamide, methoxyfenozide,    Spodoptera frugiperda nuclear Spodoptera frugiperda nuclear    polyhedrosis virus (SfNPV), polyhedrosis virus (SfNPV),    pyrethrum pyrethrum  "},{"text":" Mulching crop residues improves soil and provides habitat for insect predators; (3) Inter-crops improve soil fertility and diversifies the field environment; (4) Shrubs with flowers support populations of parasitic wasps; (5) Trees provide perches and roosts for birds and bats; (6) Crop rotation improves soil fertility management and diversifies the farm environment; (7) Scouting to identify pests and assess damage enables informed pest management decisions; (8) and (9) Diverse field margins provide habitat for predators; (10) Insectivorous birds and bats reduce pest abundance in diverse agro-ecological systems; (11) Insect hotel for predatory wasps; (12) Predatory wasp. Source: Harrison et al 2019 4 Figure 2: Agroecological approaches are low-cost options Figure 2: Agroecological approaches are low-cost options that farmers can use to manage fall armyworm. Some agro- that farmers can use to manage fall armyworm. Some agro- ecological approaches to pest management: (1) Minimum ecological approaches to pest management: (1) Minimum soil disturbance enhances biological properties of soil; (2) soil disturbance enhances biological properties of soil; (2) The next layer on the pyramid involves monitoring pest The next layer on the pyramid involves monitoring pest abundance, through scouting fields and pheromone traps, abundance, through scouting fields and pheromone traps, so that pest-management decisions are based on accurate so that pest-management decisions are based on accurate and timely information. Finally, if through monitoring it is and timely information. Finally, if through monitoring it is deemed necessary to employ further control measures, deemed necessary to employ further control measures, emphasis is placed on further biological control options (for emphasis is placed on further biological control options (for example, pest fungal or viral pathogens, such as Bacillus example, pest fungal or viral pathogens, such as Bacillus thuringiensis or Spodoptera frugiperda nuclear polyhedrosis thuringiensis or Spodoptera frugiperda nuclear polyhedrosis virus (SfNPV)) or low toxicity and, ideally, high specificity virus (SfNPV)) or low toxicity and, ideally, high specificity pesticides (for example, Azadirachta indica or) so as to avoid pesticides (for example, Azadirachta indica or) so as to avoid negative impacts on natural enemies and other components negative impacts on natural enemies and other components of farmland biodiversity, such as pollinators. Recent studies in of farmland biodiversity, such as pollinators. Recent studies in Ethiopia found that botanicals based on Azadirachta indica, Ethiopia found that botanicals based on Azadirachta indica, Schinnus molle and Phytolacca dodecandra have all provedn Schinnus molle and Phytolacca dodecandra have all provedn as effective against fall armyworm as the best chemical as effective against fall armyworm as the best chemical pesticides 5 , hence there is really no justification for using more pesticides 5 , hence there is really no justification for using more toxic chemical pesticides, which pose a risk to farmers' health toxic chemical pesticides, which pose a risk to farmers' health and the environment. and the environment.  "}],"sieverID":"790aea1c-a830-4b72-beeb-a064a33b4ebd","abstract":"1. Eliminate donations of chemical pesticides and alternatively consider supporting programs for biological control or production of botanicals or biological pesticides based on pathogenic fungi or viruses.2. Ban highly hazardous pesticides and improve regulation of highly toxic pesticides, including effectively restricting their use. Meanwhile, fast track the approval of safe botanicals and biological pesticides.3. Remove highly hazardous and highly toxic pesticides from input subsidy programs and replace them with botanicals and biologicals, or biological control options.4. Train agricultural extension workers to monitor pests via field scouting and on educating farmers about the importance of preventative measures including appropriate soil-fertility management, selection of seeds and agroecological approaches.5. Enhance education and training concerning the use of chemical pesticides and improve regulation of spraying to protect rural communities, especially children, and the environment."}

data/part_2/05a787afe280083f00c382b77b0bcd8c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05a787afe280083f00c382b77b0bcd8c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1afe7847-a6e8-45f5-949f-36f0e9a8d05d/retrieve"},"pageCount":3,"title":"Index in Maikona based on data up to 19-31 Dec","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":" Figure 1. ZNDVI in Maikona from March 2010 to February 2011 "},{"text":"Table 2    . zndvi  . zndvi year month 16-day date zndvi year month 16-day datezndvi 2010 3 5 6-21 Mar 1.38 2010 356-21 Mar1.38 2010 3 6 22 Mar -6 Apr 1.62 2010 3622 Mar -6 Apr 1.62 2010 4 7 7-22 Apr 0.97 2010 477-22 Apr0.97 2010 4 8 23 Apr -8 May 0.11 2010 4823 Apr -8 May 0.11 2010 5 9 9-24 May -0.36 2010 599-24 May-0.36 2010 5 10 25 May -9 Jun -0.40 2010 51025 May -9 Jun -0.40 2010 6 11 10-25 Jun -0.18 2010 61110-25 Jun-0.18 2010 7 12 26 Jun -11 Jul -0.40 2010 71226 Jun -11 Jul -0.40 2010 7 13 12-27 Jul 0.13 2010 71312-27 Jul0.13 2010 8 14 28 Jul -12 Aug -0.21 2010 81428 Jul -12 Aug -0.21  "}],"sieverID":"c7160b39-f432-43b3-8bac-94dded889cab","abstract":""}

data/part_2/05af35bc7cb2d67031f18aee559ec2f7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05af35bc7cb2d67031f18aee559ec2f7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0715062f-4a3e-4a32-88f6-f59dbc397905/retrieve"},"pageCount":24,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":15,"text":"To assess the possible sources of microbial contamination of milk from farm to consumer 2."},{"index":2,"size":17,"text":"To establish total plate count of bacteria and coliforms in milk from Lushoto and Handeni districts 3."},{"index":3,"size":74,"text":"To establish the prevalence of Escherichia coli O157:H7 and Brucella abortus in milk using polymerase chain reaction  Detection of E. coli using O157-3 and O157-4 primer pairs targeting hyla A between at 356 bp. Note that lane M is a molecular weight marker, lane A to K are negative amplicons while lane L is a positive control  Veterinary/extension services should be provided to livestock farmers on proper animal husbandry and control of diseases."},{"index":4,"size":26,"text":" Responsible authorities must ensure that existing regulations are instituted and where possible there should be a mandatory screening of milk before sales to the public."},{"index":5,"size":11,"text":" Consumer practices such as milk boiling should be further encouraged."},{"index":6,"size":17,"text":" Further study to relate the findings with human brucellosis in that area should be carried out. "}]}],"figures":[{"text":" Food-borne diseases are a threat and are responsible for 33-90% cases of mortality to children  Bacterial milk contamination causes: • Milk spoilage • Milk-born zoonotic diseases  Up to 90% diary related diseases are due to pathogenic bacteria from milk  Dairy industry in most African countries is dominated by unpasteurized milk and informal markets  PCR is a technique which utilizes primer sets to detect presence of pathogens in a sample  Risks of milk safety hazards in informal market are high and unknown in Tanzania  Previous studies have been on the specific risks associated with pathogenic microbes along the milk chain (e.g. Swai and Schoonman 2011; Kaiza et al. 2011)  PCR detection of milk bacterial contaminants is powerful, gives reliable information on pathogens in milk  Results of the study will be used to improve food safety throughout smallholder and informal milk value chain in Tanzania Main Objective: To assess milk handling practices, bacterial contamination and determine selected milk borne zoonotic pathogens along the dairy value chain in Lushoto and Handeni districts of Tanga region Specific objectives: 1. "},{"text":"Study area : Tanga region of the North-eastern part of Tanzania Why Tanga?: Well coordinated dairy value chain • Long history of smallholder dairy farming organized under TDCU • Well developed TFL, one of the biggest supplier of processed milk in Tanzania Study design o A cross-sectional study Study area  A total of 93 (65 farmers, 28 retailers) interviewed  A total of 166 milk samples from farmers, vendors, restaurants/kiosks, collection centres and consumers Chains identified-Lushoto district 1. "},{"text":" Poor hygienic practices at milking and selling places contributes to increase in microorganisms  Lack of knowledge on zoonotic diseases and their causes in farmers contributed to poor unhygienic practices in milky activities  The prevalence of B. abortus suggests high contamination rate-relates to findings bySchoonman and Swai (2005)     "},{"text":" The Federal Ministry for Economic Cooperation and Development, Germany through the Safe Food, Fair Food project  Sokoine University of Agriculture (SUA)  International Livestock Research Institute (ILRI)  AITVM "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Total plate counts and coliform plate counts for milk actors in the chains Detection of B. abortus by PCR using BRU P5 and BRU P8 primer pairs targeting 16S-23S gene at between 500 to 600 bp. Note that lane M is a molecular weight marker while lanes A, C, D, E, F, G, H, J, K, M, O, P and Q are positive amplicons whereas lane B, I, L and N are negative amplicons. R is a positive control. Farmer Consumer Chains identified -Handeni district 1. Farmer Consumer Escherichia coli O157:H7 (O157-3 and O157-4) Microbiological isolation, PCR and statistical data analysis (stata IC 11) Variable Category General practices during milking storage and delivery Milk marketing channels Positive samples for B. abortus in Lushoto and No. (%) farmers respondents Sources of water Tap 26 (40.0) Handeni districts Farmer Consumer Chains identified -Handeni district 1. Farmer Consumer Escherichia coli O157:H7 (O157-3 and O157-4) Microbiological isolation, PCR and statistical data analysis (stata IC 11) Variable Category General practices during milking storage and delivery Milk marketing channels Positive samples for B. abortus in Lushoto and No. (%) farmers respondents Sources of water Tap 26 (40.0) Handeni districts 2. 3. 4. 5. 6. 7. 8. 2. Farmer Farmer Sub Col centre (no chilling ) CC(chilling) Factory Farmer CC(chilling) Factory Farmer CC Consumer Farmer CC Restaurant/kiosk Consumer Consumer Consumer Farmer Selling point Consumer Farmer Restaurant Consumer Farmer/Processor Consumer Vendor Wells 21 (32.3) Consumer 3. Farmer Vendor Dams and/or streams 19 (29.3) Source of Cleaning animal shed before Collection Centre Factory consumer 4. Farmer Collection centre consumer 5. Farmer Vendor Brucella abortus (BRU P5 and BRU P8 ) milking 28 (43.1) Wash hands before milking 46 (70.7) Variable Observation s Mean (log10 Std. Dev Min Max 42% positive milk samples Lushoto (%) Both districts (%) Handeni (%) (log10) Milking practices Wash cow's teats before milking cfu/ml) Consumers (2.2) (9.5) (5.7) 41 (63.1) Wash hands after milking Total Plate Count 47 (72.3) wide necked aluminium vessel 2 (03.1) Farmers 21 5.3 5.4 3.3 5.8 Restaurant (4.4) (4.6) (4.8) Restaurant Containers used for milk storage 56 (86.1) Vendors 5 5.8 5.7 4.6 6.1 Wide necked plastic vessel Used water and oil bottles 6 (09.2) Cooking pan \"sufuria\" 1 (01.5) Restaurants 7 4.9 4.9 0 5.3 Coliform plate count Farmers (31.1) (28.7) (26.2) Consumer Containers used for delivery/transportation wide necked aluminum vessel 0 (0.0) Wide necked plastick vessel Farmers 22 4.8 4.9 2.5 5.5 Vendors -(4.6) (7.1) 38 (58.5) Used water and oil bottles 8 (12.3) Cooking pan \"sufuria\" 3 (4.6) Vendors 4 4.8 5.1 3.3 5.4 Restaurants 7 3.6 3.9 0 4.3 600 bp 500 bp 600 bp 500 bp Total (37.8) (47.6) (42.5) 2. 3. 4. 5. 6. 7. 8. 2. Farmer Farmer Sub Col centre (no chilling ) CC(chilling) Factory Farmer CC(chilling) Factory Farmer CC Consumer Farmer CC Restaurant/kiosk Consumer Consumer Consumer Farmer Selling point Consumer Farmer Restaurant Consumer Farmer/Processor Consumer Vendor Wells 21 (32.3) Consumer 3. Farmer Vendor Dams and/or streams 19 (29.3) Source of Cleaning animal shed before Collection Centre Factory consumer 4. Farmer Collection centre consumer 5. Farmer Vendor Brucella abortus (BRU P5 and BRU P8 ) milking 28 (43.1) Wash hands before milking 46 (70.7) Variable Observation s Mean (log10 Std. Dev Min Max 42% positive milk samples Lushoto (%) Both districts (%) Handeni (%) (log10) Milking practices Wash cow's teats before milking cfu/ml) Consumers (2.2) (9.5) (5.7) 41 (63.1) Wash hands after milking Total Plate Count 47 (72.3) wide necked aluminium vessel 2 (03.1) Farmers 21 5.3 5.4 3.3 5.8 Restaurant (4.4) (4.6) (4.8) Restaurant Containers used for milk storage 56 (86.1) Vendors 5 5.8 5.7 4.6 6.1 Wide necked plastic vessel Used water and oil bottles 6 (09.2) Cooking pan \"sufuria\" 1 (01.5) Restaurants 7 4.9 4.9 0 5.3 Coliform plate count Farmers (31.1) (28.7) (26.2) Consumer Containers used for delivery/transportation wide necked aluminum vessel 0 (0.0) Wide necked plastick vessel Farmers 22 4.8 4.9 2.5 5.5 Vendors -(4.6) (7.1) 38 (58.5) Used water and oil bottles 8 (12.3) Cooking pan \"sufuria\" 3 (4.6) Vendors 4 4.8 5.1 3.3 5.4 Restaurants 7 3.6 3.9 0 4.3 600 bp 500 bp 600 bp 500 bp Total (37.8) (47.6) (42.5)  Others e.g traditional pots 16 (24.6) Others e.g traditional pots16 (24.6)  On foot 37 (56.9) On foot37 (56.9) Means of delivery By bicycle 9 (13.8) Means of deliveryBy bicycle9 (13.8)  By motorcycle 3 (4.6) By motorcycle3 (4.6)  "}],"sieverID":"c99aa590-f7bd-4569-9e6b-5f9591a64eda","abstract":""}

data/part_2/05bac6e0cd7d6e9f32f615385a211a90.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05bac6e0cd7d6e9f32f615385a211a90","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/18ab212a-93e9-4c93-906c-ca1b700c3757/retrieve"},"pageCount":7,"title":"Creating Wealth from Waste: Resource Use Efficiency in Climate-Smart Agriculture Findings from interviews with vermiculture farmers in Ha Tinh Province","keywords":[],"chapters":[{"head":"Overview","index":1,"paragraphs":[{"index":1,"size":69,"text":"It is increasingly urgent to support sustainable agroecosystems which optimize symbiotic interactions and productivity. Resources must be used efficiently within the agricultural system to minimize artificial or external inputs and their associated emissions, as well as costs to the farmer. However, past studies indicate that technology alone cannot sufficiently induce farmers to adopt sustainable production systems; additional economic incentives are necessary to foster technological change (Kruseman and Bade 1998)."},{"index":2,"size":96,"text":"Climate-Smart Agriculture (CSA) denotes a set of practices developed to increase both productivity and resiliency in the face of a changing climate (FAO 2010). Widespread changes in rainfall and temperature patterns impact agricultural production and farmers' livelihoods (Lipper et al. 2014). CSA practices are developed in partnership with local farmers and communities at risk of extreme weather events due to climate change, and are designed to synergistically address productivity, climate change adaptation and mitigation (Campbell and Dinesh 2017). This integrated approach aims to maximize multiple outcomes of food security, adaptation and mitigation (Lipper et al. 2014)."},{"index":3,"size":79,"text":"This study is an attempt to assess the economic and ecological benefits farmers in My Loi experienced from the adoption of vermiculture. Elucidating the quantitative and qualitative benefits of vermiculture can motivate broader adoption and scaling of this climate-smart practice. Using vermiculture as a case study, the multivariate positive benefits yielded from resource cycling within the farm system were explicated. By improving resource cycling on the farm, farmers can maximize efficiency and become more resilient both economically and environmentally."}]},{"head":"Vermiculture as a Climate-Smart Practice","index":2,"paragraphs":[{"index":1,"size":144,"text":"Vermiculture is a process in which worms convert manure into compost. Described by Darwin as \"intestines of the earth\" (Darwin 2002), earthworms and microbes accelerate the decomposition of crop materials and organic waste from livestock to generate vermicompost, a nutritive soil amendment. Earthworms aerate, grind, and mix waste components, in addition secreting enzymes and other chemicals which speed up biochemical degradation processes (Sinha et al. 2002). Vermiculture also functions as a worm production system, yielding outputs which can be sold or used as poultry feed. By utilizing the resources already present on the farm and reducing reliance on external inputs, farmers diversify risks. Resource cycling allows for increased stability and resilience in the context of fluctuating market valuations and weather patterns. The creation of a circular farm metabolism is ecologically restorative, and also yields economic returns for the farmers in direct and indirect ways."}]},{"head":"Figure 1. Input and output flows related to vermiculture in an integrated farm system","index":3,"paragraphs":[{"index":1,"size":73,"text":"The vermiculture systems studied used Perionyx excatatus, one of the most versatile earthworm species and common in tropical Asia. Perionyx excavatus requires warm, moist environments to thrive (Hallatt, Viljoen, and Reinecke 1992), and is particularly well-suited for breaking down organic waste materials (Edwards, Dominguez, and Neuhauser 1998). In particular, cattle and pig manure has been shown to yield the best results for growth and reproduction of this species (Edwards, Dominguez, and Neuhauser 1998)."},{"index":2,"size":125,"text":"A CSA approach considers the farm and landscape holistically with the goal of facilitating short and long-term ecological sustainability. Climate-smart practices can synergistically address agricultural productivity, adaptation, and mitigation to improve livelihoods and resilience in the face of a changing climate. Vermiculture has the potential to address each of these CSA pillars. § Productivity: increased agricultural productivity which results from vermicompost soil enrichment is directly linked with food security, and livelihood benefits result from the economic opportunities of worm sales; § Adaptation: vermicompost can improve fertility and moisture-holding capacity, which are essential for adaptation. Resource-use efficiency and system integration improve farmers' economic resiliency; § Mitigation: greenhouse gas emission reductions are achieved through reduced use of fossil fuel-based fertilizers or raw application of manure to fields."},{"index":3,"size":92,"text":"Considering the agricultural production within an ecosystem framework opens up possibilities for cyclical resource analysis and increased efficiency (Fan et al. 2011). This perspective explores the utilization of outputs from one farming practice to become inputs for another, thereby reducing waste as well as external resource dependency. The value of CSA is optimized when multiple practices implemented in tandem, mirroring a symbiotic ecological system. In this way, the resources on the farm are designed to mimic viable ecosystems, yield positive economic and ecological outcomes, and improve the resiliency of the farm system."},{"index":4,"size":42,"text":"These outcomes are particularly aligned with United Nations Sustainable Development Goals (SDGs) 13 and 15. SDG 13 focuses on strengthening adaptive capacity to climate-related hazards and natural disasters, and SDG 15 advocates for sustainable management of soil and water resources (Sustainabledevelopment.un.org 2015)."}]},{"head":"Methodology","index":4,"paragraphs":[{"index":1,"size":105,"text":"A secondary data and literature review was conducted to review ICRAF field notes from previous interactions with farmers, as well as the scope of available material on small-scale vermiculture. Primary economic and qualitative data was collected in My Loi village, Ha Tinh province, Vietnam. A quantitative analysis calculated costs and benefits from the initial year of vermiculture establishment. Initial investments, maintenance, inputs into the vermiculture system, and quantifiable outputs were taken into account. Labor for the farmers was valued at VND 120,000 per day (ICRAF 2003). The weight of each worm was estimated at 0.5 grams, based on available literature (Sinha, Agarwal, et al. 2010)."},{"index":2,"size":14,"text":"According to interview data, farmers receive VND 10,000 per kilogram of worms with substrate."},{"index":3,"size":101,"text":"This financial breakdown was developed for one hundred chickens, ducks, and geese, in order to compare the value of worm feed for various poultry. However, the majority of farmers interviewed raised a combination of birds. Two farmers managed 4 m 2 worm enclosures, and the third has expanded to 8 m 2 bed since initial adoption two years ago. The initial investment from ICRAF was 50 kg of worms and substrates. Based on previous data collection from ICRAF, worm density in the 4 m 2 bed ranges from 32-48 kg with substrates, and 64-96 kg in the 8 m 2 enclosure."},{"index":4,"size":96,"text":"A qualitative assessment synthesized other benefits associated with vermiculture based on farmer's experiences and available literature. Three farmers were selected for interviews based on their experience practicing vermiculture. Two of the farmers interviewed have been practicing vermiculture for two years, and the other farmer adopted the practice one year ago. One farmer received the initial worms from ICRAF, and the others began practicing vermiculture with worms shared from another farmer. This participant selection was intended to provide data on scaling and farmer-to-farmer social sharing, as well as experience and outcomes for vermiculture in the initial year."},{"index":5,"size":52,"text":"Costs and benefits associated with vermiculture or other CSA practices depend on numerous factors, such as the scale of implementation, farm size, and agricultural practices. The economic values associated with this study are indicative, of the specific conditions for respondents, as farmers' costs vary according to market opportunity, scale, and biophysical features."}]},{"head":"Results","index":5,"paragraphs":[{"index":1,"size":62,"text":"Vermiculture practice can yield significant economic returns for farmers in the initial year of implementation and beyond. The fixed costs of vermiculture include initial investment and maintenance of the system, and economic benefits are realized from direct worm sales and worms as a food supplement for animals. Noneconomic benefits for agricultural productivity and soil health are other important outcomes of vermiculture practice."}]},{"head":"Economic Costs and Benefits","index":6,"paragraphs":[]},{"head":"Implementation and maintenance","index":7,"paragraphs":[{"index":1,"size":77,"text":"In order to initiate a vermiculture system, a worm enclosure must be built. Construction materials already available on the farm can be used, such as bamboo and palm fronds, hence no additional financial investment is required. In terms of labor, construction takes a half day, which equates to about VND 60,000 in fixed costs. With initial infrastructure in place, the vermiculture system is designed to function continually with consistent maintenance and inputs of manure and crop residue."},{"index":2,"size":119,"text":"Though not included in this calculation, water may need to be added if periods of drought ensue to maintain the moisture level of the worm habitat, which is optimum at 76-83% moisture level (Hallatt, Viljoen, and Reinecke 1992). Farmers ensure the appropriate moisture levels by holding the substrate; if too much water runs out, the substrate is too wet, and if it is too dry, the substrate will break apart easily. According to interview data, the upkeep associated with vermiculture requires one hour every other day for turning, watering, and feeding the worms. Maintenance time remains consistent regardless of the enclosure size. This average labor value can be estimated at VND 7,500 per day, or VND 2,737,000 per year."}]},{"head":"Poultry Feed","index":8,"paragraphs":[{"index":1,"size":97,"text":"In addition to vermicompost, the vermiculture system produces a growing population of earthworms which can be used for animal feed. Earthworm protein content ranges from 58-71% dry weight, and contains amino acids essential for animal diets (Sabine 1978). Previous studies have cited weight gains and higher survival rates for earthworm-fed quail (Guerrero 1983), indicating that earthworms provide a nutritionally beneficial supplement in animal feed (Sabine 1978). The three farmers interviewed all utilized worms as feed for chickens, ducks, and geese. Tables 1 and 2 break down interview data on how worms were utilized to supplement poultry diets."}]},{"head":"LOCATION AND CLIMATE ADAPTATION","index":9,"paragraphs":[{"index":1,"size":211,"text":"Worms metabolism rates are optimized between 25-30˚C (Edwards, Dominguez, and Neuhauser 1998), and 76-83% moisture content (Hallatt, Viljoen, and Reinecke 1992). Hence, the location of vermiculture beds must be considered with regards to potential weather events, climate and biophysical conditions. § Worm enclosures should not be constructed close to ponds, as ponds provide habitat for many worm predator species such as frogs and snakes. § The shade of home garden trees can help regulate micro-climate variation to keep a stable environment for the worms. Nearby trees and a roof of palm leaves provide shade and protect from rain while maintaining moisture levels. Farmers should be aware of potential breaking trees during storms that may damage the enclosure roof. § Farmers can add a mulch of palm leaves, cardboard, or other available materials to avoid direct sunshine or winds and associated moisture loss. § When temperatures dip to between 15˚C or below, worm reproduction significantly slows (Edwards, Dominguez, and Neuhauser 1998). § During days when temperatures are over 40˚C, the bed can be cooled by watering. § Positioning the bed on an elevated bed or slope where water can be diverted can help avoid floods. § Vermiculture systems can also be established under more controlled environments, such as indoors, on cement floors."}]},{"head":"Table 1. Daily poultry feed details for each farmer Table 2. Number and average weight of worm feed","index":10,"paragraphs":[{"index":1,"size":109,"text":"The farmers observed many beneficial effects from this additional protein source, including faster growth, smoother feathers, and less prone to disease. All farmers noticed a five percent increase in egg hatching rate after integrating worms into the animal diets. Additionally, the eggs from poultry fed with worms contained larger, darker yolks. The farmers perceived the darker color as indicative of more nutritious eggs, a belief which is also held among consumers in many markets willing to pay a premium for darker yolks (Stadelman 1999). However, yolk color is influenced by a number of other factors and there is no conclusively direct link to nutritional value (Baker and Günther 2004)."}]},{"head":"Worm Sales","index":11,"paragraphs":[{"index":1,"size":76,"text":"Earthworms are hermaphroditic and reproduce rapidly, doubling their population on average every 60-70 days (Sinha, Agarwal, et al. 2010). When the worm populations grow in excess, worms can be sold to other farmers to be used as feed. Of the three farmers interviewed, only two sold worms for additional household income. The farmer who avoided this opportunity cited instability in the worm market. The economic benefits incurred by the other two farmers averaged VND 11,500,000 annually."}]},{"head":"Table 3. Economic assessment for initial year","index":12,"paragraphs":[{"index":1,"size":147,"text":"Table 3. provides simple economic assessments for vermiculture during the initial year from interviews with farmers with breakdowns for chickens, ducks, and geese. This data assumes that the worm enclosure was constructed in one half day using materials already present on the farm. Maintenance, including feeding, watering, and turning the worm bed is estimated at one hour every two days, which averages out to 30 minutes per day. Inputs to feed the worms comes from livestock manure and crop residues, which are assumed to already be available on the farm. Worm sales occur two times per year, with farmers selling an average of 575 kilograms of worms with substrates per season and charging VND 10,000 per kilogram. The worms used to feed poultry are supplemental to the diets of chickens, ducks, and geese. They provide additional protein, while rice or rice-corn mixtures are the main caloric sources."},{"index":2,"size":6,"text":"Qualitative Benefits for Soil and Productivity"}]},{"head":"Labor Efficiency and Flexibility","index":13,"paragraphs":[{"index":1,"size":84,"text":"Before the farmers began practicing vermiculture, manure from chicken, cows, buffalo, and pigs was used to manage soil fertility. However, this required that farmers plow the soil very carefully before planting. According to previous ICRAF interview data, untreated manure can lead to pests and pathogens, and the high concentrations of urine and minerals in undecomposed manure can damage young roots. With vermicompost, farmers require less time for field application, and can apply at any point in the growing cycle if needed without damaging plants."},{"index":2,"size":23,"text":"Through earthworm digestion and microbial activity, a rich compost is generated as agricultural waste and livestock manure are transformed into valuable farm inputs."}]},{"head":"Soil and Crop Health","index":14,"paragraphs":[{"index":1,"size":108,"text":"Beneficial soil microbes such as nitrogen-fixing bacteria are highly concentrated in vermicompost (Sinha, Herat, et al. 2010), and some research indicates that vermicompost can suppress pathogens in crops and inhibit fungal diseases in soils because of the beneficial microorganisms present in the compost (Arancon, Galvis, and Edwards 2005). Specifically, research has indicated improvements in the intensity and damage of aphids, mealy bugs, and cabbage caterpillars on cabbage plants, and reduced loss in pepper and tomato yields due to vermicompost application (Arancon, Galvis, and Edwards 2005). Plants fertilized with vermicompost were less susceptible to salinity stress than those with conventional compost or synthetic fertilizers (Chaoui, Zibilske, and Ohno 2003). "}]},{"head":"ANIMAL","index":15,"paragraphs":[]},{"head":"Improved Soil Water Use Efficiency","index":16,"paragraphs":[{"index":1,"size":95,"text":"Farmers also cited improvements in terms of soil moisture, unanimously agreeing that less water was needed after vermicompost application. Changes in soil characteristics were described by all farmers as less sandy and softer after integrating vermicompost. Loamy soil texture is commonly associated with higher waterholding capacity and absorption (Shaxson and Barber 2003), which are critical conditions for drought resilience and therefore adaptation. Studies show that reduced soil moisture is directly linked with nutrient loss and declines in productivity (Pimentel et al. 1995), therefore efforts to improve soil moisture will enhance soil quality and crop yields."}]},{"head":"Soil Nutrient Improvement","index":17,"paragraphs":[{"index":1,"size":70,"text":"Vermicompost has proven to have beneficial impacts for crop productivity, with farmers noticing that plants grow faster and are greener in color with this soil amendment. One of the farmers interviewed conducted her own experiment on two peanut fields, applying vermicompost to one and only manure to the other. The peanuts fertilized with vermicompost were larger and the yield was higher than those in the field fertilized with manure only."},{"index":2,"size":61,"text":"According to a previous study, organic material which had been composted by Perionyx excavatus earthworms yielded a significant increase in N, P, and K elementsthree essential fertilizer components (Suthar 2007). This is because earthwor m s are able to mineralize the nitrogen, phosphorous, and potassium found in organic waste and make these nutrients bio-available to plants (Sinha, Herat, et al. 2010)."},{"index":3,"size":30,"text":"After successive years of application, vermicompost can improve texture, build up the nutrients, and increase the populations of beneficial microbes in agricultural soil, thereby improving its natural fertility and resilience."},{"index":4,"size":34,"text":"Vermicompost provides a beneficial alternative to direct application of manure on agricultural fields. Additionally, for farmers currently reliant on synthetic fertilizers, vermicompost could be one option to reduce or replace fossil fuel-based fertilizer inputs."}]},{"head":"Organic Waste Management","index":18,"paragraphs":[{"index":1,"size":157,"text":"All farmers interviewed indicated that vermiculture practice has eliminated the smell previously associated with manure. This odor reduction is due to the anaerobic conditions created by earthworm burrowing which inhibits anaerobic microorganisms associated with noxious gases (Mitchell, Hornor, and Abrams 1980). Additionally, the coelomic fluids from earthworms have anti-bacterial properties which kill pathogens and reduce odors (Sinha et al. 2002). Some studies have shown that vermiculture also reduces methane emissions compared with the current practice of spreading raw manure applied on fields (Sinha et al. 2014). Because the worms must be covered to avoid direct sunlight, emissions are reduced compared to raw manure application. Additionally, home vermicompost bins have lower emissions of nitrous oxide than other small-scale composting methods (Sinha et al. 2014;Chan, Sinha, and Wang 2011), a greenhouse gas which is particularly damaging to the ozone. By decreasing the proportion of anaerobic to aerobic decomposition, emissions are lowered (Sinha, Herat, et al. 2010;Sinha et al. 2014)."},{"index":2,"size":31,"text":"In terms of waste treatment, earthworms release coelomic fluids which have been shown to contain antibacterial properties, thereby destroying many pathogens from manure (Valembois et al. 1982) in the digestive process."},{"index":3,"size":41,"text":"One experiment showed that Escherichia coli (E. coli) in organic waste was eliminated through vermicomposting in 4-5 months (Bajsa et al. 2004). In 2010, 28.7 million cases of diarrhea were attributed to E. coli in Southeast Asia (Nsubuga et al. 2010)."}]},{"head":"Scaling and Social Sharing","index":19,"paragraphs":[{"index":1,"size":55,"text":"The potential to scale out vermiculture practice is significant, as the three farmers interviewed have shared worms with 20 other individuals combined. Providing 30-50 kg of worms per farmer, other farmers were able to initiate their own vermiculture systems and multiply the worms for use in feeding poultry, selling, and creating vermicomposting for field application."},{"index":2,"size":165,"text":"The farmers interviewed also articulated their participation in an array of social sharing methods. For example, they discussed vermiculture practice in passing or at the market, often conferring about technical worm-raising questions or other beneficial outcomes of the practice in person. Additionally, ICRAF has facilitated farmer-tofarmer interest groups on livestock, forestry, intercropping, and homegardens. The relevance of vermiculture spans these various topics, and farmer groups present an ideal opportunity for disseminating information about vermiculture practice. As has been detailed in a recent ICRAF gender analysis, differences between men and women manifest in different sharing and communication networks (Minh DT 2017). Social norms should be taken into account to maximize social sharing and facilitate support systems for farmers interested in beginning vermiculture practice. All farmers in this study recommend vermiculture to fellow farmers because it is easy to implement and maintain, and leads to a host of economic benefits. Vermiculture is an appropriate technology with numerous benefits, making it particularly suitable for broader adoption and scaling."}]},{"head":"Conclusion","index":20,"paragraphs":[{"index":1,"size":126,"text":"With minimal initial investment and maintenance, vermiculture yields many benefits, both economic and qualitative. Nutrient-rich vermicompost can be generated from waste and used as a soil amendment to improve soil structure, water filtration, and overall farm productivity which manifests as economic returns for the farmer. Inedible crop residues and livestock waste are recycled back into the system to reduce agricultural waste. The worms themselves are a renewable resource, with worm biomass functioning as a supplemental protein and food source for poultry, or a valuable product for farmers to sell. Integration of worms into the diets of the birds leads to faster growth, higher hatching rates, and improved overall health. This interconnected network of farm resources is directly linked with soil health, agricultural productivity and system resiliency."}]},{"head":"Recommendations 1. Practitioners","index":21,"paragraphs":[{"index":1,"size":39,"text":"Due to the low initial capital required to establish a vermiculture system, this practice could be scaled widely among farmers. An aggregation of vermiculture farmers in a cooperative model could enhance market stability and offer increased opportunities for income."}]},{"head":"Policy Makers","index":22,"paragraphs":[{"index":1,"size":33,"text":"Vermiculture is particularly cost-effective and suitable to integrate with development funds for economic and environmental returns. Scaling efforts for CSA practices could be enhanced by inclusion in socio-economic, agricultural, and rural development plans."}]},{"head":"Further Research","index":23,"paragraphs":[{"index":1,"size":38,"text":"Initial studies in the Philippine uplands indicate potential for vermijuice, the liquid component of vermiculture, as a natural pesticide (Weidner et al. 2011). More research is necessary to identify details on application methods and effectiveness for specific crops."}]}],"figures":[{"text":"  "}],"sieverID":"08dbf31f-630e-4607-bf71-b62dc9ee41b5","abstract":"n Vermiculture as a climate-smart agriculture (CSA) improves resource use efficiency on the farm.n Integrated resource cycling is directly linked to cost savings on poultry feed, diversified income streams from worm sales, and qualitative agricultural improvements.n Vermiculture requires minimal investment and can be implemented with little space, hence suitable for backyards and home gardens.n Vermiculture yields economic and environmental benefits."}

data/part_2/05dd3eb391d1ae4b4bfa0506c2550601.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05dd3eb391d1ae4b4bfa0506c2550601","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/PYQVUB/YPMUZZ"},"pageCount":46,"title":"CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) Household Characterization Survey -IMPACTlite Training Manual","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":115,"text":"IMPACTlite is a tool that provides a unifying framework for collecting detailed information on farm resources, farm management strategies, farm productivity and household economics at the household-level. Household surveys can be implemented using this tool to capture diversity on farming activities at household level to characterize main agricultural production systems. The household surveys implemented with IMPACTlite allow collecting detailed data to i) define representative farm types for the main agricultural production systems, ii) generate sufficiently accurate aggregated values for each representative farm type to calculate performance and livelihood indicators, and iii) parameterize household models with values for farm resources and assets, technical input/output coefficients describing farming activities and contributions to indicators represented ad objective functions."},{"index":2,"size":132,"text":"IMPACTlite gathers information on: household size, household assets, farm structure, land use management, input use, crops, livestock and aquaculture production, labour requirements, sale and consumption of produce, seasonal food consumption, off-farm employment and other sources of livelihood. The IMPACTlite tool has been tested and surveys were conducted at the 15 Climate Change, Agriculture and Food Security (CCAFS) benchmark sites in East Africa (Nyando, Wote in Kenya, Hoima and Rakai in Uganda, Lushoto in Tanzania and Yabero in Ethiopia), in West Africa (Yatenga in Burkina Faso, Lawra-Jirapa in Ghana, Segou in Mali, Kollo in Niger and Kaffrine in Senegal) and in the Indo-Gangetic Plains (Vaishali and Karnal in India, Rupandehi in Nepal, and Bagerhat in Bangladesh) (Table 1). Detailed information on the site portfolios can be found in the CCFAS website. See: http://ccafs.cgiar.org/sites/default/files/assets/docs/ccafs_siteportfolio_v2.pdf."},{"index":3,"size":140,"text":"The collected data with IMPACTlite can be used i) to examine ex-ante the impact of climate change shocks on production and food consumption, ii) to identify adaptation and mitigation strategies, iii) to estimate impact of farming on the environment through livelihood and emissions indicators. This exploration can be conducted using of farm household models (see van Wijk et al., 2012 for a recent review on household modelling techniques). The detailed household characterization can be used as well for the comparison of agricultural productions systems across and within regions using key indicators of resources use and livelihoods, and to parameterize farm household models to evaluate the impact of interventions on incomes and food security. To capture within site variability, household models make use of a farm typologies, which represents the major production systems and farm types in a selected research area."},{"index":4,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Sampling framework and approach","index":2,"paragraphs":[{"index":1,"size":15,"text":"The following are the step-by-step procedure to select households at each of the research grids:"}]},{"head":"Gathering secondary data for each research grid","index":3,"paragraphs":[{"index":1,"size":55,"text":"The on-going CCAFS research projects have acquired high resolution satellite images, generated a series of maps, and geo-referenced lists of all villages within the research grids. The survey teams accessed, reviewed and updated this information. Using the satellite images, maps, grey literature available and consultations with national and local partners, the production systems were identified."}]},{"head":"Definition of agricultural production systems (P)","index":4,"paragraphs":[{"index":1,"size":233,"text":"The survey teams, in collaboration with the IMPACtlite team and the key informants (i.e. local research and development partners, village elders, chiefs) determined how the research grids were geographically split into several major production systems. The production system concept refers mainly to agroecology that shapes land use and farming activities (e.g. sort of dominant crops and livestock types) and market characteristics that determine that certain combinations of farming activities are present or not. It should be ensured that each village in the sampling frame and consequently each household is assigned to one and only one production system. The production system areas do not have to be contiguous, but should also not be too scattered making geographic interpretation difficult. After the definition of production systems, buffer zones are delineated around the boundaries of each production system, where villages might belong to both systems. These villages must be discarded before proceeding with village selection. The process of defining the production systems with the key informants must be documented by the survey team. We present as an example of the delimitation of agricultural production systems the case of the research grid at Nyando (Kenya) where we identified three systems: 1) Crop-livestock farming with local zebu cattle, 2) Mainly crop farming specialised in sugarcane, 3) Croplivestock farming specialised in dairy (Figure 2). In the case of Nyando, the production systems followed closely the delimitation of agroecological zones."},{"index":2,"size":59,"text":"The definition of production systems allows subsequent stratification of villages. The selection of an equal number of households from each production system ensures a sample size large enough also from those production systems which include few villages. This is important for the system characterisation, representativeness of the larger area, and inclusion in the farm typology and household modelling studies."},{"index":3,"size":91,"text":"The number of production systems per research grid is not fixed, but should preferably not exceed four, to allow for sufficient number of households (ca. 50) per production system allowing for a maximum of 200 households per grid. The total number finally depends on the budgetary constraints of the characterisation survey. The output of the production systems definition is a map of each research grid delineating the boundaries of each identified production system and an additional variable in the list of the villages indicating to which production system each village belongs. "}]},{"head":"Villages selection (V)","index":5,"paragraphs":[{"index":1,"size":177,"text":"The definition of village should coincide with some level of administrative organisation. People in the village share some level of interaction and dependence. It must be possible to define which household does not belong to the village, and there is some village authority with whom to communicate. Each household within the research grid should belong to one village. Within each production system (P) we aimed at an equal number of villages (V) to be randomly selected from the village list constructed for the research grid. Villages are used as an intermediate sampling step to allow for random household selection. As we expect considerable variation between villages we include a fairly large number of villages while keeping the number of households per village low (10 to 20). A maximum of two interviews can be completed per enumerator per day. A survey team of five enumerators can cover approximately 10 households in a day, so this is the suitable household sample size per village randomly selected. Based on this, the number of villages per production system is determined as:"},{"index":2,"size":48,"text":"Households per research grid = production systems (P) per research grid * villages (V) per production system * households per village Having decided to sample 200 households per CCAFS site and 10 households per village, the number of villages depends only on the number of production systems identified."},{"index":3,"size":33,"text":"As an example: For 4 production systems: villages = 200/4/10 -> 5 villages For 3 production systems: villages = 200/3/10 -> 7 villages For 2 production systems: villages = 200/2/10 -> 10 villages"},{"index":4,"size":38,"text":"In research grids where only one production system can be identified, the total number of households sampled is maintained at 200. Where discrete production systems cannot be identified the heterogeneity within only one production system might be greater."}]},{"head":"Generate village information: creating a list of households (H)","index":6,"paragraphs":[{"index":1,"size":64,"text":"For this survey a household is defined as a group of people living in the same home and sharing meals and income generating activities, and acknowledging the authority of the household head (Beaman and Dillon, 2010). We consider a household member to be a person who lives and shares meals at least one season per year, and who shares income with other household members."},{"index":2,"size":121,"text":"In order to sample households in selected villages, household lists are required. These could be either obtained from local authorities if there are already such lists with sufficient level of detail to unambiguously identify households and determine whether they are suitable for this survey. Official household lists are seldom complete and therefore household lists should be generated or completed by the survey team. It is the responsibility of the site coordinator to compile the household list. These lists should include names of the household heads and names of the It should be ensured that all households belong to a village and that households living somewhat apart from the main settlement are not overlooked. The household lists should be checked for accuracy."},{"index":3,"size":11,"text":"Building a household list using a traditional survey approach involves: a."},{"index":4,"size":17,"text":"Ask from the decentralized administration if any village household list is available (e.g. from census list) b."},{"index":5,"size":53,"text":"Obtain permission from the village authorities/elders to compile/confirm/update the list of households. Ideally the village authorities will also inform the community members so as to avoid suspicion or conflict while the list is drawn. The team should make sure that the village authorities know that the team will be numbering the dwellings. c."},{"index":6,"size":13,"text":"Engage a village guide who knows the community well and who can accompany"},{"index":7,"size":57,"text":"the team during the household listing. Discuss with the village guide what is a good starting point for this exercise. It is often advisable to start from 'an identifiable end point' in the village where a clear geographical reference can be established -this is useful when the households selected for the sample need to be identified. d."},{"index":8,"size":80,"text":"Establish the boundaries of the village. In collaboration with the village guide determine how far the village extends and therefore the area that needs to be covered during the household listing exercise. A good approach would be to use the aerial map that the team carries to the field and to discuss with the village authorities the boundaries of the village so that the survey coordinator can ensure that all areas have been covered by the household listing exercise. e."},{"index":9,"size":41,"text":"Go from dwelling to dwelling numbering them and registering them onto a Household Listing Form, until all the households in the village are included. In this case, it is important that households that are spatially difficult to reach are not ignored."}]},{"head":"Selecting households from a village list","index":7,"paragraphs":[{"index":1,"size":135,"text":"Only households who are land users, i.e. cultivating land or keeping livestock or involved in aquaculture (or both) shall be considered for the survey (i.e. households not cultivating land and not keeping livestock are not considered for the survey). Unsuitable households are excluded from subsequent selection. This means that households owning land, but not cultivating are not included if they don't keep livestock, while households not owning, but cultivating (on rented or shared land) are included. Subsequently, the previously determined number of households is randomly selected from each village. A random number generator is used to select the households from the constructed lists. Replacement households are also randomly selected for cases where households are completely uncooperative or unavailable or where selected households turn out to be unsuitable despite checking the quality of the household lists."}]},{"head":"Replacing selected households","index":8,"paragraphs":[{"index":1,"size":33,"text":"In this survey, the team aims at interviewing the households selected through the sampling process described above. Only in exceptional circumstances replacement of households will be allowed. A household can be replaced if:"},{"index":2,"size":59,"text":"• The enumerator has made a minimum of three pre-arranged attempts to interview the respondents in the household and has been unsuccessful. In this case, the enumerator will have to request in writing a replacement to the site coordinator. The request must explain the efforts made by the enumerator to carry out the interview and why these have failed."},{"index":3,"size":28,"text":"• If the respondent blankly refuses to participate in the interview. In this case, the enumerator must seek support from the survey coordinator who will visit the CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":4,"size":42,"text":"household and engage with the respondent to try to obtain the interview. If this fails, the coordinator will file a report explaining the reasons for refusal. If a replacement household is required the survey coordinator will follow the sampling procedure described above."}]},{"head":"Farm typology","index":9,"paragraphs":[{"index":1,"size":136,"text":"In order to compare the results of the statistical classification with common perceptions of what constitutes major farm types, information should be collected at this stage on how villagers define (specify criteria) major farm types within a production system. This information can be gathered at the time of constructing the household lists. The site coordinators are requested to indicate unambiguous criteria that define different sort of farm households: e.g. of a farm typology i) large farm commercially oriented, ii) mediumsize farm commercially oriented, iii) medium-size farm subsistence farming, iv) small farm subsistence farming. In this example, the site coordinator will indicate what people call large, medium and small farm in the region (indicating ranges in farm size), and when a farm would be commercially oriented and when it would be a subsistence farm providing quantitative indicators."}]},{"head":"Implementation Plan","index":10,"paragraphs":[{"index":1,"size":36,"text":"A proposed implementation plan for the household survey at each site includes details about each activity with respect to timeline, responsibility, location and budget including other resources needed. An implementation plan should include the following components:"},{"index":2,"size":45,"text":"• Production systems definition process • Team composition and recruitment • Training of site survey team (by the IMPACTlite team) • Field activities planning (including all logistics) • Production of a random sample of the villages from village list which belongs to the sampling frame"},{"index":3,"size":22,"text":"• Generation of a complete household lists for the selected villages and randomly sample 10 households per village Language of the Questionnaire"},{"index":4,"size":30,"text":"The questionnaire has been produced in English for the implementation of the survey in East Africa and in the Indo-Gangetic plains, and in French for West Africa (except for Ghana)."},{"index":5,"size":47,"text":"The enumerators need to master the language used in the questionnaire so that they can translate properly into the local language during the interviews. The site coordinator should ensure that the simultaneous translation works well. Training of enumerators was done using the questionnaires in English and French."}]},{"head":"Enumerator and Supervisor Recruitment Guidelines","index":11,"paragraphs":[{"index":1,"size":25,"text":"The recruitment of well-qualified enumerators to conduct the interviews is crucial to this process. The enumerators need to be experienced and qualified in the following:"},{"index":2,"size":6,"text":"• Collecting data through quantitative questionnaires"},{"index":3,"size":29,"text":"Engaging farmers in open-ended semi-structured questionnaires, including listening, processing and probing for more detailed answers, as well as synthesizing and recording the story lines the farmer tells in detail"},{"index":4,"size":13,"text":"• Subject matter specialists with good knowledge of farming systems, agronomy or livelihoods"},{"index":5,"size":5,"text":"• Speaking the local language"}]},{"head":"Guidelines for Survey coordinators","index":12,"paragraphs":[{"index":1,"size":6,"text":"Duties of the survey coordinator include:"},{"index":2,"size":19,"text":"• Ensure that the logistic arrangements and materials for each visit are sorted out before departure to the field."},{"index":3,"size":19,"text":"• Engage with the relevant authorities to ensure that the survey can be carried out in every selected village."},{"index":4,"size":13,"text":"• Draw a sample of villages following the procedure described in this manual."},{"index":5,"size":18,"text":"• Ensure a good household listing form is prepared in each selected village, and describe the procedure used."},{"index":6,"size":13,"text":"• Draw a sample of households following the procedure described in the manual."},{"index":7,"size":23,"text":"• Join as an observer the process of interviewing in the villages. This should be random checks while the enumerators interview the respondents."},{"index":8,"size":38,"text":"• Check every questionnaire for completeness, clarity and consistency. Once the questionnaire has been checked and the site coordinator is satisfied with its quality, he/she should sign it to indicate that he/she assumes the responsibility for its quality."},{"index":9,"size":27,"text":"• Record the GPS references for each sampled household • Ensure that the completed questionnaires are returned from each site and guarantee the quality of the data."},{"index":10,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":11,"size":18,"text":"• Supervise data entry, which should start as soon as there are questionnaires available, and after quality control"},{"index":12,"size":15,"text":"• Deliver the complete set of questionnaires and filled clean database to IMPACTlite survey coordinator."},{"index":13,"size":50,"text":"• Report to the Regional survey coordinator appointed by the IMPACTlite team highlighting any events that were different from the plan, specific comments about the performance of the team of enumerators, justification for replacements, and any observations he/she may consider pertinent for the interpretation of the data from the village."},{"index":14,"size":80,"text":"The survey coordinators act as team leaders in the field and will participate in the training event for enumerators before data collection starts. This person assumes the duties of a supervisor and is responsible for the smooth implementation of data collection through managing logistics on the ground, managing the enumerators in the field and troubleshooting where needed. The coordinator needs to speak the local language and make sure that the questions are properly translated by the enumerators during the interview."},{"index":15,"size":87,"text":"The survey coordinator has an important role to play in adequately entering the village, introducing the survey purpose and team to the village leaders. This person has to engage actively throughout the data collection process to ensure smooth implementation and high data quality standards. The survey coordinator needs to be equipped with a GPS unit (that is geo-referenced in UTM coordinate system) and needs to be trained in using the GPS. The survey coordinator is responsible for recording the GPS coordinate for each household that is interviewed."},{"index":16,"size":105,"text":"Enumerator management is critical for the successful implementation of the data collection process, as well as for data quality assurance. The site coordinator has to engage closely with the enumerators, provide support and supervision in the field as needed and manage any concerns that may arise during the data collection process. The coordinator has to ensure that enumerators stay motivated throughout the process, countering any symptoms of enumerator fatigue appropriately. The coordinator needs to monitor enumerators, carry out surprise visits and actively manage the enumerators to adhere to high standards of interviewing. The coordinator is responsible for the quality of the data in the database."}]},{"head":"Guidelines for the training of site coordinators and enumerators","index":13,"paragraphs":[{"index":1,"size":46,"text":"The IMPACTlite team is responsible for the process of the training survey coordinators and enumerators. This is crucial to ensure good quality data. While most teams are experienced in survey work, the regional survey coordinators should take into account the following important elements for this training."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":3,"size":7,"text":"The training event has the following objectives:"},{"index":4,"size":123,"text":"1. To familiarize the field teams with the objectives of the survey, with the methodology and the reasons why this level of standardization is required by the household survey. 2. The survey coordinator and enumerators must be able to apply the sampling procedures described in this manual. 3. The survey coordinator and enumerators must have an in-depth knowledge and understanding of each question in the survey questionnaire. This is more than being familiar with the questions. It implies knowing what is being asked, why it is being asked, and how it should be asked. 4. To explain the roles and responsibilities of each member of the field team, and how a chain of responsibilities has been established to help in ensuring data quality."},{"index":5,"size":179,"text":"The training event must include the following activities 1. Discussion of entry procedures to ensure that the required protocol is followed in the field. This includes entry into the village and the introduction of the survey to the respondents, for the latter in particular the use of the paragraph for obtaining consent. 2. Discussion of the roles and responsibilities of different members of the team. 3. Reading, discussing and using the questionnaire under classroom conditions. There will be demonstrations by competent members of the team on how to conduct the interview as part of the process of familiarization with the questionnaire. Role plays where enumerators take the place of interviewees and interviewers should be organized, witnessed by members of the field team and discussed to improve the ability of the enumerators to carry out interviews. 4. Using the sampling procedure on pre-prepared village and household listings. 5. A field-based practice in which enumerators and site coordinator can put the interview in practice. This experience must be discussed and lessons drawn after the field visit. 6. Planning the field trip."}]},{"head":"The Questionnaire -Guidelines for Site coordinators and Enumerators","index":14,"paragraphs":[]},{"head":"Roles and responsibilities","index":15,"paragraphs":[{"index":1,"size":68,"text":"The survey coordinator is directly responsible for communications with the IMPACTlite team. He/she develops the implementation plan and budget for each site, as well as coordinate the site team, and organize logistics. The survey coordinator is responsible for reporting and delivery of study products to the IMPACTlite team in a timely manner, while adhering to the quality standards set out in this manual and the agreed upon deadlines."}]},{"head":"CCAFS_Training_Manual_For_HH_Survey-English-20121226","index":16,"paragraphs":[{"index":1,"size":167,"text":"The survey coordinator is responsible for ensuring that the work of the enumerators in done to the highest quality standard. The survey coordinator is responsible for generating the complete village list and the sampling process of households. He/she assigns the selected households to interview to the enumerators. He/she records the geographical position of each household that is being interviewed with the GPS. He/she verifies that each interview was carried out in the correct household and checks and signs each questionnaire for completeness, accuracy and readability. After finalizing the site data collection, the survey coordinator delivers the completed questionnaires of the villages to the Regional survey coordinator and complete a site report that includes the list of village households and households selected and an explanation for any households that had to be replaced. Copies of the completed questionnaires and field reports from each village are to be attached to the site report. The survey coordinator hands in a clean and complete database containing the data from the questionnaires."},{"index":2,"size":85,"text":"The Enumerators are responsible for interviewing the households that were assigned to them and for completing the questionnaires in a complete, accurate and readable manner. The Enumerators follow the procedures outlined in this manual and conduct themselves in an appropriate manner. If the Enumerators encounter problems during data collection, they are to report the problem to the Survey coordinator in a timely manner. The Enumerator deliver the completed and signed questionnaires (including the story line) to the site coordinator at the end of each day."}]},{"head":"Mode of operation in the field and conduct","index":17,"paragraphs":[{"index":1,"size":100,"text":"Travelling to the Sampled Village It has been outlined above how to randomly select the villages for data collection. When the location of a village is known, the survey coordinator has to make firm arrangements to inform the appropriate authorities. A letter of introduction is provided to support and introduce the Survey coordinator to the district authorities (and lower level authorities, if needed). However, the survey coordinator is expected to say more about the survey and its objectives and requests the district officials to introduce him to the local leader/village before the actual implementation of your household baseline survey starts."}]},{"head":"Mode of Operation in the Field","index":18,"paragraphs":[{"index":1,"size":104,"text":"A team of a Survey coordinator and five enumerators works together to generate a complete list of households for the selected village, randomly sampling households and conducting the interviews in these (the exact number of days depends on the implementation plan). When the sample is drawn the Survey coordinator and the Enumerators are all involved in administering the questionnaires to the selected households. The enumerators conduct the questionnaires in an appropriate location, ideally within the household. A public place may not be appropriate as that might attract a lot of attention from other village members and thus disrupt the process of a household interview."}]},{"head":"CCAFS_Training_Manual_For_HH_Survey-English-20121226","index":19,"paragraphs":[{"index":1,"size":48,"text":"Arrangements for the team to travel to the next village are made by the Survey coordinator. Travel takes place when all outstanding work in the first village is completed. The Survey coordinator makes sure that all work is completed in the first village before moving to the next."},{"index":2,"size":20,"text":"• Household listing and sample selection are properly done before the process of data collection using the household questionnaire starts."},{"index":3,"size":95,"text":"• While the Enumerators administer their questionnaires, the Survey coordinator monitors the quality of work by his/her Enumerators. Some time will have to be put aside to check how work is progressing. This should not be a difficult thing to do as everybody will be working in the same village. All mistakes the Enumerator commits ought to be rectified while in the village. The Survey coordinator has to check every questionnaire for a given Enumerator. Correction of mistakes of one village when the team is in another village cost more time to the Survey coordinator."},{"index":4,"size":31,"text":"• No Enumerator is left behind completing his/her remaining tasks in the village. All the tasks assigned to the Enumerator should be finished before the team decides to leave the village."}]},{"head":"Conduct","index":20,"paragraphs":[{"index":1,"size":36,"text":"At each stage of this Household Survey, it is recommended to conduct oneself in a polite and confidential manner. The Enumerators are to conduct themselves in a polite, sensitive and attentive manner throughout the entire interview."},{"index":2,"size":121,"text":"Enumerators have to be polite when approaching one of the selected households, making sure they follow the locally appropriate ways of greetings and introducing themself. Enumerators should strongly adopt the confidentiality statement provided by the household questionnaire. The interview process has to take place in a polite way. Enumerators should keep respectful behaviour and eye contact throughout the interview and be attentive and interested in the answers the respondent provides, be sensitive to household needs and make sure they do not take up more of their time than scheduled and/or absolutely necessary. They have to be prepared to arrange the interview at a time when it is convenient to the respondent; remember that they are offering information on a voluntary basis."}]},{"head":"Getting Started with the Household Questionnaire","index":21,"paragraphs":[{"index":1,"size":61,"text":"Enumerators should use exactly the wording in the questionnaire and do not interpret the questions. Also avoid leading questions and listen to the responses and do not assume to know the answer. In completing the questionnaire, the enumerators should not leave any fields blank. Whenever a mistake is made, cross the wrong answer and write a correct answer next to it."},{"index":2,"size":134,"text":"Enumerators need to pay particular attention to the instructions outlined in each question in relation to how to ask it. They have to follow these instructions faithfully, in particular, do not change their wording. If the respondent requires clarification or explanation they can give it but after the question has been asked in the standard form. When they are probing in order to get a more detailed answer, they have to be sure not to ask leading questions so as to avoid biasing the response. Every field of the questionnaire needs to be filled. The story lines of some questions are an integral part of the questionnaire and a questionnaire is not complete without these. The questionnaire should be finalised at the household in case enumerators need to ask for clarifications or follow up."}]},{"head":"Introduction and Consent by Main Respondent","index":22,"paragraphs":[{"index":1,"size":76,"text":"• At the top right of the every page, record the site ID, production system ID, village ID, and the household ID. The site ID has been assigned by CCAFS and is provided to you ahead of time; the production system ID, village ID and household ID are being produced by the survey team. This is a very vital initial activity. Remember to do that in order to ensure that you work with the right sample."},{"index":2,"size":54,"text":"• Identify an appropriate respondent for the interview. Ideally you interview the household head or spouse. If nobody is around to answer your questions you are required to revisit the household at least three times. Only once you have done everything you can to talk to the household, you may inform the Survey coordinator."},{"index":3,"size":41,"text":"• Read out the introduction and confidentiality statement provided at the beginning of each household interview. You ought to own the statement in order for the interviewee to be confident in you. This must be done before you start the interview."},{"index":4,"size":42,"text":"• Introduce yourself as a member of the organization that you work for (e.g. university, consulting firm). Your organization has been hired by a multi-institutional program that is an international network of research organizations (do not mention climate change and long-term involvement)."},{"index":5,"size":50,"text":"• These interviews target the household head. In his/her absence the spouse or any other responsible adult in the household should be used to handle the interviews. Record if the main respondent is giving you consent for the interview. Repeat the confidentiality statement if another household member joins the process."},{"index":6,"size":34,"text":"• Ensure that the respondent understands that names will not appear in the information we publish. We will use the information they provide but make sure that names of the household are not published."},{"index":7,"size":45,"text":"• If a respondent refuses consent, the interview will be stopped at this stage. The respondent can also opt out of the interview at any time. The questionnaire has to be submitted to the site coordinator. Your supervisor will randomly sample another household for you."},{"index":8,"size":14,"text":"• Be honest that this interview takes about 3 hours of the household time."},{"index":9,"size":34,"text":"• Respondents may have expectations and it may be tempting to promise gifts to ensure cooperation. We will provide a token of gratitude to be distributed (e.g. of sugar). This has to be budgeted."},{"index":10,"size":31,"text":"• Respondents may ask if you have permission to conduct the interviews in his/her village. You can assure them that the district authorities and local leaders have granted your organization permission."},{"index":11,"size":9,"text":"The questionnaire form by form Section 0: Data Handlers"},{"index":12,"size":180,"text":"This section assigns responsibility to the interviewer (enumerator), the survey coordinator and the data entry clerks. We are asking for signatures from all the team members. These are available on the household listing form and household questionnaires. In all cases, completion should be done clearly and readably/legibly. Note that success in processing the questionnaires will be attained if all sections of the questionnaires are legibly, accurately, and consistently and orderly done before endorsing your signature. This implies that before you endorse your signature, you need to go through the questionnaire once again so that you are assured that everything is fine according to the reference point. It will be advisable if this is done before you leave the village so that if you identify some irregularities, these are sorted out before while there. The survey coordinator checks the completed and signed questionnaires for completion and, when satisfied sign. The roles and responsibilities section above clearly outlines the process to be used. This uniform process is vital in ensuring that a high level of data quality is maintained throughout the survey."},{"index":13,"size":24,"text":"• Each team member is assigned a unique identifier code that is to be recorded. This code must be a number with two digits."},{"index":14,"size":23,"text":"• The interviewer signs when he is sure that the questionnaire is complete. With his/her signature the interviewer assumes responsibility for the questionnaire."},{"index":15,"size":42,"text":"• The field supervisor signs when he/she checked the questionnaire and has confirmed that it is complete and meets the data quality standard. With his/her signature the survey coordinator assumes responsibility for the questionnaire. Responsibility now no longer is with the interviewer."},{"index":16,"size":33,"text":"• The two data entry clerks sign when he/she has completed the data entry into the data entry format provided. The data is entered double by two independent data clerks to ensure quality."},{"index":17,"size":22,"text":"• GPS coordinates should be recorded by the field supervisor in UTM format. This will help to find households in the future."},{"index":18,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Cover page","index":23,"paragraphs":[{"index":1,"size":33,"text":"The cover page intends to capture general information related to the household and its geographical location. The cover page also records data about the enumerator, its site coordinator, and the data entry clerks."}]},{"head":"List of variables","index":24,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"Date","index":25,"paragraphs":[{"index":1,"size":7,"text":"The date when the interview is conducted"}]},{"head":"Name of household head","index":26,"paragraphs":[{"index":1,"size":25,"text":"The head of the household and/or the person who makes decisions on the farm management. It will be useful to have both spouses whenever possible."}]},{"head":"Gender of the household head","index":27,"paragraphs":[{"index":1,"size":8,"text":"The gender of the head of the household"}]},{"head":"Name of respondent","index":28,"paragraphs":[{"index":1,"size":28,"text":"The person who is responding the questionnaire. This person should be the household head. If the household head is not available it is advised to re-schedule the meeting."}]},{"head":"Gender of respondent","index":29,"paragraphs":[{"index":1,"size":8,"text":"The gender of the person responding the questionnaire."}]},{"head":"Name of second respondent","index":30,"paragraphs":[{"index":1,"size":29,"text":"In some cases there is a second respondent answering sections of questionnaire. For example, the wife of the farmer may answers household consumption questions. Record it here if applicable"}]},{"head":"Gender of second respondent","index":31,"paragraphs":[{"index":1,"size":6,"text":"The gender of the second respondent."},{"index":2,"size":40,"text":"Geographical location (e.g. country, province, division, location, sublocation, village and GPS coordinates) This is the geographical location of the household. This information must be provided by the site coordinator prior visiting the household. This is derived from the household lists."},{"index":3,"size":12,"text":"The administrative organisation of each site may be site specific Production system"},{"index":4,"size":46,"text":"A production system defines a set of key farm activates/enterprises that household engage on and are common across geographical locations. For example, dairy + sugarcane or local cattle + maize. Different production systems will be indentified and provided by the site coordinator prior visiting the household."}]},{"head":"Enumerator name","index":32,"paragraphs":[{"index":1,"size":5,"text":"The person conducting the interview"}]},{"head":"Supervisor name","index":33,"paragraphs":[{"index":1,"size":5,"text":"The person supervising the enumerator"}]},{"head":"Language used during the interview","index":34,"paragraphs":[{"index":1,"size":34,"text":"Although the language of the questionnaire is English or French, local language is usually used in the interview to enhance the interview's clarity for the respondent. Indicate here the language used during the interview."}]},{"head":"Data entry information (name and code)","index":35,"paragraphs":[{"index":1,"size":21,"text":"This is filled by the data entry clerk after the survey is checked and approved by the supervisor and site coordinator."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Form 1. Household composition and off-farm activities","index":36,"paragraphs":[{"index":1,"size":72,"text":"The household includes the people who live and share meals at least one season per year, and share resources. Members who live somewhere else and only come to visit and bring money are not household members. Include here all household members and their position in the household, e.g. household head, spouse, son, daughter, nephew, etc. Also detail here for each member whether he/she works in the farm or off-farm in different seasons."},{"index":2,"size":35,"text":"Schooling is considered an off-farm activity. This information is used to quantify labour availability and to get a general idea of sources of off-farm income that then must be detailed in Form 13. Other income."}]},{"head":"List of variables","index":37,"paragraphs":[]},{"head":"Name Description","index":38,"paragraphs":[{"index":1,"size":9,"text":"Person This is a consecutive number for identification purposes."},{"index":2,"size":21,"text":"Position in household This is the position of the member within the household, examples are: head, wife, son, daughter, nephew, etc."}]},{"head":"Year of birth","index":39,"paragraphs":[{"index":1,"size":7,"text":"The year of birth of the member"}]},{"head":"Gender","index":40,"paragraphs":[{"index":1,"size":14,"text":"The gender of the household member General working calendar per season 1 (on/off farm)"},{"index":2,"size":35,"text":"Indicate here whether the member works on/off farm in different season. Please note that it can be both cases in a season. The season is defined by the month in which it starts and ends."}]},{"head":"Off-farm activities description","index":41,"paragraphs":[{"index":1,"size":22,"text":"Description of the activity engaged off-farm. This can be business, employment, etc. We want to capture any income generated by offfarm activities."}]},{"head":"Notes","index":42,"paragraphs":[{"index":1,"size":29,"text":"Any extra information that is relevant to note regarding a household member. For example indicate the period of time when the household member is engaged in the off-farm activity."},{"index":2,"size":38,"text":"If one of the member of the family is too young or too old to carry out activities and the column 'of ' and 'on-farm' have not been filled, the notes should report \"too young\" or \"over age\"."},{"index":3,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Form 2. Sketch of the farm and seasonality of crops","index":43,"paragraphs":[{"index":1,"size":53,"text":"This section is intended to capture a sketch/drawing of the farm and the seasonality of crops. This activity must be performed in collaboration with the respondent or if possible entirely by him/her. Base the discussion around the plots rotation/seasonality of crops (when different crops occur in each plot) and if intercrops are present."},{"index":2,"size":6,"text":"We suggest to following these steps:"},{"index":3,"size":70,"text":"1. In form 2 draw together with the farmer the plots and sub-plots and assign numbers to them. We suggest to start with the plots and sub-plots the farmer has in place in the season during the interview and ask him/her to describe how the same plots and sub-plots looked like in the previous two seasons i.e. this should be site specific as some sites have two or more seasons."},{"index":4,"size":122,"text":"For example in the Fakara region of Niger, where there are three seasons named rainy, warm-dry and cold-dry and where are conducting the interview during the month of June, we start by drawing first the rainy season (takes place from June to September). We then proceed by drawing how the plots looked like the previous 4 months (March-June) and then the ones before. In this way we are able to have the full picture of the change of the plots and sub-plots in a year time. 2. Some households may have a wide range of crops, which might make the sketch very complicated. Detail as much as possible then use Form 3 to filter the most important crops and rank the activities."},{"index":5,"size":10,"text":"The additional following information should help to complete form 2."},{"index":6,"size":39,"text":"Definition of plot: it is land management unit whose dimensions do not change in time. It is a piece of land owned, leased in or out, and can be fully cropped, kept fallow, used for grazing, forestry or aquaculture."},{"index":7,"size":61,"text":"Definition of sub-plot: it is a sub-unit within a plot used to record differences in land use pattern in space and/or in time. The purpose of using the sub-plot concept is to be able to describe framing activities that may change in space or in time and to record labour and inputs demanding activities, production and the use of crop residues."},{"index":8,"size":87,"text":"In several systems in Sub-Saharan Africa, crops are often planted in plots which have native or exotic trees. We noticed that farmers do not mention the trees unless we ask specifically Use this form to provide an inventory and ranking of the most important income generating activities and consumption of on-farm products 2 . Include crops, livestock, and aquaculture activities. Also include woodlots and grazing areas. Do not include off-farm products or services. Off-farm services must be included in Form 13 while off-farm products in Form 16."},{"index":9,"size":71,"text":"Some households may have a wide range of activities. Rank the most important farming activities. Trees and tree products tend to be omitted. It has to be asked specifically what kind of product farmers may get from the trees (firewood, fruits, fodder etc.). Similarly, poultry and poultry products tend to be omitted. It has to be asked specifically what kind of product farmers get from the poultry (eggs, chicks, manure, etc.)."}]},{"head":"List of variables","index":44,"paragraphs":[]},{"head":"Name Description","index":45,"paragraphs":[{"index":1,"size":15,"text":"Most important, in terms of quantity, for sales Those activities that generate most cash income."}]},{"head":"Most important, in terms of quantity for household consumption","index":46,"paragraphs":[{"index":1,"size":28,"text":"Those activities that contribute the largest quantities of food products for the household's food consumption. It includes those that provide most of the food consumed by the household."},{"index":2,"size":13,"text":"Taking most of the labour Those activities that require most of the labour."},{"index":3,"size":13,"text":"Taking most of the land Those products that occupy most of the land."}]},{"head":"Notes","index":47,"paragraphs":[{"index":1,"size":7,"text":"Any extra information worth explaining the raking."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Form 4. Land allocation","index":48,"paragraphs":[{"index":1,"size":73,"text":"Based on the ranking made on Form 3 include here all the different plots that the household has and that hold the ranked farming activities. For each plot, indicate the crops, trees, pasture or aquaculture it holds in different periods of time. Each period of time represents a different subplot. A subplot can hold multiple crops (e.g. intercropping). Use the sketch drawn in Form 2 as a reference to record plots and subplots."}]},{"head":"List of variables","index":49,"paragraphs":[]},{"head":"Name Description","index":50,"paragraphs":[{"index":1,"size":8,"text":"Plot A consecutive number to identify the plot"}]},{"head":"Physical area","index":51,"paragraphs":[{"index":1,"size":46,"text":"Area of the plot. This is the area given by the respondent and should be write in local units. Please remember that such are may not be accurate. A real measurement using GPS will be done later on by the site coordinator to correct the measurement."}]},{"head":"Gender ownership","index":52,"paragraphs":[{"index":1,"size":27,"text":"Whether the plot is own by a male, female or jointly owned. The concept of ownership can be site specific, discuss with the respondent to clarify ownership."},{"index":2,"size":28,"text":"It refers normally to who makes final decision on the farm and products and has for example the power to decide when to sell or keep the products."}]},{"head":"Land ownership","index":53,"paragraphs":[{"index":1,"size":9,"text":"Whether the plot is owned, sharecropped or leased in/out."}]},{"head":"Cost / return if leased","index":54,"paragraphs":[{"index":1,"size":14,"text":"Indicate here the cost / returns if the plot is leaded in or out."}]},{"head":"Subplot","index":55,"paragraphs":[{"index":1,"size":74,"text":"A consecutive number to identify the subplot. A subplot represents a period of time where crops occupy a plot. Crops usually vary across seasons in the same plot or the land is subdivided in sections at several periods of time to accommodate different crops. Each variation or subdivision should represent a subplot, also fallow periods. If two or more crops are intercropped in a period of time, they should share the same subplot ID."},{"index":2,"size":24,"text":"Crop / aquaculture species or grazing area Indicate here the crop or aquaculture species present in the subplot. Grazing areas are also included here."}]},{"head":"Name of local / improved crop variety","index":56,"paragraphs":[{"index":1,"size":18,"text":"The name of the local / improved variety planted in the subplot. This is to capture crop diversity."}]},{"head":"Intercrop","index":57,"paragraphs":[{"index":1,"size":8,"text":"Where the variety is intercropped with another one."}]},{"head":"Area of the subplot","index":58,"paragraphs":[{"index":1,"size":10,"text":"Indicate here the area or proportion covered by the subplot."},{"index":2,"size":13,"text":"When importing the data in CSpro, then convert the unit used, in ha."}]},{"head":"Period of usage","index":59,"paragraphs":[{"index":1,"size":32,"text":"Indicate here the start and end months in which the subplot is occupied by the farming activity. Usually this period of time covers from preparing the land to the end of harvesting."}]},{"head":"Notes","index":60,"paragraphs":[{"index":1,"size":17,"text":"Any extra information worth noticing about a plot or subplot, for example that the plots are irrigated."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Form 5. Farming activities and inputs","index":61,"paragraphs":[{"index":1,"size":72,"text":"Indicate here the different labour consuming activities happening in each plot and subplot. Please remember that a joint plot + subplot declared in Form 4 represent crops, trees and aquaculture varieties happening in a period of time. Some activities could imply the use of inputs for example: planting could imply the use of seed while fertilizing would imply the acquisition of fertilizer. Under each activity please indicate any input used if applicable."}]},{"head":"List of variables","index":62,"paragraphs":[]},{"head":"Name Description","index":63,"paragraphs":[{"index":1,"size":41,"text":"Plot A consecutive number to identify the plot Subplot A consecutive number to identify the subplot Activity 3 / input Indicate here the activity performed or the input used. A check list of activities and inputs is tailored to each site."}]},{"head":"Labour, family or hired (Male and female)","index":64,"paragraphs":[{"index":1,"size":24,"text":"Indicate here the number of people (differentiated by gender) and type (family or hired) used to perform the activity indicated in the previous column."}]},{"head":"Labour required","index":65,"paragraphs":[{"index":1,"size":52,"text":"Indicate here the time required to perform the activity by each person in the three categories above. This should be recorded using the units the farmer utilizes. Please remember to describe the time as detailed as possible because it has to be transformed into Frequency (days/month) + Time (hours/day) during data entry."}]},{"head":"Cost of hired labour (currency and unit)","index":66,"paragraphs":[{"index":1,"size":36,"text":"Indicate here the cost of the labour described in local currency and units. Please remember to describe the cost as detailed as possible because it has to be transformed to currency / hour during data entry."}]},{"head":"Other cost","index":67,"paragraphs":[{"index":1,"size":8,"text":"Describe here other costs incurred by the activity."}]},{"head":"Amount used (amount and unit)","index":68,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the amount of the input used and the local unit of measurement. Please remember to describe the unit as detailed as possible because it has to be transformed to kg or litre during data entry."}]},{"head":"Price per unit","index":69,"paragraphs":[{"index":1,"size":12,"text":"Indicate here the cost of the input per local unit of measurement."},{"index":2,"size":25,"text":"Please remember to describe the cost as detailed as possible because it has to be transformed to currency / kg or litre during data entry."}]},{"head":"Notes","index":70,"paragraphs":[{"index":1,"size":10,"text":"Any extra information worth noticing about an activity or input."},{"index":2,"size":54,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226 Form 6. Production of main crops / aquaculture Indicate here the different products harvested from crops, trees and aquaculture. Please remember that a joint plot + subplot declared in Form 4 represent crops, trees and aquaculture varieties happening in a period of time. Please do not include residues, include them in Form 7."}]},{"head":"List of variables","index":71,"paragraphs":[]},{"head":"Name Description","index":72,"paragraphs":[{"index":1,"size":16,"text":"Plot A consecutive number to identify the plot Subplot A consecutive number to identify the subplot"}]},{"head":"Product","index":73,"paragraphs":[{"index":1,"size":10,"text":"The product produced by a farming activity in a subplot."}]},{"head":"Crop","index":74,"paragraphs":[{"index":1,"size":40,"text":"The crop used in the production of a product Production (quantity and unit) 4 Indicate the production in local units as given by the respondent. Each local unit and its equivalence to international units must be written by the enumerator."}]},{"head":"Sales (quantity, unit and price per unit)","index":75,"paragraphs":[{"index":1,"size":43,"text":"Indicate here the quantity of the production used for sale. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg and the price to currency / kg during data entry."}]},{"head":"Who controls the income","index":76,"paragraphs":[{"index":1,"size":33,"text":"Whether the income is controlled by a male, female member of the household or jointly controlled. The concept of ownership can be site specific, discuss with the respondent to clarify ownership if necessary."}]},{"head":"Human consumption","index":77,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the quantity of the production used for human consumption. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg during data entry."}]},{"head":"Livestock feeding","index":78,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the quantity of the production used for livestock feeding. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg during data entry."}]},{"head":"Other","index":79,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the quantity of the production used for other purposes. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg during data entry."}]},{"head":"Notes","index":80,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about a product."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":3,"size":44,"text":"Form 7. Residue production of main crops / aquaculture Indicate here the different residues produced from crops, trees and aquaculture. Please remember that a joint plot + subplot declared in form 4 represent crops, trees and aquaculture varieties happening in a period of time."}]},{"head":"List of variables","index":81,"paragraphs":[]},{"head":"Name Description","index":82,"paragraphs":[{"index":1,"size":16,"text":"Plot A consecutive number to identify the plot Subplot A consecutive number to identify the subplot"}]},{"head":"Crop","index":83,"paragraphs":[{"index":1,"size":5,"text":"The crop that produces residues"}]},{"head":"Crop residue","index":84,"paragraphs":[{"index":1,"size":9,"text":"The residue produced by a crop in a subplot"}]},{"head":"Collected (quantity and unit)","index":85,"paragraphs":[{"index":1,"size":43,"text":"Indicate the production in local units as given by the respondent. Each local unit and its equivalence to kg must be written by the enumerator. It is possible to indicate a proportion however, be aware that this quantity must be converted to kg."}]},{"head":"Sales (quantity, unit and price per unit)","index":86,"paragraphs":[{"index":1,"size":43,"text":"Indicate here the quantity of the production used for sale. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg and the price to currency / kg during data entry."}]},{"head":"Who controls the income","index":87,"paragraphs":[{"index":1,"size":33,"text":"Whether the income is controlled by a male, female member of the household or jointly controlled. The concept of ownership can be site specific, discuss with the respondent to clarify ownership if necessary."}]},{"head":"Feed","index":88,"paragraphs":[{"index":1,"size":34,"text":"Indicate here the quantity of the production used for livestock feeding. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg."}]},{"head":"Other","index":89,"paragraphs":[{"index":1,"size":34,"text":"Indicate here the quantity of the production used for other purposes. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg."}]},{"head":"Notes on other uses","index":90,"paragraphs":[{"index":1,"size":16,"text":"Any extra information worth noticing about a quantity given to other outlets. For example residues burnt."},{"index":2,"size":32,"text":"Left on the field Tick here whether the residues are left of the field. It is also possible to indicate a quantity or the proportion of the residue left on the field."}]},{"head":"Grazing","index":91,"paragraphs":[{"index":1,"size":71,"text":"Indicate here whether the residue left if grazed by own or other animals or not grazed at all. It is also possible to indicate a quantity or the proportion of the residue grazed by livestock Form 8. Non-ruminant livestock species Indicate here only livestock species that are not ruminants. Ask directly the respondent whether the household has poultry. Do not include here aquaculture because it must be included in Form 4."}]},{"head":"List of variables","index":92,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"Livestock","index":93,"paragraphs":[{"index":1,"size":14,"text":"The name of the non-ruminant livestock species, for example: Chickens, Rabbits, Pigs, Poultry, etc."}]},{"head":"Gender ownership","index":94,"paragraphs":[{"index":1,"size":26,"text":"Whether the livestock is owned by a male, female or jointly owned. The concept of ownership can be site-specific, discuss with the respondent to clarify ownership."},{"index":2,"size":28,"text":"It refers normally to who makes final decision on the farm and products and has for example the power to decide when to sell or keep the products."}]},{"head":"Total number of animals","index":95,"paragraphs":[{"index":1,"size":41,"text":"The total number of animals owned or managed by the household Number of males / females by age (young / adult) Disaggregate here the total number of animals by type, breed and sex (male / female) and age (young / adult)."},{"index":2,"size":12,"text":"It is considered adult an animal that has reached the reproductive age."}]},{"head":"Notes","index":96,"paragraphs":[{"index":1,"size":9,"text":"Any extra information worth noticing about a livestock species."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Form 9. Ruminant livestock inventory","index":97,"paragraphs":[{"index":1,"size":33,"text":"Indicate here the different ruminant livestock species (cattle, sheep, goats, camels) that are fed and taken care of by the household. Separate each species into categories for example: young cattle / adult cows."}]},{"head":"List of variables","index":98,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"ID","index":99,"paragraphs":[{"index":1,"size":15,"text":"A consecutive number to identify the livestock species or a category of a livestock species."}]},{"head":"Species","index":100,"paragraphs":[{"index":1,"size":22,"text":"The name of the livestock species Category A category is usually a group of the total herd or flock separated by age."},{"index":2,"size":23,"text":"For example young cattle / adult cows. Discuss with the respondent and try to record the categories he can recognize in his/her herd/flock."}]},{"head":"Breed","index":101,"paragraphs":[{"index":1,"size":12,"text":"Whether the livestock is local, a cross-breed or a pure exotic breed."}]},{"head":"Number of animals","index":102,"paragraphs":[{"index":1,"size":13,"text":"Indicate here the number of animals in each category for each livestock species."}]},{"head":"Gender ownership","index":103,"paragraphs":[{"index":1,"size":27,"text":"Whether the livestock is own by a male, female or jointly owned. The concept of ownership can be site specific, discuss with the respondent to clarify ownership."},{"index":2,"size":28,"text":"It refers normally to who makes final decision on the farm and products and has for example the power to decide when to sell or keep the products."},{"index":3,"size":12,"text":"Age Indicate here the age ranges for the animals in each category."}]},{"head":"Sex","index":104,"paragraphs":[{"index":1,"size":10,"text":"Whether the animals in such category are males or females."}]},{"head":"Number of offspring in a period 5","index":105,"paragraphs":[{"index":1,"size":14,"text":"Number of offspring in a period of time, for example: \"one every six months\"."}]},{"head":"Pregnant","index":106,"paragraphs":[{"index":1,"size":4,"text":"Number of pregnant animals."}]},{"head":"Lactating","index":107,"paragraphs":[{"index":1,"size":4,"text":"Number of lactating animals."},{"index":2,"size":9,"text":"Lactation period Indicate average number of months in lactation."},{"index":3,"size":20,"text":"Milk yield peak This is the maximum yield produced in a period of time, for example: 8 litres a day."},{"index":4,"size":21,"text":"Milk yield minimum This is the minimum yield produced in a period of time, for example: 1/3 of litre a day."}]},{"head":"Weaning age","index":108,"paragraphs":[{"index":1,"size":10,"text":"At what time the off-springs are removed from their dams."}]},{"head":"For animal traction","index":109,"paragraphs":[{"index":1,"size":12,"text":"Indicate the number of animals in the category used for animal traction."},{"index":2,"size":23,"text":"Present last year This indicates that there were no changes in the numbers of animals in this category. All were present last year."}]},{"head":"Total number last year","index":110,"paragraphs":[{"index":1,"size":29,"text":"The number of animals present last year. If the total last year is not the same of the present year record the numbers coming in and out the herd/flock."}]},{"head":"Born","index":111,"paragraphs":[{"index":1,"size":13,"text":"Number of animals born in the household between last year and this year."},{"index":2,"size":18,"text":"Gifts / dowry in Number of animals acquired as gifts or dowry between last year and this year."}]},{"head":"Purchased","index":112,"paragraphs":[{"index":1,"size":10,"text":"Number of animals purchased between last year and this year."},{"index":2,"size":8,"text":"Total paid Total paid for the purchased animals. "}]},{"head":"Deaths","index":113,"paragraphs":[]},{"head":"Labour required","index":114,"paragraphs":[{"index":1,"size":56,"text":"Indicate here the time required to perform the activity by a person in the three categories above. This should be recorded using the units the farmer utilizes. Please remember to describe the time as detailed as possible because it has to be transformed to Frequency (days / month) + Time (hours / day) during data entry."}]},{"head":"Cost of hired labour (currency and unit)","index":115,"paragraphs":[{"index":1,"size":36,"text":"Indicate here the cost of the labour described in local currency and units. Please remember to describe the cost as detailed as possible because it has to be transformed to currency / hour during data entry."}]},{"head":"Other cost","index":116,"paragraphs":[{"index":1,"size":8,"text":"Describe here other costs incurred in the activity."}]},{"head":"Amount used (amount and unit)","index":117,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the amount used of the input and the local unit of measurement. Please remember to describe the unit as extensive as possible because it has to be transformed to kg or litre during data entry."}]},{"head":"Price per unit","index":118,"paragraphs":[{"index":1,"size":12,"text":"Indicate here the cost of the input per local unit of measurement."},{"index":2,"size":25,"text":"Please remember to describe the cost as extensive as possible because it has to be transformed to currency / kg or litre during data entry."}]},{"head":"Notes","index":119,"paragraphs":[{"index":1,"size":10,"text":"Any extra information worth noticing about an activity or input."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226 "}]},{"head":"Feed","index":120,"paragraphs":[{"index":1,"size":8,"text":"The sort of feed given to the livestock"}]},{"head":"Source","index":121,"paragraphs":[{"index":1,"size":111,"text":"The source of the feed. For on-farm feeds the farmers usually merge the production from different plots before given it to the animals thus is not possible to trace the plot/subplot of origin. For this cases write down \"on-farm\", however probe if the farmer knows the plot/subplot of origin as different varieties may target different outlets. Use the forms detailing crop production as reference (Form 6 and 12). For purchased feed write \"purchased\" Quantity given and unit of measure This is the quantity given to the animals in local units. Please remember to describe the unit as detailed as possible because it has to be transformed to kg during data entry."}]},{"head":"How often in a week","index":122,"paragraphs":[{"index":1,"size":12,"text":"How often in a week such quantity is given to the animals."},{"index":2,"size":12,"text":"Feeding period How long it takes for the feed to get finished."},{"index":3,"size":13,"text":"Price paid If the feed is purchased indicate here the total price paid."}]},{"head":"Estimated market value","index":123,"paragraphs":[{"index":1,"size":13,"text":"If the feed is on-farm indicate here the market price of such feed."},{"index":2,"size":9,"text":"Other costs Other costs incurred in feeding the animals."}]},{"head":"Notes","index":124,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about a feed."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":3,"size":69,"text":"Form 12. Production of livestock products Indicate here the production of livestock products for example: poultry for consumption, eggs, cow milk. Do not include here services like ploughing. Ploughing as an activity must be included as an input in Form 5 as on-farm input use. If ploughing is a service please include it as source of income in Form 13. Do the same with other services provided by livestock."}]},{"head":"List of variables","index":125,"paragraphs":[]},{"head":"Name Description","index":126,"paragraphs":[{"index":1,"size":40,"text":"Livestock ID, Livestock + Category Indicate here the livestock linked to the product. It is possible to indicate a livestock ID (from Form 9), a livestock species in general, or a category for example: \"1\" or \"Chickens\" or \"Female cattle\"."}]},{"head":"Product","index":127,"paragraphs":[{"index":1,"size":13,"text":"The type of product produced by a livestock species Production (quantity and unit)"},{"index":2,"size":25,"text":"Indicate the production in local units as given by the respondent. Each local unit and its equivalence to kg must be written by the enumerator."}]},{"head":"Sales (quantity, unit and price per unit)","index":128,"paragraphs":[{"index":1,"size":43,"text":"Indicate here the quantity of the production used for sale. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg and the price to currency / kg during data entry."}]},{"head":"Who controls the income","index":129,"paragraphs":[{"index":1,"size":33,"text":"Whether the income is controlled by a male, female member of the household or jointly controlled. The concept of ownership can be site specific, discuss with the respondent to clarify ownership if necessary."}]},{"head":"Human consumption","index":130,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the quantity of the product used for human consumption. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg during data entry."}]},{"head":"Other","index":131,"paragraphs":[{"index":1,"size":37,"text":"Indicate here the quantity of the production used for other purposes. It is possible to indicate this quantity in local units or proportion however, be aware that this quantity must be converted to kg during data entry."}]},{"head":"Notes","index":132,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about a product."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"},{"index":3,"size":39,"text":"Form 13. Other income Indicate here other sources of income received by the household members. For example: business in local market, remittances, animal traction. Food aid must not be included here, use form 16 for any food aid items."}]},{"head":"List of variables","index":133,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"Income description","index":134,"paragraphs":[{"index":1,"size":5,"text":"The description of the income"}]},{"head":"Currency","index":135,"paragraphs":[{"index":1,"size":30,"text":"The amount received from the income How often How often such amount is received. For example: \"per day\", \"per month\", \"every six month\", \"at the end of the year\", etc."}]},{"head":"Who controls the income","index":136,"paragraphs":[{"index":1,"size":33,"text":"Whether the income is controlled by a male, female member of the household or jointly controlled. The concept of ownership can be site specific, discuss with the respondent to clarify ownership if necessary."}]},{"head":"Notes","index":137,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about an income."}]},{"head":"Form 14. Other expenses","index":138,"paragraphs":[{"index":1,"size":32,"text":"Indicate here other expenses incurred by the household members. For example: school fees, payment of loan. The acquisition of food must not be included here, use form 16 for any food items."}]},{"head":"List of variables","index":139,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"Expense description","index":140,"paragraphs":[{"index":1,"size":12,"text":"The description of the expense. We provide a check list on activities"}]},{"head":"Currency","index":141,"paragraphs":[{"index":1,"size":3,"text":"The amount expended"}]},{"head":"How often","index":142,"paragraphs":[{"index":1,"size":25,"text":"How often such amount is expended. For example: \"per day\", \"per month\", \"every six month\", \"at the end of the year\", \"per school term\", etc."}]},{"head":"Notes","index":143,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about an expense."}]},{"head":"Some additional comments and examples:","index":144,"paragraphs":[{"index":1,"size":58,"text":"• A farmer may receive money through a loan, this should be consider such as an income, but from another side when the farmer is giving back the money this becomes for him a cost/expenses. In this last case the payment of the loan becomes an expense. On the other hand loan goes under income, form 13, once."}]},{"head":"•","index":145,"paragraphs":[{"index":1,"size":19,"text":"The cost of the transport to go to buy seeds should be recorded in form 14 under other expenses."},{"index":2,"size":74,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226 Form 15. Household consumption of on-farm products Indicate here the household consumption of on-farm products for example: maize produced in the farm. Usually farmers merge the production from different plots before consumption thus is not possible to trace the plot/subplot of origin. For this cases leave the plot and subplot columns empty, however probe if the farmer knows the plot/subplot of origin. Use the forms detailing production as reference (form 6 and 12)."},{"index":3,"size":77,"text":"Organize the discussion in two different periods of time: good and bad times. Start with products available in good times then check whether they are consumed as well during bad times. If an on-farm product is substituted by an off-farm product, include the off-farm in form 16. For example: in good times the household members eat maize produced on-farm while in bad times maize must be purchased. For each good/bad period of time indicate the start-end months."}]},{"head":"List of variables","index":146,"paragraphs":[]},{"head":"Name Description","index":147,"paragraphs":[{"index":1,"size":9,"text":"Good time period Start-end month of the good times."}]},{"head":"Bad time period","index":148,"paragraphs":[{"index":1,"size":6,"text":"Start-end month of the bad times."}]},{"head":"Timing","index":149,"paragraphs":[{"index":1,"size":10,"text":"Where the product is consumed during good or bad times."}]},{"head":"Crop, livestock or aquaculture variety","index":150,"paragraphs":[{"index":1,"size":11,"text":"The type of crop, livestock or aquaculture species that is consumed."}]},{"head":"Product","index":151,"paragraphs":[{"index":1,"size":12,"text":"The product of the crop, livestock or aquaculture species that is consumed"}]},{"head":"Plot, subplot","index":152,"paragraphs":[{"index":1,"size":59,"text":"For on-farm products the farmers usually merge the production from different plots before consumption thus is not possible to trace the plot/subplot of origin. For this cases write down \"on-farm\", however probe if the farmer knows the plot/subplot of origin as different varieties may target different outlets. Use the forms detailing crop production as reference (Form 6 and 12)."}]},{"head":"Consumption quantity and unit","index":153,"paragraphs":[{"index":1,"size":29,"text":"This is the quantity consumed in local units. Please remember to describe the unit as detailed as possible because it has to be transformed into kg during data entry."}]},{"head":"How often in a week","index":154,"paragraphs":[{"index":1,"size":9,"text":"How often in a week such quantity is consumed."}]},{"head":"Consumption period","index":155,"paragraphs":[{"index":1,"size":9,"text":"For how long in months is this product consumed."}]},{"head":"Notes","index":156,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about a product."}]},{"head":"Some additional comments:","index":157,"paragraphs":[{"index":1,"size":70,"text":"Sometimes the farmer gives food to some people working on the farm that are not part of the household. This consumption should be recorded in form 6. When the food is given in form of in-kind payment, this amount should be reported under form 6 and in the notes should be specified that this was used as payment. Similarly this quantity should be reported in form 5 under \"other costs\"."}]},{"head":"Form 17. Farm and domestic assets","index":158,"paragraphs":[{"index":1,"size":58,"text":"Indicate here the assets the household owns. The list given may not be extensive for your site. If a product is not listed please include it in others. For each asset ask how many the household have in total and based in its age allocate them across the three age categories. Also distribute the total number by gender."}]},{"head":"List of variables","index":159,"paragraphs":[{"index":1,"size":2,"text":"Name Description"}]},{"head":"Name of asset","index":160,"paragraphs":[{"index":1,"size":19,"text":"The asset. If an asset mentioned by the respondent is not present in the list add it to others."}]},{"head":"Total number owned","index":161,"paragraphs":[{"index":1,"size":10,"text":"The total number of an asset owned by the household"}]},{"head":"Relative age average","index":162,"paragraphs":[{"index":1,"size":33,"text":"Disaggregate here the total number owned in three categories: those which are less than three years old, those between three and seven years old, and those which are more than seven years old."}]},{"head":"Number owned by male, female and jointly","index":163,"paragraphs":[{"index":1,"size":14,"text":"Disaggregate here the total number owned by household members of each gender or jointly."}]},{"head":"Notes","index":164,"paragraphs":[{"index":1,"size":8,"text":"Any extra information worth noticing about an asset."},{"index":2,"size":16,"text":"5. Select the directory where you extracted the HH Survey.zip files and select the file CCAFS_Survey."},{"index":3,"size":73,"text":"6. You will then be prompted to select a data file. Select a directory for such file and called it CCAFS_Survey_data_siteName.dat. 8. The computer will now request an 'Operator ID' -enter your first name. This will be your ID for all data entry that you carry out. 9. You are now ready to enter the data for your 1 st baseline adult female survey, by keying in the entries from the paper document."},{"index":4,"size":67,"text":"10. It is highly advisable to save the work after every 'form' entry. This is advisable since CSPro has a bug that sometimes occurs and if you had not saved your work, then could lose all the entries you have made. This is called partially saving and can be done by clicking the Save/partial save option under the File menu or using Ctrl + S key combination."},{"index":5,"size":45,"text":"11. When you have entered an entire survey (or have partially completed a survey), make sure you save before you stop the data entry process. To stop the data entry process click on the STOP symbol on the toolbar or press the Escape (Esc) key."},{"index":6,"size":24,"text":"12. On saving, each questionnaire survey entry will be saved with the unique ID code and these will be shown in the left-hand window:"},{"index":7,"size":78,"text":"To re-open a partially saved or saved survey double-click on the case name (household ID) shown in the left-hand column, shown above. 13. Every evening make a back-up of the folder that contains the CSPro surveys. This will help avoid data loss incase of any unforeseen happening and allow for periodical data entered sending to Nairobi. You could place this on a memory stick to ensure that it is not lost if any problems occur with your computer."},{"index":8,"size":38,"text":"14. When all surveys have been entered, zip the folders from the different computers together and send to Nairobi where consolidation of the entered data will be done. Send to: Carlos Quiros ([email protected]) and Mariana Rufino ([email protected] )."}]},{"head":"Data entry tips and guidelines:","index":165,"paragraphs":[]},{"head":"Modes of Operation","index":166,"paragraphs":[{"index":1,"size":16,"text":"There are five different modes or states of operation within Data Entry. They are as follows:"},{"index":2,"size":4,"text":"Add -Entering new cases."},{"index":3,"size":5,"text":"Modify -Modifying previously entered cases."},{"index":4,"size":5,"text":"Verify -Verifying previously entered cases."},{"index":5,"size":33,"text":"Pause -Temporarily stop adding, modifying, or verifying cases. The timer maintained for statistics collection is suspended. Pause is used when you plan to continue from where you left off after a short delay."},{"index":6,"size":15,"text":"Stop -No adding, modifying, or verifying cases in the data file. No form is visible."}]},{"head":"Cases","index":167,"paragraphs":[{"index":1,"size":24,"text":"A case is the primary unit of data in the data file. A case usually corresponds to a questionnaire, in this survey a household."}]},{"head":"Forms","index":168,"paragraphs":[{"index":1,"size":17,"text":"A form appears on the right-hand side of the screen when you Add, Modify, or Verify cases."},{"index":2,"size":68,"text":"A form contains data fields and text. Forms may be larger than the actual screen area. The form will scroll automatically to ensure that the field you are entering is visible on the screen. These data entry applications consist of several forms. As you complete one form the next form is presented. If you move backward from the first field on a form, the previous form is presented. "}]},{"head":"Fields","index":169,"paragraphs":[{"index":1,"size":73,"text":"A field is the basic element on the data entry form into which you enter data During data entry the cursor moves from one field to the next, according to the order and rules defined by the data entry application Fields are shown on the form as boxes Some fields cannot be entered. They may contain either data previously entered on another form or protected fields. Such fields appear dark gray in color."}]},{"head":"Rosters","index":170,"paragraphs":[{"index":1,"size":57,"text":"A roster is table of related items (e.g. household membership table) Individual fields show as column headings Each row of the roster therefore corresponds to an occurrence of this group member The rows repeat as many times as we defined in the data dictionary. We have tried to ensure the maximum possible number of rows is available."},{"index":2,"size":7,"text":"Navigation through the survey is as follows:"},{"index":3,"size":15,"text":"Use the \"/\" (slash) key on the numeric keypad to jump to the next row."},{"index":4,"size":43,"text":"Use the \"Ctrl\" +\"/ \" key to jump out of the current roster (table or question) and go to the next Never use \"Ctrl + F12\" as this will add null to all the sections in the questionnaire making further modifications very difficult."}]},{"head":"Field Colours","index":171,"paragraphs":[{"index":1,"size":19,"text":"The Data Entry module uses colours (as shown in the diagram below) to indicate the status of each field."}]},{"head":"WHITE -Data","index":172,"paragraphs":[{"index":1,"size":89,"text":"have not yet been entered as you have not reached this part of the survey GREEN -You have passed through this field for data entry input but have not moved backwards over it. If you move backwards over green fields, they become yellow. YELLOW -You have passed through this field for data entry input and have moved backwards over it or you have skipped over this field during data entry. Green and yellow shows you the \"high-water mark\", that is, how far forward you have reached in this case."},{"index":2,"size":1,"text":"CCAFS_Training_Manual_For_HH_Survey-English-20121226"}]},{"head":"Value set","index":173,"paragraphs":[{"index":1,"size":40,"text":"The value set provides the user with the listing of the acceptable codes/entries for a specific field. This is similar to look-up tables in MS-ACCESS. Values outside this listing will not be accepted and will invoke an appropriate error message."}]},{"head":"Validation and null values","index":174,"paragraphs":[{"index":1,"size":36,"text":"The questionnaire has been set up to not allow null values in numeric fields. This means that pressing \"Tab\" in an empty field will invoke an error message. All numeric values must be set to 0."},{"index":2,"size":48,"text":"The following keys/combination of keys have special meaning in the data entry process: F8 -Clears the error message and allows one to continue with the data entry process Ctrl + C -Pressing this key combination displays a list of acceptable codes to be entered for a specific field"}]},{"head":"Special entry codes","index":175,"paragraphs":[{"index":1,"size":25,"text":"The following values have been used in the development of this CSPro Data entry application and have some special meaning for our data entry purposes:"},{"index":2,"size":41,"text":"• -777 = 'Other' This value will be input in case another option rather than the specified categories has to be entered. On typing -77, the data entry person will be required to specify the additional option in the Other-specify field."},{"index":3,"size":54,"text":"• -888 = 'Empty' or 'Not Applicable' This value will be input if an empty or Not Applicable is encountered in the filled questionnaire. For the majority of 'not applicable' entries the database has been designed to 'skip' the field so the data entry personnel do not have to enter anything into the field."},{"index":4,"size":30,"text":"• -999 = 'Not clear in paper' This value will be input if a value is not clear in the paper questionnaire but there should have been a value entered."}]},{"head":"Notes:","index":176,"paragraphs":[{"index":1,"size":72,"text":"i. In case you enter a household code that is already entered, the case (the whole survey) will not be accepted/saved since the household code should be unique (no duplicates). ii. If you enter a wrong Household code or need to make a modification on already entered data for a survey you can click on the data file that corresponds to that questionnaire from the left window and make modification, then save."},{"index":2,"size":66,"text":"iii. CSPro can occasionally freeze the whole application due to some bugs in the application. When this happens press Ctrl + Alt + Del key combination to access the task manager, then click on the CSPro entry application, and click on End Task. After this the data entry application will be closed and you will need to re-open again to continue with the data entry process."}]}],"figures":[{"text":"Figure 1 : Figure 1: Delimitation of three production systems in the Nyando (Kenya) research grid. "},{"text":" For example: CCAFS_Survey_data_nyando.dat. Click open. 7. The first time you open the file the computer will say the file does not exist. Do you want to create a new file? Select YES. Later, when you open the Data Entry application the computer will select the last data file automatically. "},{"text":" Number of animals dead between last year and this year.Indicate here the different labour activities carried out for each livestock species and categories. Some activities could imply the use of inputs for example: vaccination implies the acquisition of vaccines. Under each activity please indicate any input used if applicable. No not include feeds as an input, please include them in Form 11. Form 10. Livestock activities and inputs Form 10. Livestock activities and inputs List of variables  List of variables Name Description NameDescription Livestock ID, Livestock + Category Gifts / dowry out Activity / input Indicate here the livestock linked to the activity. It is possible to indicate a livestock ID (from Form 9), a livestock species, or sets of categories for example: \"Cattle + Sheep + Goats\" or \"All animals\" or \"All females\". Number of animals given away as gifts or dowry between last year and this year. Indicate here the activity performed or the input used. Livestock ID, Livestock + Category Gifts / dowry out Activity / inputIndicate here the livestock linked to the activity. It is possible to indicate a livestock ID (from Form 9), a livestock species, or sets of categories for example: \"Cattle + Sheep + Goats\" or \"All animals\" or \"All females\". Number of animals given away as gifts or dowry between last year and this year. Indicate here the activity performed or the input used. Consumed Labour owned (Male and Number of animals consumed between last year and this year Indicate here the number of people segregated by gender and type Consumed Labour owned (Male andNumber of animals consumed between last year and this year Indicate here the number of people segregated by gender and type Sold female) or hired labour Number of animals sold between last year and this year. used to perform the activity. Sold female) or hired labourNumber of animals sold between last year and this year. used to perform the activity. Total sold Total amount obtained through sales. Total soldTotal amount obtained through sales. Others Number of animals entering/exiting the herd for other circumstances between last year and this year OthersNumber of animals entering/exiting the herd for other circumstances between last year and this year Notes Any notes NotesAny notes CCAFS_Training_Manual_For_HH_Survey-English-20121226 CCAFS_Training_Manual_For_HH_Survey-English-20121226  "},{"text":" Form 11. Livestock feeding Indicate here the different feeds (on-farm and purchased) that the livestock gets in different seasons. For each feed you must indicate the quantity given and the unit of measure for such quantity. If the feed is purchased indicate the price paid. For on-farm feeds indicate the estimated market value. List of variables  List of variables Name Description NameDescription  Indicate here the livestock linked to the activity. It is possible to indicate Indicate here the livestock linked to the activity. It is possible to indicate Livestock ID, Livestock + a livestock ID (from Form 9), a livestock species or series of species, or Livestock ID, Livestock +a livestock ID (from Form 9), a livestock species or series of species, or Category sets of categories for example: \"Cattle + Sheep + Goats\" or \"All animals\" Categorysets of categories for example: \"Cattle + Sheep + Goats\" or \"All animals\"  or \"All females\". or \"All females\". Season The season where the feeding takes place. It is possible to indicate \"All seasons\" SeasonThe season where the feeding takes place. It is possible to indicate \"All seasons\"  "}],"sieverID":"2025fcd9-0597-4aa8-9983-f05b0c2e6fe1","abstract":"CCAFS_Training_Manual_For_HH_Survey-English-20121226 Climate Change, Agriculture and Food Security (CCAFS) Household Survey-IMPACTlite Training ManualHow often in a week How often in a week such quantity is consumed.Consumption period How long it takes for the product to get finished."}

data/part_2/05eb469e7476823566a2a22a73efde3f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05eb469e7476823566a2a22a73efde3f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8529027d-0ea1-4b60-abd5-9d7d8361a1b8/retrieve"},"pageCount":13,"title":"Diversity and Identification of Plant-Parasitic Nematodes in Wheat-Growing Ecosystems","keywords":["Keçici, A. ˙I.","Bozbu ga, R.","Öcal, A.","Yüksel, E.","Özer, G.","Yildiz, Ş.","Lahlali, R.","Slaats, B.","Dababat, A.A.","˙Imren, M. Diversity and ITS region","plant-parasitic nematodes","Sakarya","wheat"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":106,"text":"Türkiye is one of the world's top 10 wheat producers, with 20 million tonnes of average annual wheat production [1]. Wheat production in Türkiye climbed from 10.7 thousand tons in 1971 to 18.2 thousand tons in 2020, expanding at an annual increase of 1.85% yearly pace on average [2]. However, wheat yield is highly variable among the different geographical zones of Türkiye, primarily because of climatic conditions and poor management methods of plant disease and pests [3]. In 2021-2022, the wheat planting area dropped to 7.05 million hectares, with a total production of 17.6 million tons, which is insufficient to meet Türkiye's wheat industry's needs [2]."},{"index":2,"size":155,"text":"Fungus and nematode-induced soil-borne diseases are among the main constraints in agricultural production and are quite challenging to be managed. Plant-parasitic nematodes alone are responsible for nearly 10% of yield losses worldwide, resulting in economic losses of over USD 125 billion per year [4,5]. However, yield losses associated with PPNs generally go unnoticed by a great proportion of farmers due to the soil-dwelling nature of most PPNs and the similarity of symptoms with other biotic and abiotic disease-inducing factors. Even though it is established that the problem is nematode-originated, it is still quite difficult to differentiate PPN species due to the co-occurrence of different species of PPNs in the field and the complexity of diagnostic characteristics. Among the PPNs that cause a reduction in the yield and profitability of wheat production, Cyst (Heterodera spp.), Root-lesion (Pratylenchus spp.), Root-knot (Meloidogyne spp.), Seed-gall (Anguina spp.), and Stubby-root nematodes (Paratrichodorus spp.) are the most economically important genera [6]."},{"index":3,"size":134,"text":"The sedentary endoparasites are the most injurious and economically destructive groups attacking cereals [6,7]. Cyst nematodes have been extensively investigated as a category of endoparasitic nematodes as they lead to substantial yield losses. Numerous research studies have been conducted to clarify the biology of cyst nematodes concerning their host plants [8,9]. Cyst nematodes, such as Heterodera, infect various host plants, including wheat [10,11]. This genus has 12 known species with overlapping morphological features, making it difficult to separate them, especially when they occur in the same niche [12,13]. Molecular diagnostic tools enable researchers to correctly and rapidly identify morphologically indistinct PPN species. The internal transcribed spacer sequences (ITS) region, including non-coding ITS1 and ITS2, and the 5.8S region of ribosomal DNA (rDNA), have proved very beneficial in accurately identifying and characterizing PPN species [14,15]."},{"index":4,"size":109,"text":"In Türkiye, Heterodera spp. populations obtained from different wheat cropping systems have mainly been identified based on their morphology/morphometrics and molecular tools [16][17][18][19][20]. Although Sakarya is one of the significant wheat-producing provinces of Türkiye in the Marmara region, our knowledge is still insufficient regarding the morphometrics and genetics of CCNs, including the diversity and variability of CCN. Thus, the specific objectives of this study were to (i) investigate the occurrence and prevalence of the important plant-parasitic nematode genera in the Marmara region, (ii) identify both mature cysts and second-stage juveniles (J2s) of H. filipjevi group using morphological/morphometrical and molecular tools, and (iii) examine polygenetic relationships of the collected populations."}]},{"head":"Materials and Methods","index":2,"paragraphs":[{"index":1,"size":63,"text":"Soil samples were collected from Hendek, Pamukova, Geyve, Akyazı, and the Central districts of monoculture cereal production areas in Sakarya province in 2018 (Figure 1). Surveys were performed during wheat's heading and flowering times for migratory nematodes and at harvesting time for the sedentary nematodes. A total of 40 soil samples were randomly collected from each location for each sampling time (Table 1)."},{"index":2,"size":74,"text":"A modified Baermann funnel technique was employed to recover motile nematodes from 100 cm 3 of soil per soil sample [21]. The extracted nematodes were transferred to cylinder measures and allowed to sink and settle down at the bottom for 8 h before pouring the settled nematodes into 15 mL tubes. Migratory nematodes were counted and identified to the genus level using a light microscope (DM1000, Leica Microsystems, Wetzlar, Germany) at 100× magnification [22]."},{"index":3,"size":140,"text":"cylinder measures and allowed to sink and settle down at the bottom for 8 h before pouring the settled nematodes into 15 mL tubes. Migratory nematodes were counted and identified to the genus level using a light microscope (DM1000, Leica Microsystems, Wetzlar, Germany) at 100× magnification [22].    The modified sieving-decanting method was used to remove sedentary nematodes (Heterodera spp.) from 200 cm 3 of soil using 60 mesh (0.25 mm) and 100 mesh (0.015 mm) sieves, as described by [21,22]. From each sample, at least ten healthy cysts were handpicked and kept at 4 • C for genetic and morphological examinations. Sedentary nematodes were morphologically identified to the genus level under a stereomicroscope (Zeiss Stemi 305, Carl Zeiss, Jena, Germany). The incidence of the nematode (number of samples with nematode/total number of samples) was computed for each sample location [23]."},{"index":4,"size":170,"text":"Second-stage juveniles and males were relaxed in a water bath at 65 • C for 5 min, fixed in a mixture of ethanol, acetic acid, and formalin (20:6:1), processed into glycerine solution, and mounted on permanent slides with anhydrous glycerin and paraffin seal [23,24]. Measurements were taken for the following morphological structures: length, width at the midbody, stylet length, labial region height and width, dorsal oesophageal gland to spear knobs base, anterior end to the median bulb, anterior end to excretory pore, oesophageal length, width at the anus and hyaline region, tail length, hyaline tail length, and spicules length (males). To see the vulval cone, cysts were soaked in 45% of lactic acid for 15 min, transferred to water, dissected, and mounted in glycerin with a paraffin seal for viewing and analysis [23][24][25]. The vulval slit length, fenestral length, and breadth were all measured. All measurements were measured under a light microscope (CX31, Olympus, Tokyo, Japan) equipped with the Infinity Analyze software version 6.5.2 (Lumenera Inc., Ottawa, ON, Canada) [26,27]."},{"index":5,"size":54,"text":"The data were analyzed using analysis of variance (ANOVA) techniques in the SPSS 10.0 software for Windows (SPSS Inc., Chicago, IL, USA) to evaluate if there were any statistically significant differences between the populations (p ≤ 0.05). The standard test of means was used to detect if the variance across populations is statistically significant."},{"index":6,"size":143,"text":"DNA extraction and PCR reaction to amplify the ITS of ribosomal DNA using the Direct PCR Master kit (Cat. No. PCR-111S; Jena Bioscience GmbH, Jena, Germany) following the manufacturer's recommendations. A single cyst from each sample was used for direct PCR amplification via the Direct PCR Master kit. PCR reaction mix consisted of 1 of sample lysate, 2 µL of each 10 µM forward primer AB28 (5 -CGTAACAAGGTAGCTGTAG-3 ), and reverse TW81 (5 -TCCTCCGCTAAATGATATG3 ) (28); 25 µL Direct PCR Master Mix, and PCR-grade water up to 50 µL [25]. PCR conditions included initial denaturation at 94 • C for 4 min, 35 cycles at 94 • C for 1 min, 55 • C for 1.5 min, 72 • C for 2 min, and final elongation at 72 • C for 10 min in a T100 thermal cycler (Bio-Rad, Hercules, CA, USA) [28,29]."},{"index":7,"size":158,"text":"The amplicons were purified and sequenced in both directions using the same primers by a commercial sequencing company (Macrogen Inc., Seoul, Korea). The DNA sequences were edited, and consensus sequences were computed manually using Mega X computing platforms [30]. All sequences were compared against the GenBank database, National Center for Biotechnological Information (NCBI), using the BLASTn algorithm and deposited in GenBank. The obtained isolates from this study plus additional sequences retrieved from the GenBank database were aligned in the MAFFT v.7 online interface using default settings and manually edited with MEGA X. A maximum likelihood (ML) tree of ITS data set was inferred using the command-line version of IQ-TREE 1.6.7 with ultrafast bootstrapping implemented with 1000 replicates. Analyses were run on the CIPRES Science Gateway V 3.3. [30][31][32][33]. The resulting trees were analyzed and edited in FigTree v1.4.2 software. The ITS sequence of Globodera pallida (HQ670281) was included as an outgroup to facilitate the production of consensus trees."},{"index":8,"size":111,"text":"The Shannon Diversity Index is a method to quantify species diversity in a community. It is calculated with the formula: H = −Σpi × ln(pi) that Σ: A Greek symbol that means \"sum\"; ln: Natural log; pi: The proportion of the entire community made up of species \"I\". A higher value of H represents a higher diversity of species in a specific community, while a lower value of H indicates a lower diversity within a particular community. The Shannon Equitability Index is a method to measure the evenness of species in a community [30]. The term \"evenness\" (EH) signifies how related the abundances of different species are in the community [30]."},{"index":9,"size":249,"text":"EH is calculated as: EH = H/ln(S), where H is the Shannon Diversity Index and S is the total number of unique species. This value ranges from 0 to 1, where 1 signifies whole evenness [33,34]. Shannon diversity index (H) is classified based on the subsequent grouping: low (H < 2), moderate (2 < H < 4), and high (H > 4) species of gastropods [34].  2). The PPN species were found in 92% of soil samples collected from Hendek, Pamukova, Geyve, Akyazı, and the Central districts of Sakarya province. The highest occurrence was detected in the genus of Tylenchus, having a frequency of 42% in the Geyve district, followed by Filenchus, having a frequency of 25% in the Taraklı district (Table 3). The lowest frequency was found for the genus of Boleodorus and Basiria with 5%. The economically important PPN genera detected in the surveyed areas were Pratylenchus, Heterodera, Helicotylenchus, Merlinius, Trophurus, Paratrophurus, Pratylenchoides, and Amplimerlinius (Table 3) [35,36]. The RLNs, Pratylenchus spp. populations were found in 45% of the soil samples collected from wheat fields in 18 different locations of Sakarya Province (Table 3). The nematodes were recorded from three, four, two, and five fields located in Hendek, Pamukova, Geyve, and Akyazı, respectively. Geyve has the lowest nematode occurrence rate in infested fields. The highest density of nematodes was 25 juveniles or mature nematodes per g of soil, which was obtained from Pamukova, while the lowest nematode density was detected in samples taken from Hendek (Table 4)."}]},{"head":"Results","index":3,"paragraphs":[]},{"head":"Occurrence of Plant-Parasitic Nematodes","index":4,"paragraphs":[{"index":1,"size":121,"text":"The cyst nematodes were found in 30% of wheat fields in Geyve, Taraklı, Sö gütlü and Kaynarca in Sakarya Province. All Heterodera populations were identified as H. filipjevi based on both morphological and molecular analysis. Heterodera filipjevi was found mostly in fields where monoculture systems are practiced, such as Geyve, Taraklı, and Kaynarca districts (Table 5). High cyst incidence levels were recorded in the fields of Kaynarca and Taraklı districts. The lowest infested fields were reported from the Sö gütlü district, where only one out of four fields was infested. The highest number of cysts was found in the Taraklı district with nine cysts, whereas the lowest number of two cysts was found in samples from the Central district (Table 5).  "}]},{"head":"Morphological Measurements","index":5,"paragraphs":[{"index":1,"size":180,"text":"Twelve H. filipjevi populations were identified in the samples from Geyve, Taraklı, and Central districts (Table 5). Morphometric and morphological characteristics have close similarities with those described by [37]. Lemon-shaped cysts with a posterior protuberance, the vulval cone was bifurcate with a horseshoe-shaped semifenestra and prominent bullae and underbridge (Figure 2). Cysts (n = 10) were measured for the following dimensions (range, mean, SD): body length without neck 780 µm (from 670 to 862 µm), neck length 95 µm (from 76 to 116 µm), fenestra length 52 µm (from 42 to 60 µm), and breadth 24.5 µm (from 21 to 27 µm) (Table 6). Juveniles in their second stage had a cylindrical form with a slightly offset head and a tapering circular tail tip. The stylet was robust, with shallow concave basal knobs on the front side (Figure 2). Heterodera filipjevi juveniles had a body length of 477-516 µm and a stylet length of 22-25 µm (Table 6), with fairly concave stylet knobs. Lateral fields were divided into four different lines; however, only the two inner lines were sometimes distinct.  "}]},{"head":"Molecular Features","index":6,"paragraphs":[{"index":1,"size":190,"text":"The sequences of the ITS rRNA gene recovered from the Sakarya Province tion of H. filipjevi (Sak_Hf11) varied by 1 bp from other H. filipjevi population. depicts the phylogenetic connections of Sakarya populations of H. filipjevi to oth lations derived from GenBank and species in the Avenae group. The phylogen tionships of H. filipjevi populations were compared to sequences from other coun cluding China, the USA, Italy, and Türkiye. The phylogenetic tree was construct 1000 bootstrapped sequence alignments randomly replicated globally. The H. fil quences constitute a single clade within the tree. Shannon diversity index (H) is classified based on the subsequent grouping: low (H < 2); moderate (2 < H < 4); and high (H > 4) species of gastropods [34]. In this study, the Shannon diversity index (H) was calculated as H = 2.31767 in 12 migratory nematode species in wheat fields. The value of the H index is between 2 and 4, which means moderate diversity of nematode genus. The evenness value was calculated as EH = 0.932699. These results showed that nematode evenness was high in wheat-planted areas because EH is close to 1 (Table 7). "}]},{"head":"Molecular Features","index":7,"paragraphs":[{"index":1,"size":95,"text":"The sequences of the ITS rRNA gene recovered from the Sakarya Province population of H. filipjevi (Sak_Hf11) varied by 1 bp from other H. filipjevi population. Figure 3 depicts the phylogenetic connections of Sakarya populations of H. filipjevi to other populations derived from GenBank and species in the Avenae group. The phylogenetic relationships of H. filipjevi populations were compared to sequences from other countries, including China, the USA, Italy, and Türkiye. The phylogenetic tree was constructed using 1000 bootstrapped sequence alignments randomly replicated globally. The H. filipjevi sequences constitute a single clade within the tree. "}]},{"head":"Discussion","index":8,"paragraphs":[{"index":1,"size":124,"text":"The results indicated that plant-parasitic nematodes were found in 92% of soil samples, and 13 taxa of nematodes were recovered from cereal roots and soil samples. Helicotylenchus spp., Heterodera spp., Merlinius spp., Pratylenchoides spp., Pratylenchus spp., Trophurus spp., Paratrophurus spp., Filenchus spp., Tylenchus spp., Scutylenchus spp., Amplimerlinius spp., Boleodorus spp., and Basiria spp. were detected in the surveyed areas. Results indicated a clear separation of the cyst nematode, H. filipjevi confirmed the link between genotyping and phenotyping traits. Any intraspecific polymorphism was not found among H. filipjevi populations placed in the same phylogenetic group and contributed to GenBank, as indicated by high bootstrap values (Figure 3). All accession numbers provided by GenBank for the populations obtained in this study are shown in Figure 3."}]},{"head":"Discussion","index":9,"paragraphs":[{"index":1,"size":131,"text":"The results indicated that plant-parasitic nematodes were found in 92% of soil samples, and 13 taxa of nematodes were recovered from cereal roots and soil samples. Helicotylenchus spp., Heterodera spp., Merlinius spp., Pratylenchoides spp., Pratylenchus spp., Trophurus spp., Paratrophurus spp., Filenchus spp., Tylenchus spp., Scutylenchus spp., Amplimerlinius spp., Boleodorus spp., and Basiria spp. were detected in the surveyed areas. Apart from Pratylenchoides sheri, Merlinus brevidens, Amplimerlinus vicia, Paratrophurus striatus, and P. acristylus, the most prevalent genera of PPNs were discovered previously in wheatproducing regions of Türkiye's Southeast Anatolian region [38]. Merlinius brevidens, Scutylenchus quadrifer, H. latipons, P. thornei, and Aphelenchus avenae were the most frequently discovered PPNs in the cereal cropping system of Adıyaman region in Türkiye [39]. Consequently, the identified genera are economically significant for grain production in Sakarya Province."},{"index":2,"size":212,"text":"The findings of this study revealed that there is an intensive presence of cereal cyst nematode species H. filipjevi in cereal growing locations (wheat and barley areas as main crops) from Geyve, Taraklı, Sö gütlü, and Kaynarca districts. The results suggested that 24% of the soil samples were infested with H. filipjevi in wheat production areas in Sakarya Province. The fields where cyst nematodes were not detected were generally rotated with other non-cereal crops. However, H. filipjevi was found mostly in monoculture system in Geyve, Taraklı, Sö gütlü, and Kaynarca districts (Table 3). High cyst incidence levels were recorded, e.g., four out of five and three out of four fields were infested in Kaynarca and Taraklı districts, respectively. Sö gütlü district has the lowest prevalence of infested fields, with just one out of every four fields affected. In an earlier study, the most extensively dispersed species were H. filipjevi, H. latipons, P. thornei, and P. neglectus in the Anatolia region of Türkiye [18]. Another study demonstrated that 56% of wheat fields in Elazig, Malatya, Sivas, Erzurum, Erzincan, Igdir, and Kars provinces in Türkiye were infected with H. filipjevi [36]. Imren et al. [40] observed that 83% of wheat fields in Bolu province, Türkiye, were infected with the cereal cyst nematode, H. filipjevi."},{"index":3,"size":67,"text":"Toktay et al. reported that the most prevalent phytophagous nematodes in cereal soils in Nigde province were those belonging to the genera Heterodera, Ditylenchus, Merlinius, Pratylenchus, Aphelenchus, Aphelenchoides, Tylenchus, Helicotylenchus, Trophurus, Pratylenchoides, Filenchus, and Xiphinema. [41]. It suggests that the presence of climatic circumstances conducive to H. filipjevi completing its life cycle may be a significant element in presenting a danger to grain output in Sakarya Province."},{"index":4,"size":148,"text":"The findings of this current study suggested that there is no discernible variability in H. filipjevi populations based on morphological variables, confirming that cyst and J2 body measurements vary. H. filipjevi is a close relative of H. avenae, with minor morphological differences separating them [36,37]. H. filipjevi has smaller bullae and a noticeable, though narrow, underbridge. H. latipons, on the other hand, was identified from H. filipjevi by its strong underbridge and lack of conspicuous bullae in the vulval cone. The absence of an underbridge and the presence of bullae around the vulval cone of H. filipjevi cysts are acknowledged as useful physical characteristics for identification. The vulval cones of H. filipjevi and H. latipons are readily differentiated by an underbridge and bullae in H. latipons [13,42,43]. In comparison to H. latipons, H. filipjevi second-stage juveniles have a longer tail, stylet, and hyaline section of the tail [42,43]."},{"index":5,"size":80,"text":"The Shannon diversity index estimates the diversity of species within a community and shows how diverse the species in a particular community are and their relative abun-dance [34]. The Shannon biodiversity index of migratory nematodes in wheat fields was moderate. This implies that wheat affects on nematode community. It is expected that nematode richness in the soil would be high in usually undisturbed ecosystems by human beings. This situation suggests that it may be related to monoculture agriculture (Table 7)."},{"index":6,"size":138,"text":"DNA data to determine phylogeny are well established for various groups of animals. Numerous articles have shown that molecular data may be a very significant resource for cyst nematode systematics [44][45][46][47][48]. The genetic variety of species, both inter-and intra-specific, has been found to be beneficial in identifying the nematode phylogeny. The use of molecular approaches in combination with the analysis of ribosomal RNA gene (rRNA) sequences has bolstered our confidence in our understanding of cyst nematode relationships [49,50]. Ribosomal RNA genes are one of the most well-characterized gene families in worms [51,52]. While the majority of the RNA genes are highly conserved, there is significant diversity in discrete parts of the genes, as well as the length and sequence of the spacer regions. Unlike their spacer sections, the ribosomal genes change slowly but retain some useful genetic information."},{"index":7,"size":131,"text":"Typically, the rRNA array consists of three ribosomal genes, 18S, 5.8S, and 28S, which are linked in repeating units together with their spacer segments, ITS1 and ITS2. This work demonstrated the significance of certain cyst and J2 body dimension traits in identifying various populations of H. filipjevi by comparing them to rDNA sequences. Molecular and morphological evidence indicate that species within the H. filipjevi population may be classified as a single group. Similarly, Bekal et al. [38] and Imren et al. [40] found little genetic diversity amongst H. filipjevi populations of Türkiye's Mediterranean area. Subbotin et al. [42], on the other hand, discovered intraspecific polymorphism within the H. filipjevi population. Toktay et al. [1] have also reported the presence of intraspecific diversity in Türkiye's Eastern Anatolian area of H. filipjevi population."}]},{"head":"Conclusions","index":10,"paragraphs":[{"index":1,"size":122,"text":"The main goal of this research was to identify the eco-regional distribution of the major genera of plant-parasitic nematodes in Sakarya Province, with a focus on the cereal cyst nematode species H. filipjevi. In conclusion, this survey makes the following recommendations to local technical personnel and researchers: diversify wheat cultivars to include durum wheat in areas with high cyst counts, as resistant durum wheat than spring wheat; apply cultural practices, especially crop rotation practices; breeding for germplasms with high resistance potentials against cereal cyst nematodes; and finally, educate more technical staff to work on soil-borne disease topics in the region. Additional extensive surveys in Sakarya province and comprehensive pathotype investigations of H. filipjevi are still required to draw a suitable control strategy."}]}],"figures":[{"text":"Figure 1 . Figure 1. Surveyed locations in the Sakarya province for plant-parasitic nematodes. "},{"text":"Figure 1 . Figure 1. Surveyed locations in the Sakarya province for plant-parasitic nematodes. "},{"text":"Figure 2 . Figure 2. Heterodera filipjevi image under light microscope: (A) second stage juveniles; (B gion; (C) tail region; (D) fenestral region. "},{"text":"Figure 2 . Figure 2. Heterodera filipjevi image under light microscope: (A) second stage juveniles; (B) head region; (C) tail region; (D) fenestral region. "},{"text":"Microorganisms 2022 , 14 Figure 3 . Figure 3. Phylogenetic tree based on maximum-likelihood using IQ-TREE ITS sequences of Heterodera populations. The bootstrap values (left) are at each node. Isolates obtained in this study are indicated in bold. "},{"text":"Figure 3 . Figure 3. Phylogenetic tree based on maximum-likelihood using IQ-TREE ITS sequences of Heterodera populations. The bootstrap values (left) are at each node. Isolates obtained in this study are indicated in bold. "},{"text":"Table 1 . The locations of the plant-parasitic nematodes collected from different wheat fields in the Sakarya province. No District Location Latitude Longitude NoDistrictLocationLatitudeLongitude 1 Hendek Beylice 40°83′13″ 30°84′80″ 1HendekBeylice40°83′13″30°84′80″ 2  Beylice 40°83′04″ 30°84′24″ 2Beylice40°83′04″30°84′24″ 3  Bıçkıatik 40°83′85″ 30°85′69″ 3Bıçkıatik40°83′85″30°85′69″ 4  Beylice 40°83′85″ 30°88′34″ 4Beylice40°83′85″30°88′34″ 5  Beylice 40°83′28″ 30°86′14″ 5Beylice40°83′28″30°86′14″ 6 Ferizli Karadiken 40°96′13″ 30°47′70″ 6FerizliKaradiken40°96′13″30°47′70″ 7  Sebiller 40°96′13″ 30°43′25″ 7Sebiller40°96′13″30°43′25″ 8  Doğancı 40°98′44″ 30°43′06″ 8Doğancı40°98′44″30°43′06″ 9  Karadiken 40°95′59″ 30°51′48″ 9Karadiken40°95′59″30°51′48″ 10  Karadiken 40°96′15″ 30°43′27″ 10Karadiken40°96′15″30°43′27″ 11 Kaynarca Kızılcaali 40°98′66″ 30°40′71″ 11KaynarcaKızılcaali40°98′66″30°40′71″ 12  Kızılcaali 40°98′27″ 30°40′58″ 12Kızılcaali40°98′27″30°40′58″ 13  Merkez 41°03′33″ 30°30′77″ 13Merkez41°03′33″30°30′77″ 14  Küçükkaynarca 41°03′38″ 30°32′48″ 14Küçükkaynarca41°03′38″30°32′48″ 15 Geyve Merkez 40°51′81″ 30°30′91″ 15GeyveMerkez40°51′81″30°30′91″ 16  Merkez 40°51′78″ 30°30′94″ 16Merkez40°51′78″30°30′94″ 17  Merkez 40°51′74″ 30°31′06″ 17Merkez40°51′74″30°31′06″ 18  Merkez 40°50′41″ 30°30′55″ 18Merkez40°50′41″30°30′55″ 19  Merkez 40°51′18″ 30°29′81″ 19Merkez40°51′18″30°29′81″ 20  Ilıca 40°45′25″ 30°38′10″ 20Ilıca40°45′25″30°38′10″ 21  Çamlık 40°45′24″ 30°37′93″ 21Çamlık40°45′24″30°37′93″ 22 Taraklı Hacıyakup 40°44′69″ 30°37′94″ 22TaraklıHacıyakup40°44′69″30°37′94″ 23  Hacıyakup 40°43′95″ 30°43′85″ 23Hacıyakup40°43′95″30°43′85″ 24  Hacıyakup 40°43′98″ 30°43′90″ 24Hacıyakup40°43′98″30°43′90″ 25  Aksu 40°44′64″ 30°45′37″ 25Aksu40°44′64″30°45′37″  "},{"text":"Table 1 . The locations of the plant-parasitic nematodes collected from different wheat fields in the Sakarya province. No. District Location Latitude Longitude No.DistrictLocationLatitudeLongitude 1 Hendek Beylice 40 • 83 13 30 • 84 1HendekBeylice40 • 83 1330 • 84 2  Beylice 40 • 83 04 30 • 84 2Beylice40 • 83 0430 • 84 3  Bıçkıatik 40 • 83 85 30 • 85 3Bıçkıatik40 • 83 8530 • 85 4  Beylice 40 • 83 85 30 • 88 4Beylice40 • 83 8530 • 88 5  Beylice 40 • 83 28 30 • 86 5Beylice40 • 83 2830 • 86 6 Ferizli Karadiken 40 • 96 13 30 • 47 6FerizliKaradiken40 • 96 1330 • 47 7  Sebiller 40 • 96 13 30 • 43 7Sebiller40 • 96 1330 • 43 8  Do gancı 40 • 98 44 30 • 43 8Do gancı40 • 98 4430 • 43 9  Karadiken 40 • 95 59 30 • 51 9Karadiken40 • 95 5930 • 51 10  Karadiken 40 • 96 15 30 • 43 10Karadiken40 • 96 1530 • 43 11 Kaynarca Kızılcaali 40 • 98 66 30 • 40 11KaynarcaKızılcaali40 • 98 6630 • 40 12  Kızılcaali 40 • 98 27 30 • 40 12Kızılcaali40 • 98 2730 • 40 13  Merkez 41 • 03 33 30 • 30 13Merkez41 • 03 3330 • 30 14  Küçükkaynarca 41 • 03 38 30 • 32 14Küçükkaynarca41 • 03 3830 • 32 15 Geyve Merkez 40 • 51 81 30 • 30 15GeyveMerkez40 • 51 8130 • 30 16  Merkez 40 • 51 78 30 • 30 16Merkez40 • 51 7830 • 30 17  Merkez 40 • 51 74 30 • 31 17Merkez40 • 51 7430 • 31 18  Merkez 40 • 50 41 30 • 30 18Merkez40 • 50 4130 • 30 19  Merkez 40 • 51 18 30 • 29 19Merkez40 • 51 1830 • 29 20  Ilıca 40 • 45 25 30 • 38 20Ilıca40 • 45 2530 • 38 21  Çamlık 40 • 45 24 30 • 37 21Çamlık40 • 45 2430 • 37 22 Taraklı Hacıyakup 40 • 44 69 30 • 37 22TaraklıHacıyakup40 • 44 6930 • 37 23  Hacıyakup 40 • 43 95 30 • 43 23Hacıyakup40 • 43 9530 • 43 24  Hacıyakup 40 • 43 98 30 • 43 24Hacıyakup40 • 43 9830 • 43 25  Aksu 40 • 44 64 30 • 45 25Aksu40 • 44 6430 • 45 26  Aksu 40 • 44 62 30 • 46 26Aksu40 • 44 6230 • 46 27  Aksu 40 • 44 52 30 • 46 27Aksu40 • 44 5230 • 46 28  Aksu 40 • 44 37 30 • 47 28Aksu40 • 44 3730 • 47 29 Sö gütlü Merkez 40 • 44 28 30 • 43 29Sö gütlüMerkez40 • 44 2830 • 43 30  Merkez 40 • 44 13 30 • 43 30Merkez40 • 44 1330 • 43 31  Merkez 40 • 86 42 30 • 49 31Merkez40 • 86 4230 • 49  "},{"text":"Table 1 . Cont.     No. District Location Latitude Longitude No.DistrictLocationLatitudeLongitude 32 Akyazı Merkez 40 • 89 69\" 30 • 46 43\" 32AkyazıMerkez40 • 89 69\"30 • 46 43\" 33  Merkez 40 • 67 62\" 30 • 62 37\" 33Merkez40 • 67 62\"30 • 62 37\" 34  Şerefiye 40 • 61 73\" 30 • 67 32\" 34Şerefiye40 • 61 73\"30 • 67 32\" 35  Şerefiye 40 • 61 68\" 30 • 67 43\" 35Şerefiye40 • 61 68\"30 • 67 43\" 36  Merkez 40 • 05 33\" 30 • 85 00\" 36Merkez40 • 05 33\"30 • 85 00\" 37 Pamukova Merkez 40 • 05 32\" 30 • 85 06\" 37PamukovaMerkez40 • 05 32\"30 • 85 06\" 38  Mekece 40 • 45 44\" 30 • 04 85\" 38Mekece40 • 45 44\"30 • 04 85\" 39  Mekece 40 • 45 51\" 30 • 04 72\" 39Mekece40 • 45 51\"30 • 04 72\" 40  Mekece 40 • 45 48\" 30 • 04 28\" 40Mekece40 • 45 48\"30 • 04 28\"  "},{"text":" The genera of PPNs; Helicotylenchus Steiner 1945, Heterodera Schmidt 1871, Merlinius Siddiqi 1970, Pratylenchoides Winslow 1958, Pratylenchus Filipjev 1936, Trophurus Loof 1956, Paratrophurus Arias 1970, Filenchus Andrassy 1954, Tylenchus Bastian 1865, Scutylenchus Jairajpuri 197, Amplimerlinius Siddiqi 1976, Boleodorus Thorne 1941, and Basiria Siddiqi 1959 were detected in the surveyed areas (Table  "},{"text":"Table 2 . The plant-parasitic nematodes surveyed wheat areas in Sakarya province. No. Districts Locations Nematode Genera No.DistrictsLocationsNematode Genera 1 Hendek Beylice Pratylenchus; Dorylaimida; Basiria 1HendekBeylicePratylenchus; Dorylaimida; Basiria 2  Beylice Ditylenchus 2BeyliceDitylenchus 3  Bıçkıatik Dorylaimida 3BıçkıatikDorylaimida 4  Beylice Dorylaimida 4BeyliceDorylaimida 5  Beylice Dorylaimida 5BeyliceDorylaimida 6 Ferizli Karadiken Scutylenchus; Filenchus; Dorylaimida 6FerizliKaradikenScutylenchus; Filenchus; Dorylaimida 7  Sebiller Helicotylenchus; Dorylaimida 7SebillerHelicotylenchus; Dorylaimida 8  Do gancı Helicotylenchus; Scutylenchus; Filenchus 8Do gancıHelicotylenchus; Scutylenchus; Filenchus 9  Karadiken Dorylaimida 9KaradikenDorylaimida   Karadiken Filenchus KaradikenFilenchus  Kaynarca Kızılcaali Dorylaimida KaynarcaKızılcaaliDorylaimida   Kızılcaali Filenchus; Aphelenchus KızılcaaliFilenchus; Aphelenchus   Merkez Helicotylenchus; Scutylenchus; Dorylaimida MerkezHelicotylenchus; Scutylenchus; Dorylaimida   Küçük Kaynarca Tylenchus; Dorylaimida Küçük KaynarcaTylenchus; Dorylaimida  Geyve Town center Merlinius; Filenchus; Ditylenchus GeyveTown centerMerlinius; Filenchus; Ditylenchus   Town center Pratylenchus; Scutylenchus Town centerPratylenchus; Scutylenchus   Town center Pratylenchus Town centerPratylenchus   Town center Scutylenchus; Filenchus; Dorylaimida Town centerScutylenchus; Filenchus; Dorylaimida   Town center Ditylenchus; Dorylaimida Town centerDitylenchus; Dorylaimida   Ilıca Pratylenchus; Paratrophurus; Filenchus; Ditylenchus; Dorylaimida IlıcaPratylenchus; Paratrophurus; Filenchus; Ditylenchus; Dorylaimida   Çamlık Pratylenchus; Merlinius; Dorylaimida ÇamlıkPratylenchus; Merlinius; Dorylaimida  "},{"text":"Table 2 . Cont.     No. Districts Locations Nematode Genera No.DistrictsLocationsNematode Genera  Taraklı Hacıyakup Merlinius; Filenchus; Dorylaimida TaraklıHacıyakupMerlinius; Filenchus; Dorylaimida   Hacıyakup Merlinius; Pratylenchus; Dorylaimida HacıyakupMerlinius; Pratylenchus; Dorylaimida   Hacıyakup Ditylenchus HacıyakupDitylenchus   Aksu Scutylenchus; Filenchus AksuScutylenchus; Filenchus   Aksu Filenchus AksuFilenchus   Aksu Ditylenchus; Tylenchus; Boleodorus AksuDitylenchus; Tylenchus; Boleodorus   Aksu Helicotylenchus; Filenchus; Ditylenchus AksuHelicotylenchus; Filenchus; Ditylenchus   Hacıyakup Pratylenchus; Merlinius; Ditylenchus; Scutylenchus Filenchus HacıyakupPratylenchus; Merlinius; Ditylenchus; Scutylenchus Filenchus   Hacıyakup Dorylaimida HacıyakupDorylaimida  Sö gütlü Mahsudiye Pratylenchus; Aphelenchoides; Filenchus; Boleodorus; Dorylaimida Sö gütlüMahsudiyePratylenchus; Aphelenchoides; Filenchus; Boleodorus; Dorylaimida   Town center Ditylenchus; Dorylaimida Town centerDitylenchus; Dorylaimida  Akyazı Town center Helicotylenchus; Amplimerlinius; Merlinius; Ditylenchus; Filenchus; Dorylaimida AkyazıTown centerHelicotylenchus; Amplimerlinius; Merlinius; Ditylenchus; Filenchus; Dorylaimida   Şerefiye Helicotylenchus; Ditylenchus; Monachus; Dorylaimida ŞerefiyeHelicotylenchus; Ditylenchus; Monachus; Dorylaimida   Şerefiye Aphelenchoides; Ditylenchus; Dorylaimida ŞerefiyeAphelenchoides; Ditylenchus; Dorylaimida  Kocaali Town center Ditylenchus; Amplimerlinius; Scutylenchus; Monachus; Scutylenchus KocaaliTown centerDitylenchus; Amplimerlinius; Scutylenchus; Monachus; Scutylenchus   Town center Helicotylenchus; Ditylenchus; Scutylenchus; Filenchus Dorylaimida Town centerHelicotylenchus; Ditylenchus; Scutylenchus; Filenchus Dorylaimida  Pamukova Mekece Merlinius; Ditylenchus; Filenchus; Dorylaimida PamukovaMekeceMerlinius; Ditylenchus; Filenchus; Dorylaimida   Mekece Helicotylenchus; Dorylaimida MekeceHelicotylenchus; Dorylaimida   Mekece Merlinius; Ditylenchus; Tylenchus MekeceMerlinius; Ditylenchus; Tylenchus  "},{"text":"Table 3 . Migratory nematode genera recovered from the sampled fields in Sakarya province. No. Nematode Genera Infested Fields (%) * Nematode Abundance ** No.Nematode GeneraInfested Fields (%) *Nematode Abundance ** 1 Merlinus 28 960 ± 120 (220-1100) 1Merlinus28960 ± 120 (220-1100) 2 Trophurus 16 240 ± 20 (200-360) 2Trophurus16240 ± 20 (200-360) 3 Paratrophurus 14 140 ± 40 (80-980) 3Paratrophurus14140 ± 40 (80-980) 4 Pratylenchus 26 240 ± 40 (400-980) 4Pratylenchus26240 ± 40 (400-980) 5 Amplimerlinus 32 340 ± 60 (200-880) 5Amplimerlinus32340 ± 60 (200-880) 6 Helicotylenchus 40 420 ± 50 (280-780) 6Helicotylenchus40420 ± 50 (280-780) 7 Tylenchus 34 320 ± 40 (200-480) 7Tylenchus34320 ± 40 (200-480) 8 Pratylenchoides 30 640 ± 160 (200-980) 8Pratylenchoides30640 ± 160 (200-980) 9 Scutylenchus 28 550 ± 60 (100-860) 9Scutylenchus28550 ± 60 (100-860) 10 Filenchus 24 280 ± 20 (100-200) 10Filenchus24280 ± 20 (100-200) 11 Boleodorus 20 120 ± 160 (140-360) 11Boleodorus20120 ± 160 (140-360) 12 Basiria 16 240 ± 30 (160-900) 12Basiria16240 ± 30 (160-900)  "},{"text":"Table 4 . Infestation rate of the sampled fields by Pratylenchus spp. in Hendek, Pamukova, Geyve, and Akyazı districts in wheat fields. No. District Number of Fields Surveyed Infestation (%) Average Number of Nematodes/100 g * No.DistrictNumber of Fields SurveyedInfestation (%)Average Number of Nematodes/100 g * 1 Hendek 5 3 40 1Hendek5340 2 Pamukova 4 4 20 2Pamukova4420 3 Geyve 7 2 15 3Geyve7215 4 Akyazı 5 5 25 4Akyazı5525 Total  22 35 * 25 Total2235 *25  "},{"text":"Table 5 . Sequenced Heterodera filipjevi samples were collected from wheat fields in Sakarya Province. No. District Location Latitude Longitude No.DistrictLocationLatitudeLongitude 1 Kaynarca Kızılcaali 40 • 98 66 30 • 40 71 1KaynarcaKızılcaali40 • 98 6630 • 40 71 2  Kızılcaali 40 • 98 27 30 • 40 58 2Kızılcaali40 • 98 2730 • 40 58 3  Merkez 41 • 03 33 30 • 30 77 3Merkez41 • 03 3330 • 30 77 4  Küçükkaynarca 41 • 03 38 30 • 32 48 4Küçükkaynarca41 • 03 3830 • 32 48 5 Geyve Merkez-I 40 • 50 41 30 • 30 55 5GeyveMerkez-I40 • 50 4130 • 30 55 6  Merkez-II 40 • 51 74 30 • 31 06 6Merkez-II40 • 51 7430 • 31 06 7  Çamlık 40 • 45 24 30 • 37 93 7Çamlık40 • 45 2430 • 37 93 8  Ilıca 40 • 45 25 30 • 38 10 8Ilıca40 • 45 2530 • 38 10 9 Taraklı Hacıyakup-I 40 • 44 69 30 • 37 94 9TaraklıHacıyakup-I40 • 44 6930 • 37 94 10  Hacıyakup-II 40 • 43 95 30 • 43 85 10Hacıyakup-II40 • 43 9530 • 43 85 11  Aksu 40 • 44 64 30 • 45 37 11Aksu40 • 44 6430 • 45 37 12 Sö gütlü Merkez 40 • 89 69 30 • 46 43 12Sö gütlüMerkez40 • 89 6930 • 46 43  "},{"text":"Table 6 . Morphological and morphometrical characteristics of second juveniles and cysts of Heterodera filipjevi populations (n = 10); measurement unit in µm. Morphological Characters Geyve Taraklı Kaynarca Sö gütlü Morphological CharactersGeyveTaraklıKaynarcaSö gütlü  "},{"text":"Table 6 . Cont. Means in the same raw followed by the same letter(s) were not significantly different according to Tukey HSD test (p ≤ 0.05). H\" represents the Shannon diversity index; \"EH\" indicates the evenness; \"pi\" indicates th tion of the entire community made up of species i; \"ln\" represents the natural log Morphological Characters Microorganisms 2022, 10, x FOR PEER REVIEW Geyve Taraklı Kaynarca Sö gütlü  Morphological Characters Microorganisms 2022, 10, x FOR PEER REVIEW GeyveTaraklıKaynarcaSö gütlü Fenestral length 51.32 ± 2.32 b (42.1-63.4) 58.34 ± 3.44 a (43.8-68.4) 54.54 ± 2.32 a,b (45.2-63.2) 48.34 ± 1.64 b (40.2-59.8)  Fenestral length51.32 ± 2.32 b (42.1-63.4)58.34 ± 3.44 a (43.8-68.4)54.54 ± 2.32 a,b (45.2-63.2)48.34 ± 1.64 b (40.2-59.8) Semifenestral width Basiria Total Vulval bridge width 20.4 ± 2.43 c (15.2-26.6) 10.56 ± 1.32 b (6.8-17.2) 24.4 ± 2 a (16.7-24.6) 240 14.44 ± 2.43 a 4490 (9.2-18.6) 23.2 ± 1.04 a,b (16.8-27.5) 0.053452 12.09 ± 2.33 a,b 1 (7.88-16.54) 22.4 ± 2.09 b −2.92897 (15.2-28.6) −31.8336 15.65 ± 2.33 a (9.2-17.5) H = 2.31767 −0.1 −2.3 Semifenestral width Basiria Total Vulval bridge width20.4 ± 2.43 c (15.2-26.6) 10.56 ± 1.32 b (6.8-17.2)24.4 ± 2 a (16.7-24.6) 240 14.44 ± 2.43 a 4490 (9.2-18.6)23.2 ± 1.04 a,b (16.8-27.5) 0.053452 12.09 ± 2.33 a,b 1 (7.88-16.54)22.4 ± 2.09 b −2.92897 (15.2-28.6) −31.8336 15.65 ± 2.33 a (9.2-17.5) H = 2.31767−0.1 −2.3 Vulval slit length (12.6-25.8) 19.5 ± 1.02 b (10.3-26.2) 22.6 ± 1.58 a (13.4-25.6) 20.2 ± 2.34 a,b (13.3-25.5) 18.2 ± 3.32 b EH = 0.932699 Vulval slit length(12.6-25.8) 19.5 ± 1.02 b(10.3-26.2) 22.6 ± 1.58 a(13.4-25.6) 20.2 ± 2.34 a,b(13.3-25.5) 18.2 ± 3.32 b EH = 0.932699  "},{"text":"Table 7 . Diversity of migratory nematodes in wheat field using Shannon diversity index. Nematode Genus Average Number of Nematodes/100 g Soil (Frequency) pi ln(pi) pi × ln(pi) Nematode GenusAverage Number of Nematodes/100 g Soil (Frequency)piln(pi)pi × ln(pi) Merlinus 960 0.213808 −1.54267 −0.32984 Merlinus9600.213808−1.54267−0.32984 Trophurus 240 0.053452 −2.92897 −0.15656 Trophurus2400.053452−2.92897−0.15656 Paratrophurus 140 0.031180 −3.46797 −0.10813 Paratrophurus1400.031180−3.46797−0.10813 Pratylenchus 240 0.053452 −2.92897 −0.15656 Pratylenchus2400.053452−2.92897−0.15656 Amplimerlinus 340 0.075724 −2.58066 −0.19542 Amplimerlinus3400.075724−2.58066−0.19542 Helicotylenchus 420 0.093541 −2.36935 −0.22163 Helicotylenchus4200.093541−2.36935−0.22163 Tylenchus 320 0.071269 −2.64129 −0.18824 Tylenchus3200.071269−2.64129−0.18824 Pratylenchoides 640 0.142539 −1.94814 −0.27769 Pratylenchoides6400.142539−1.94814−0.27769 Scutylenchus 550 0.122494 −2.09969 −0.25720 Scutylenchus5500.122494−2.09969−0.25720 Filenchus 280 0.062361 −2.77482 −0.17304 Filenchus2800.062361−2.77482−0.17304 Boleodorus 120 0.026726 −3.62212 −0.09680 Boleodorus1200.026726−3.62212−0.09680 Basiria 240 0.053452 −2.92897 −0.15656 Basiria2400.053452−2.92897−0.15656 Total 4490 1 −31.8336 −2.31767 Total44901−31.8336−2.31767    H = 2.31767 H = 2.31767    E H = 0.932699 E H = 0.932699  "}],"sieverID":"c581e9b3-2d24-4a6e-9f3c-d753a3046776","abstract":"Several nematode species can be found in different densities in almost any soil ecosystem, and their diversity in those ecosystems depends on numerous reasons, such as climatic conditions and host presence. Cereals are one of the main hosts of plant-parasitic nematodes (PPN), chiefly rootlesion nematodes (RLN, Pratylenchus spp.) and cereal cyst nematodes (CCN, Heterodera spp.). These nematodes are known as major parasites of the cereal crops; however, agricultural areas accommodate various nematodes showing biological variation. The diversity of parasitic nematodes on cereals in the Sakarya provinces of Türkiye, where cereals are intensively grown and located in the middle of two climatic zones, has not been well studied. Therefore, in this study, we aimed to determine the diversity, identification, and molecular phylogeny of PPNs in wheat-growing ecosystems in the Hendek, Pamukova, Geyve, Akyazı, and Central districts of Sakarya. The diversity of PPNs was calculated using the Shannon diversity index. Thirteen PPN genera were detected in 92% of soil samples. Heterodera filipjevi was identified in 24% of the soil samples using morphological, morphometrical, and molecular tools. In the morphological and molecular analyses, intraspecific polymorphism was observed in H. filipjevi populations. The result indicated that the high infestation rate of H. filipjevi was recorded from Geyve and Pamukova, followed by Hendek and Akyazı; however, a low infestation rate was detected in the Central district. The moderate value of the Shannon index of migratory nematode species was obtained in wheat fields as 2.31, whereas the value of evenness was 0.93, implying moderate diversity and high evenness of nematodes. This study is the first comprehensive report on H. filipjevi from wheat cropping areas in the Sakarya province. Intensified cereal cropping systems with/without non-cereal rotations increased the risk of plant-parasitic nematodes, especially RLNs and H. filipjevi infection of wheat production areas in the province."}

data/part_2/064232d94be5479c16089a6f85e93d5d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"064232d94be5479c16089a6f85e93d5d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c0dc1f28-f236-4afb-9d49-7bec3377f0ad/retrieve"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"What is NATURE+?","index":1,"paragraphs":[{"index":1,"size":38,"text":"The CGIAR Initiative on Nature-Positive Solutions aims to re-imagine, collaboratively create and implement nature-positive solutions for agrifood systems that equitably support food and livelihoods and ensure that agriculture is a netpositive contributor to biodiversity and nature. The opportunities"},{"index":2,"size":2,"text":"The challenges"},{"index":3,"size":49,"text":"The NATURE+ approach NATURE+ worked with diet health clubs and vegetable value chain groups (where the vast majority of participants were women) to understand their production practices, collaborations and incomes. In collaboration with FAVRI, 166 farmers received training on nature-positive solutions related to a suite of sustainable farm-management strategies."},{"index":4,"size":61,"text":"The Initiative plans further capacity building based a training manual on seed systems, vegetables, nutrition and seed production. Work is also planned for variety-selection skills to enable farmers to meet their needs and produce niche varieties with high market potential. The Initiative and partners are eager to explore market opportunities for selected indigenous fruits and vegetables to promote agrobiodiversity and agritourism."},{"index":5,"size":83,"text":"NATURE+ completed a study on the drivers of land degradation and the lessons learned from the recent and ongoing restoration efforts that are helping halt land degradation while improving rural livelihoods. However, as most restoration activities have focused on exotic species, NATURE+ surveyed 240 rural households to add native tree species to the Diversity for Restoration (D4R) tool. Many of the additional 100 species, identified with several partners based on local indigenous knowledge, are suitable for mountainous regions and can provide ecosystem services."},{"index":6,"size":61,"text":"The D4R databases will be updated with the 100 tree species and 50 functional traits. NATURE+ will support local authorities, partners, and ethnic minorities (particularly women) as they build on restoration projects. Research will focus on monitoring and incentives for restoration, guidelines for restoration on sloping landscapes, and the national and international market potential for timber species and forest food products. "}]},{"head":"How NATURE+ works in Vietnam","index":2,"paragraphs":[{"index":1,"size":43,"text":"The circular economy hub collaboration will help the Initiative advance its circular economy work by generating knowledge and awareness of agri-waste recycling approaches, leveraging international best practices from the agri-food industry, and supporting circular business innovations with technical resources, training, advisories and finance."},{"index":2,"size":43,"text":"The Initiative collected baseline data on nature-positive activities from 1,153 agricultural households, 334 farm workers, and nearly 80 key informant interviews and focus group discussions. The work led to the creation of resource maps and clear strategies for increasing nature-positive interventions in communities."},{"index":3,"size":11,"text":"Researchers collected and shared data on the true cost of food."}]},{"head":"RECYCLE 2024 ENGAGE to date","index":3,"paragraphs":[{"index":1,"size":38,"text":"procedures. NATURE+ and its partners work closely with farmers' groups, health clubs, households, and existing platforms -and, to mainstream agrobiodiversity education -with teachers and students. This multilayered and flexible approach to Initiative work is critical to on-the-ground success."},{"index":2,"size":36,"text":"NATURE+ will continue gathering, analyzing, and sharing data related to nature-positive activities and true-cost accounting. Policy briefs and technical reports will be developed to support implementation and scaling areas of nature-positive and true cost accounting approaches."},{"index":3,"size":2,"text":"ENGAGE 2024"}]},{"head":"Media coverage & blogs","index":4,"paragraphs":[{"index":1,"size":6,"text":"Please contact us for more information:"},{"index":2,"size":19,"text":"We would like to thank all funders who support this research through their contributions to the CGIAR Trust Fund. "}]}],"figures":[{"text":"  "}],"sieverID":"b64f117a-0fdd-480b-9294-d7ba364ecbcf","abstract":"NATURE+ works in the northwestern Vietnamese provinces of Lao Cai and Son La. Known for their hilly terrain, terraced rice fields and diverse ethnic groups, these provinces have high potential for increased food production. But sustainability, nutrition, health, conservation of nature and traditional knowledge are sometimes overlooked. The Initiative aims to help address these gaps in the areas' development."}

data/part_2/064783f349685d85a612d25276504637.json

@@ -0,0 +1 @@
+{"metadata":{"id":"064783f349685d85a612d25276504637","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e94f042b-7220-4911-b392-6069c1462779/retrieve"},"pageCount":14,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":236,"text":"The Africa RISING East and Southern Africa (ESA) project management team led by the project manager, Irmgard Hoeschle-Zeledon, the ESA project chief scientist, Mateete Bekunda and implementing partners recently (12 -14 February) visited project sites in various camps in Chipata District, Zambia. The goal of the two-day visit was to review the progress of activities and to assess how technologies were being used by farmers. Additionally, the 2017/18 cropping season was also in principle a season which had been earmarked by partners as one for 'closing' existing research information gaps for all the technology options offered to farmers to ensure that all relevant information required for effective scaling in future was available. The management team interacted with farmers and got first-hand feedback about how they were using each of the technologies and improved practices put forward by the project. This photo report highlights what the team found. An online version of this photo report is also accessible at: https://spark.adobe.com/page/CfXHi9RvkbYbO/ Benefits from doubled-up legume in conservation agriculture Demonstrations on doubled-up legume-intercropping two grain legumes with different growth habits -have been ongoing with farmers in Africa RISING Malawi since 2013. As part of technology transfer, this practice which was already showing great impact in Malawi was introduced by the project team to Zambian farmers in 2014/2015 cropping season as part of the conservation agriculture practice that is already widely adopted by farmers in the Eastern Province of Zambia."},{"index":2,"size":305,"text":"Julius Mshanga, a farmer from Kapara Camp in Chipata District is working with the Africa RISING project team on the doubled-up legume under conservation agriculture (CA) practice trials. As part of these trials he is also implementing seasonal legume-cereal crop rotations as a means of ensuring effective nutrient cycling. Mshanga says that he has seen first-hand what difference the rotations make when implemented in a double-up legume CA system. Julius Mshanga at his farm. Photo credit: Jonathan Odhong'/IITA. 'Take a look, this part of my farm where the maize is really healthy and green is where I planted pigeon pea and groundnut last season,' he says, pointing at a portion of his farm where the maize is lush green. 'Also looking at the different experiments on my farm, it is not lost on me that pigeon pea seems to fix nitrogen better on the soil compared to groundnut,' he adds. Mshanga also notes that conservation agriculture is better than conventional practices (using ox driven ripper, for example) particularly in seasons where there is a drought. 'Last year-2016/2017 season-we had a drought in Zambia and most of the crops withered particularly on parts of my farm where I had prepared the land using the ox driven ripper and taken out all the crop residues from. But on the same farm, the side where I did CA, the crops there survived and there was an obvious difference to me in the two sections of my farm even eventually when I harvested,' he notes. 'I must also add that implementing CA and rotations on my farm have turned me into a believer in the two. At first, I was very doubtful and argumentative with the extension officer who had picked me to be a model farmer in this camp for these two practices,' explains Mshanga with a smile."},{"index":3,"size":56,"text":"Photo credit: Jonathan Odhong'/IITA. Mathias Phiri (pictured), a farmer from Mtaya Camp in Chipata District has been involved in conservation agriculture and doubled-up legume trials cumulatively for the past five years. Phiri was introduced to the double up legume technology in 2014 (in addition to CA) and has seen some interesting improvements in his yields since."},{"index":4,"size":65,"text":"'I am happy to implement the doubled-up legume technology because I have confirmed it improves soil fertility and also offers me different options at harvest. For example, I use the pigeon pea grain sometimes as a relish while the groundnut can be sold and the maize is used as a staple. This intercropping allows me to harvest three crops from the same plot,' he says."},{"index":5,"size":92,"text":"Asked how he knows that soil fertility has improved in his 2 ha farm; Phiri's answer is simple -'The fact that I can now see that the soil is much looser at planting is a good sign,' he says. He also admits that reduced labour is a significant factor informing his decision to prefer doubled-up legume in CA over the conventional ox ridge tilling. Additionally, he also notes that the seasonal rotation of cereal-legume crops also accounts for the impressive performance he has seen on his farm over the past three years."},{"index":6,"size":65,"text":"'One of my bigger challenges is still finding markets. Selling our pigeon pea produce is still difficult. For example, I currently have about 50 kg of pigeon pea at my home that I have had intent to sell, but there are no buyers. On the other hand, while groundnuts are relatively easy to sell, prices are usually low thereby even compounding our challenges,' adds Phiri."},{"index":7,"size":29,"text":"Africa RISING project in Zambia is implementing these doubled-up legume and CA trials with 7 farmers in 6 camps within the Chipata District in the Eastern Province of Zambia."}]},{"head":"Green manure cover crops","index":2,"paragraphs":[{"index":1,"size":33,"text":"Photo credit: Jonathan Odhong'/IITA. Zandonda Mbewe (pictured) , is hosting Africa RISING green manure cover crop trials (GMCC) on his farms for the second season. He is experimenting with the following GMCC options:"},{"index":2,"size":152,"text":" maize intercrop with cowpea  maize intercrop with pigeon pea  maize intercrop with lablab  maize intercrop with Gliricidia Green manure cover crops offer farmers various benefits such as suppressing weed growth and creating surface cover that helps in keeping the soils moist for longer. Additionally, having crops like lablab and cowpea ensures that a farmer can harvest some extra grain for home consumption too. On the other hand, Gliricidia is beneficial for making compost manure as well as helping with soil fertility improvement. Asked which of the GMCC options he prefers, Mbewe said that he favours the maize intercrop with cowpea because this combination seems to build better soil fertility compared to other GMCC alternatives. Additionally, it offers extra cowpea grain for home consumption. In terms of ground cover, moisture conservation and weed suppression he prefers the lablab GMCC alternative which he says is much better in this regard."}]},{"head":"Improving the legume seed delivery systems in Zambia","index":3,"paragraphs":[{"index":1,"size":102,"text":"The International Institute of Tropical Agriculture (IITA), the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) and the Zambian Agricultural Research Institute (ZARI) are partnering under the Africa RISING going to scale in eastern Zambia project to make high-quality legume seeds accessible to smallholder farmers in Zambia. The focus legumes of the project are: cowpea, pigeon pea, soya bean, and groundnut. Under this activity, the breeder seed produced from ZARI are passed to private sector producers of foundation seed. The foundation seed is then fed into a network of certified seed producers that include seed companies and community-based seed outgrower schemes."},{"index":2,"size":29,"text":"The ZARI Chipata Station head, Kennedy Kanenga (left), congratulates Thomas Mtonga for a job well done in multiplication of certified pigeon pea seed (variety MPPV2). Photo credit: Jonathan Odhong'/IITA."},{"index":3,"size":49,"text":"To meet the demand for seed, ZARI is partnering with willing and interested farmers like Mtonga to produce certified seed. The need to enter this kind of partnership arrangements with farmers became clear last year (2017) when ZARI could not meet a 22 metric tonnes demand for pigeon pea."},{"index":4,"size":87,"text":"Farmers like Mtonga are helping to relieve the pressure of producing certified seed from ZARI thereby allowing the institute to focus on production of basic seed. For farmers like him, this partnership equally portends a profitable venture whereby he is guaranteed of selling back the seed after certification by government inspectors to ZARI at an agreeable price to both parties. Although it is the first time Thomas has participated in pigeon pea seed multiplication, he is expecting to harvest xxx tonnes out of the 1 ha planted."},{"index":5,"size":167,"text":"'The fact that the market for my harvest is assured makes this a perfect venture for me compared to growing maize for example. I have strived to follow all the outlined requirements stipulated by ZARI for seed multiplication and expect that the seed produced from my field will be easily certified,' explains Mtonga. 'Another reason that makes this interesting for me is that at the end of this season I will just be expected to ratoon the pigeon pea so this same crop will serve me into the next cropping season too,' he adds. This is the first time ZARI is implementing this kind of strategy for pigeon pea seed multiplication, but in previous seasons they have done the same for other legumes such as beans, soya bean and cowpea as part of efforts by the institute to address the persistent legume seed shortage in the country. This goal closely aligns with the activities of the Africa RISING going to scale in the Eastern Province of Zambia."}]},{"head":"Demonstrating and promoting newly released groundnut varieties and improved management practices","index":4,"paragraphs":[{"index":1,"size":109,"text":"The Africa RISING Zambia team is also working with farmers to promote and demonstrate five Feed the Future groundnut seed varieties that were released in 2017. The aim of the exercise is to check the performance of the released varieties under farmer management in different locations. Bisalom Banda, a farmer from Chiparamba Camp in Chipata District is one of those involved in this initiative. During the selection of varieties, the farmers look out for various criteria for variety selection like grain size, taste, early maturity, the number of pods produced per plant etc. During these exercises are typically done by both men and women separately and then results compared."},{"index":2,"size":6,"text":"Bisalom Banda. Photo credit: Jonathan Odhong'/IITA."},{"index":3,"size":142,"text":"Once Banda and his fellow farmers in Chiparamba identify and select the preferred groundnut variety at the end of the season, this information will be provided to ZARI who will then start to supply the 'winning' seed to farmers within that location (Chiparamba Camp) for propagation through the community seed banks. According to Banda, setting up the tied ridges (or 'ma boxy ma boxy' as the farmers call them) for moisture conservation is also a good management practice that he thinks would make a big difference in a season with erratic rainfall like the previous one. An extension of this activity is to also promote the production of quality declared seed of these five varieties by farmers. The production of QDS is being implemented in collaboration with 150 farmers in three districts within the Eastern Province of Zambia -Chipata, Katete and Lundazi."},{"index":4,"size":38,"text":"Farmers Outgrower Foundation coordinator, Whyton Sakala (centre) poses for a photo with Edward Zulu (left) one of the outgrower farmers working with the foundation to produce certified seed in Chanje Camp, Zambia's Eastern Province. Photo credit: Jonathan Odhong'/IITA."},{"index":5,"size":73,"text":"The Farmer Outgrower Foundation (FOF) partners with individual farmers to produce certified seed. This season (2017/18) FOF provided farmers with two varieties for multiplication -Wamusanga (500 kg) and MGV 7 (150 kg). FOF then contracts trained farmers in seed growing, giving them 20 kg each to produce the certified seed. 'In this area (Chanje Camp), we are working with 25 smallholder farmers (19 women) to produce certified seed,' explains FOF coordinator Whyton Sakala."},{"index":6,"size":51,"text":"'FOF is working currently with 50 farmers and is introducing them to newly-released improved groundnut varieties. However, through other initiatives we are working with a total of 1,000 farmers in the Eastern Province of Zambia using groundnut as a means of helping them get out of the poverty cycle,' adds Sakala."},{"index":7,"size":85,"text":"In this arrangement, FOF trains the contracted farmers on all the stipulated standards for certified seed production and then gives each of them 20 kg for planting. In the course of the season, seed inspectors conduct visits to the farmer's fields to evaluate whether all standards are met. If all standards are met, then the farmers produce is certified as seed. FOF recovers their seed investments at a ratio of 1:2 after harvest and then buys off the rest of the certified seed from them."},{"index":8,"size":78,"text":"At the time of the visit, FOF and the farmers had not agreed on the selling price for the seed -an issue which ideally should be determined before farmers and FOF finalize their agreement. However, the situation has been complicated by the fact that the seed price in Zambia is not fixed. As a general principle, and a reason for optimism for the farmers, is that the selling price for seed is always higher than that for grain."},{"index":9,"size":85,"text":"At the end of the visit, the Africa RISING management team urged FOF to (in future) establish a minimum selling price with the farmers before a final contract between the two parties is agreed. An idea floated by Share Africa based on their experience making similar arrangements with farmers was that the contract should stipulate that the farmer is bound to sell to the company (FOF/Share Africa) and that the selling price, for the farmer, will be 50% more than the price of commercial grain."},{"index":10,"size":64,"text":"Some criteria for selecting outgrower farmers  Has productive land.  Field isolation -no neighbouring fields within a distance of 5 m should be having groundnuts growing on it.  Willing to follow and maintain the high standards prescribed for seed production Chasaya Sanga, one of the women FOF outgrower farmers producing certified seed in Chanje Camp, Eastern Province Zambia. Photo credit: Jonathan Odhong'/IITA."},{"index":11,"size":104,"text":"'From what I can observe, the groundnut variety provided to me by FOF (Wamusanga) is fast growing and it is better-yielding considering the number of pegs into the ground that it has already established compared to the older varieties at the same stage,' notes Chasaya. This mechanical groundnut sheller [driven by hand] has been introduced at a limited scale to farmers as a means of aiding them in processing their harvests. The machine is popular with farmers, however, the absence of a local fabricator in Chipata District is a barrier to its widespread adoption despite the high interest from farmers. Photo credit: Jonathan Odhong'/IITA."}]},{"head":"Soya bean seed multiplication","index":5,"paragraphs":[{"index":1,"size":97,"text":"The Africa RISING project is also collaborating with Share Africa Zambia in Soyabean Seed Multiplication. Through the arrangement, Share Africa purchases basic seed from IITA for production of certified seed. During the trip, the Africa RISING management team visited the Share Africa's 46 ha model farm in Chitandika Camp. Like the Farmers Outgrower Foundation, Share Africa also has its network of outgrower farmers with whom they collaborate to produce certified groundnut and soya bean seed for the market. Their eventual ambition is to eventually establish Share Africa as a legume seed company in the Zambian seed market."},{"index":2,"size":115,"text":"Debrief with USAID Zambia Feed the Future coordinator At the end of the site visits, the Africa RISING management team and project partners held a debrief meeting with the USAID Zambia FtF Coordinator, Harry Ngoma. The team appraised Mr Ngoma about the observed progress of various activities and the farmer adoption and adaptation of the different technologies. Discussions at the debrief also touched upon future outlook for activities in light of the Feed the Future strategy for Zambia. In the end, partners took time to express gratitude to the USAID Zambia Country Mission for their steadfast support to ensure Zambian farmers get access to improved agricultural technologies that are changing their lives for the better."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"d10e067e-35f8-4942-8568-979c7b54f784","abstract":""}

data/part_2/067600e8787e350449d66e2d6ecf5e23.json

@@ -0,0 +1 @@
+{"metadata":{"id":"067600e8787e350449d66e2d6ecf5e23","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2e915cac-f01e-4a0d-bbd3-381a460c0eef/retrieve"},"pageCount":6,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"application deadline: February 15, 2021. • MSc Graduate Fellowship: Diarrheal disease in cattle production systems. Click for detail. • MSc Graduate Fellowship: Epidemiology and control of Pestes des Petit Ruminants. Click for details. n Food Biosystems Doctoral Training Program in subject areas that span the entire food value chain. application   Fellowships, scholarships and internships Fellowships, scholarships and internships n Future Food Swiss Research Fellowship for postdoctoral n Future Food Swiss Research Fellowship for postdoctoral researchers. application deadline: march 31, 2021. researchers. application deadline: march 31, 2021. Click for details. Clickfor details. n International Center for Genetic Engineering and n International Center for Genetic Engineering and Biotechnology Arturo Falaschi PhD and postdoctoral Biotechnology Arturo Falaschi PhD and postdoctoral fellowships. application deadline: march 31, 2021. fellowships. application deadline: march 31, 2021. Click for details. Clickfor details. n Stellenbosch Institute for Advanced Study ISO n Stellenbosch Institute for Advanced Study ISO Lomso Fellowship for early-career African researchers. Lomso Fellowship for early-career African researchers. application deadline: February 15, 2021. Click for application deadline: February 15, 2021. Clickfor details.  details. n World Wildlife Fund Russell E. Train Fellowship for n World Wildlife Fund Russell E. Train Fellowship for masters or doctoral degree in conservation. application masters or doctoral degree in conservation. application deadline: march 21, 2021. Click for details. deadline: march 21, 2021. Clickfor details. n Alexander von Humboldt Foundation International n Alexander von Humboldt Foundation International Climate Protection Fellowships 2021. application Climate Protection Fellowships 2021. application deadline: march 1, 2021. Click for details. deadline: march 1, 2021. Clickfor details. n Council for Tropical and Subtropical Agricultural n Council for Tropical and Subtropical Agricultural Research (ATSAF) Academy call for applications for PhD Research (ATSAF) Academy call for applications for PhD scholarships. Click for details. scholarships. Click for details. n Alliance of International Science Organizations (ANSO) n Alliance of International Science Organizations (ANSO) scholarship for young talents 2021 -MSc and PhD. scholarship for young talents 2021 -MSc and PhD. application deadline: march 31, 2021. Click for application deadline: march 31, 2021. Clickfor details.  details. n The African Computational Genomics postdoctoral n The African Computational Genomics postdoctoral fellowship in genetic epidemiology. fellowship in genetic epidemiology.  "},{"text":"application deadline: February 19, 2021. Click for details. n Agency for Science, Technology and Research national science scholarship for undergraduate studies in computer and information  Funding -Grants and awards Funding -Grants and awards n Food Prize Foundation -global nomination n Food Prize Foundation -global nomination process for agricultural innovators. application process for agricultural innovators. application deadline: may 1, 2021. Click for details. 12, 2021. Click for details. deadline: may 1, 2021. Clickfor details.12, 2021. Clickfor details. n World Food Prize Foundation. The Norman Borlaug n Wageningen University and Research Orange Knowledge n World Food Prize Foundation. The Norman Borlaugn Wageningen University and Research Orange Knowledge Award for field research and application. application Programme Scholarships. application deadline: march Award for field research and application. applicationProgramme Scholarships. application deadline: march deadline: June 15, 2021. Click for details. 16, 2021. Click for details. deadline: June 15, 2021. Clickfor details.16, 2021. Clickfor details. n World Food Prize Foundation call for nominations n University of Tasmania scholarships for research degrees. n World Food Prize Foundation call for nominationsn University of Tasmania scholarships for research degrees. for World Food Prize. application deadline: may 1, application deadline: march 5, 2021. Click for for World Food Prize. application deadline: may 1,application deadline: march 5, 2021. Clickfor 2021. Click for details.  details. 2021. Clickfor details.details. n The Royal Society Rising Star Africa Prize to an n University of Freiburg -scholarship for MSc. Global n The Royal Society Rising Star Africa Prize to ann University of Freiburg -scholarship for MSc. Global early career research scientist who is making Urban Health. application deadline: march 1, 2021. early career research scientist who is makingUrban Health. application deadline: march 1, 2021. an innovative contribution to the physical, Click for details. an innovative contribution to the physical,Clickfor details. mathematical and engineering sciences. application n University of Queensland PhD scholarships: Automation mathematical and engineering sciences. applicationn University of Queensland PhD scholarships: Automation deadline: February 15, 2021. Click for details. of cyber software security targeting on agriculture, smart deadline: February 15, 2021. Clickfor details.of cyber software security targeting on agriculture, smart n Global Grand Challenges -smart farming innovations contract and blockchain, Internet-of-Things and mobile n Global Grand Challenges -smart farming innovationscontract and blockchain, Internet-of-Things and mobile for small-scale producers. application deadline: devices. application deadline: February 21, 2021. Click for small-scale producers. application deadline:devices. application deadline: February 21, 2021. Click February 25, 2021. Click for details. for details. February 25, 2021. Clickfor details.for details. n Call for nominations -UNESCO-Russia n Finnish National Agency for Education -EDUFI n Call for nominations -UNESCO-Russian Finnish National Agency for Education -EDUFI Mendeleev International Prize in the Basic Sciences. fellowships for doctoral level students and young Mendeleev International Prize in the Basic Sciences.fellowships for doctoral level students and young application deadline: march 15,2021. Click researchers. applications can be submitted throughout application deadline: march 15,2021. Clickresearchers. applications can be submitted throughout for details.    the year. Click for details. for details.the year. Clickfor details. n UNESCO Equatorial Guinea international prize for n University of Konstanz -ZUKOnnect Fellowships n UNESCO Equatorial Guinea international prize forn University of Konstanz -ZUKOnnect Fellowships research in the life sciences. application deadline: for Scholars from Africa, Asia and Latin America. research in the life sciences. application deadline:for Scholars from Africa, Asia and Latin America. march 31,2021. Click for details. application deadline: February 24, 2021. Click for march 31,2021. Clickfor details.application deadline: February 24, 2021. Clickfor n The Australian Council of Graduate Research Awards for excellence in graduate research education, 2021. details. n University of Oxford -Reach Oxford Scholarships for n The Australian Council of Graduate Research Awards for excellence in graduate research education, 2021.details. n University of Oxford -Reach Oxford Scholarships for application deadline: march 26, 2021. Click undergraduates. application deadline: February 10, application deadline: march 26, 2021. Clickundergraduates. application deadline: February 10, for details.    2021. Click for details. for details.2021. Clickfor details. n Danida Fellowship Center -Grants for research n American University of Beirut -Mastercard Foundation n Danida Fellowship Center -Grants for researchn American University of Beirut -Mastercard Foundation collaboration projects, 2021. application deadline: Scholars Program for graduate education. application collaboration projects, 2021. application deadline:Scholars Program for graduate education. application February 26, 2021. Click for details. deadline: march 18, 2021. Click for details. February 26, 2021. Clickfor details.deadline: march 18, 2021. Clickfor details. n USDA-NIFA Agriculture and Food Research Initiative n University of Bristol -Think Big undergraduate n USDA-NIFA Agriculture and Food Research Initiativen University of Bristol -Think Big undergraduate Competitive Grants Program -Sustainable Agricultural scholarships. application deadline: march 29, 2021. Competitive Grants Program -Sustainable Agriculturalscholarships. application deadline: march 29, 2021. Systems. application deadline: July 1, 2021. Click Click for details. Systems. application deadline: July 1, 2021. ClickClickfor details. for details.    n The Food and Agriculture Organization -Hungarian for details.n The Food and Agriculture Organization -Hungarian n Global Water Awards 2021 -call for technologies, plants, government scholarship program. 2021-22 for Masters. n Global Water Awards 2021 -call for technologies, plants,government scholarship program. 2021-22 for Masters. Click projects, and companies that made significant contributions for details. to the development of the water sector. application n The African Women in Agricultural Research and deadline: February 28, 2021. Click for details. application deadline: February 28, 2021. Click details. n Women-in-Tech scholarship for the data science and for Click projects, and companies that made significant contributions for details. to the development of the water sector. application n The African Women in Agricultural Research and deadline: February 28, 2021. Click for details.application deadline: February 28, 2021. Click details. n Women-in-Tech scholarship for the data science andfor Development (AWARD) call for the 2021 Cohort of the n The Arrell Global Food Innovation Awards recognizing global One Planet Fellowship. application deadline: February 15, 2021. Click excellence in food innovation and community impact. for details. application deadline: February 28, 2021. Click for n University of Göttingen -Sustainable Food Systems details. full stack development career programs. application deadline: march 31, 2021. Click for details. n Hungarian state scholarships for foreign higher education students, graduates, lecturers and researchers. Development (AWARD) call for the 2021 Cohort of the n The Arrell Global Food Innovation Awards recognizing global One Planet Fellowship. application deadline: February 15, 2021. Click excellence in food innovation and community impact. for details. application deadline: February 28, 2021. Click for n University of Göttingen -Sustainable Food Systems details.full stack development career programs. application deadline: march 31, 2021. Click for details. n Hungarian state scholarships for foreign higher education students, graduates, lecturers and researchers. Research Training Group -opportunities for doctoral n Strathclyde research studentship scheme -student researchers and postdoctoral researchers in food systems excellence awards for PhD studentship. application application deadline: February 25, 2021. Click details. for Research Training Group -opportunities for doctoral n Strathclyde research studentship scheme -student researchers and postdoctoral researchers in food systems excellence awards for PhD studentship. applicationapplication deadline: February 25, 2021. Click details.for deadline: march 31, 2021. Click  for details. n Edinburgh doctoral college scholarships for PhD research deadline: march 31, 2021. Clickfor details.n Edinburgh doctoral college scholarships for PhD research n World Federation of Engineering Organizations -Women in the 2021-2022 academic session. application n World Federation of Engineering Organizations -Womenin the 2021-2022 academic session. application in Engineering Award for the enhancement of the figure of deadline: varies with programs. Click for details. in Engineering Award for the enhancement of the figure ofdeadline: varies with programs. Clickfor details. the female engineer in all engineering sectors. application the female engineer in all engineering sectors. application deadline: February 7, 2021. Click  for details. deadline: February 7, 2021. Clickfor details.  "},{"text":"application deadline: February 18, 2021. Click Click for details. n The Food and Agriculture Organization International Innovation Award for Sustainable Food and Agriculture. Click for details. n Crop Science Society of America. Emerging Leader for African Agricultural Transformation (ELAAT) Award.  "}],"sieverID":"8f06c30c-9d24-46d7-b701-4957ee9e2ce2","abstract":"PhD Graduate Fellowship: Quantifying the cost-effectiveness of rabies control in Machakos County, Kenya. Click for details.• PhD Graduate Fellowship: Crimean Congo Hemorrhagic Fever, Burkina Faso. Click for details.• PhD Graduate Fellowship: Taenia solium control in smallholder pig value chains in East-Africa; An exante impact assessment. Click for details. • PhD Graduate Fellowship: Supporting interventions to improve food safety in Ethiopia. Click for details • PhD Graduate Fellowship: Hazard assessment for food in East African Community. Click for details. • PhD Graduate Fellowship: Development of data management & analysis pipeline for integrated surveillance of endemic and emerging zoonoses in Kenya. Click for details. • PhD Graduate Fellowship: Gender and socio-cultural economic research on EIDs in northern Kenya. Click for details."}

data/part_2/06d7cba4cdbaf16bff221d8895452e7b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06d7cba4cdbaf16bff221d8895452e7b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e3610a7f-64ee-4171-b59c-1ee1976b25d7/retrieve"},"pageCount":2,"title":"CS Dietary software system to support the entry, management, and processing of quantitative 24-hour dietary recall survey data","keywords":[],"chapters":[],"figures":[],"sieverID":"314947f4-6d36-4006-8178-c9f3d605197e","abstract":"Description of the innovation: CSDietary is a software program for the collection and analysis of 24-hour dietary recall data. The software is fully customizable to tailor food composition tables and recipes to region-specific foods, measurement methods, and cooking techniques. The program features an expanded food composition table, options to generate outputs for different statistical packages, and a data sharing platform on the cloud. The program is accompanied by quick guides on how to install and operate the program. New Innovation: No Innovation type: Research and Communication Methodologies and Tools Stage of innovation: Stage 3: available/ ready for uptake (AV) Geographic Scope: Global Number of individual improved lines/varieties: <Not Applicable> Description of Stage reached: Software was developed by HarvestPlus and SerPro SA. In 2020, it was made freely available for download through Intake's online resource library. Intake provides technical assistance to support national or large-scale dietary surveys around the world."}

data/part_2/06fa46034e59e93e252594c0a2ad8513.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06fa46034e59e93e252594c0a2ad8513","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/07d6617f-4812-4aee-ae54-3d35c63ad12e/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"Objectives","index":1,"paragraphs":[]}],"figures":[{"text":"CLIMATE  "},{"text":" Land preparation was difficult Soil erosion along the slopes Floods destroyed crops and houses Crop failure Relied on food aid and off farm labour Climate calendar was prepared for normal, wet (1997) and dry (2012) years by male and female groups in Kilosa, TZ. Men engaged in casual labour to cope Strong for the two most important crops, reported by the men's group in Kilolo, TZ. Symbols indicate who undertakes the activity (women, men, children, jointly). "}],"sieverID":"f6386851-8a03-41df-9ef4-132d511893bd","abstract":"The CSA-RA was developed as part of the CIAT-led, IFAD-funded project titled, \"Increasing food security and farming system resilience in East Africa through wide-scale adoption of climate-smart agricultural practices\"."}

data/part_2/0768d4d67b20cb2941ba6d06956feda8.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0768d4d67b20cb2941ba6d06956feda8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a6f4c293-c06d-41c8-a356-7f1ea2360d61/retrieve"},"pageCount":5,"title":"","keywords":[],"chapters":[{"head":"Points of Attention","index":1,"paragraphs":[{"index":1,"size":4,"text":"Evidence and learning 1"},{"index":2,"size":74,"text":"Is there useful and credible information on the scaling process for learning, adaptive management and buy-in? What can you, and your (new!?) partners, do to strengthen this ingredient? What lies out of your control? Eliot Jones: This project intends to explore the onboarding process -to map out the process of research, design, and development of an audio analytics tool for an Agricultural NGO, such that future organizations in this eld may do the same."}]},{"head":"Recommended tools","index":2,"paragraphs":[{"index":1,"size":87,"text":"Scaling is complex and dealing with this complexity requires having a basic understanding of certain concepts. Here and there you may need to refresh or deepen your knowledge, because you are not able to answer a question adequately, or because you identi ed that issue as a key challenge and your strategy needs to address this the best way possible. Below we provide a list of recommended tools per step. The list is not exhaustive and you are encouraged to use the tools you are comfortable with."},{"index":2,"size":12,"text":"Tools and methods to help with Step 1: formulating the scaling ambition"},{"index":3,"size":2,"text":"Step 1"},{"index":4,"size":48,"text":"• The Problem Framing Canvas of the Gri ith Center for Systems innovation was developed to spend more time framing problems rather than jumping straight into problem \"solving\". It will help in clarifying the \"why to scale\" question and understand be er the needs of the target group."},{"index":5,"size":41,"text":"• GenderUp is a discussion-based method that supports innovation teams to scale agricultural innovations in a gender responsible and socially inclusive way. It goes deep into the question of WHO bene ts from scaling and helps strengthen Step 1c-the responsibility check."},{"index":6,"size":30,"text":"• Toolbox for System Thinkers by Disrupt Design. Disrupt Design shares the key insights and tools needed to develop and advance a systems mindset for dealing with a complex problem."},{"index":7,"size":10,"text":"Tools and methods to help with Step 2: Scaling Ingredients"},{"index":8,"size":2,"text":"Step 2"},{"index":9,"size":3,"text":"Evidence and learning"},{"index":10,"size":33,"text":"• CapacityWORKS by GIZ. The CapacityWORKS toolbox: Success Factor -Learning and Innovation provides an overview of tried and tested approaches and an extensive toolbox to deal with complex cooperation systems (not open source)."},{"index":11,"size":24,"text":"• Blue Marble Evaluation is a global initiative focused on training the next generation of evaluators to Think Globally, Act Globally and Evaluate Globally."},{"index":12,"size":42,"text":"• Outcome harvesting is a monitoring and evaluation methodology used to identify, describe, verify and analyse the changes brought about through a development intervention. It is designed to collect evidence of change, and then work backwards to assess contribution to that change."},{"index":13,"size":11,"text":"Tools and methods to help with Step 3: The scaling strategy"},{"index":14,"size":2,"text":"Step 3"},{"index":15,"size":51,"text":"• ExpandNet and WHO \"Nine steps for developing a scaling-up strategy\" facilitates systematic planning for scaling up. It is intended for programme managers, researchers and technical support agencies who are seeking to scale up health service innovations that have been tested in pilot projects or other eld tests and proven successful."},{"index":16,"size":33,"text":"• Scaling Readiness is a scienti c approach which supports organisations, projects and programmes in achieving their ambitions to scale innovations. An e ective and e icient innovation for the issue at stake."}]},{"head":"Awareness and demand","index":3,"paragraphs":[{"index":1,"size":10,"text":"A wish and readiness to use and produce the innovation."}]},{"head":"Business cases","index":4,"paragraphs":[{"index":1,"size":13,"text":"Incentives and a ractive value propositions to support the scaling of the innovation."},{"index":2,"size":16,"text":"Value chain E ective links between actors to pursue business cases and bridge supply and demand."},{"index":3,"size":13,"text":"Finance E ective nancing options to produce, deliver, manage and acquire the innovation."}]},{"head":"Knowledge and skills","index":5,"paragraphs":[{"index":1,"size":15,"text":"Capacities at individual and institutional level to use, adapt and promote the innovation at scale."}]},{"head":"Collaboration","index":6,"paragraphs":[{"index":1,"size":11,"text":"Strategic collaboration within and beyond the sector to scale the innovation."}]},{"head":"Evidence and learning","index":7,"paragraphs":[{"index":1,"size":14,"text":"Credible evidence and facts underpin and help gain support to reach the scaling ambition."},{"index":2,"size":13,"text":"Leadership and management E ective coordination and navigation to achieve the scaling ambition."}]},{"head":"Public sector governance","index":8,"paragraphs":[{"index":1,"size":7,"text":"Government support to reach the scaling ambition."}]}],"figures":[{"text":" More tools are recommended in the Scaling Scan workbook that can be downloaded from scalingscan.org 19/12/2023, 09:51 FRI 19/12/2023, 09:51FRI More Tools  More Tools  Scaling Ingredients Description Scaling Ingredients Description Technology / practice  Technology / practice https://projects.cimmyt.org/ss-app/index.html?host=750&displayname=Eliot Jones&[email protected]&lang=en 4/5 https://projects.cimmyt.org/ss-app/index.html?host=750&displayname=Eliot Jones&[email protected]&lang=en4/5  "}],"sieverID":"85832d93-9bcb-4332-af36-a7c1987efe29","abstract":""}

data/part_2/078f817e57a398e2c217bd384691728c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"078f817e57a398e2c217bd384691728c","source":"gardian_index","url":"http://www.slire.net/download/697/article_3_brab_60_aihou_et_al_restoration_of_terre_de_barre_fertility_using_pigenpea_grown_in_rotation_or_inte.pdf"},"pageCount":14,"title":"Restoration of \"terre de barre\" fertility using pigeonpea grown in rotation or intercropping with maize in the derived savanna of Benin","keywords":["N-fertilization","P","yield efficiency","LER","Benin N","P","rendement efficient","LER","Benin"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":194,"text":"In the Mono Province of Benin, reduced fallow periods as a result of increasing demographic pressure (200-250 persons/km 2 ) have led to a decline in soil fertility and, hence, to reduced agricultural productivity. In this Province, N was evaluated at 68 % of the total cost of chemical fertilizer required to restore soil fertility in a degraded soil (Honlonkou et al., 1999). Farmers' perception of crop importance in improving or depleting soil fertility were investigated in a recent survey conducted in the derived savanna (DS) in southern Benin to get first-hand indications of technologies that could enhance soil nutrients' stocks (Houngnandan et al., 2000;Aihou et al., 2006a;Aihou et al., 2006b). Giller and Wilson (1991) reported that various approaches could be used to solve the problem of soil fertility. The most obvious solution is to import nutrients in the form of chemical fertilizers but for a variety of social, economic, and other reasons, this is generally difficult. The alternative is to increase the biological input of nutrients and it is here that the biological fixation of atmospheric N has a crucial role to play in increasing the sustainability of yields with minimal external inputs."},{"index":2,"size":325,"text":"Farming systems based on the direct drilling with cover plants on Ferralsols showed advantages in the dynamics of certain nutritive elements (Balbino et al., 2007). Thus, concerning P, the direct drilling with cover plants also contribute to a better valorization while exploiting the organic share of this element in the system. Several low input practices offering a potential for improving soil fertility management in the study area were introduced. They include alley cropping and its variants which consist of the simultaneous planting trees and food crops (Acacia auriculiformis, Leucaena leucocephala and Gliricidia sepium are the most commonly used trees), Mucuna sp fallow or Mucuna sp in relay maize (Zea mays) cropping systems, and the pigeonpea (Cajanus cajan) as a resource management technology because of its dense biomass. All these introduced technologies at different scales face low adoption rates because of many technical, social, cultural and economic reasons: mismanagement, the socio-economic aspect, land tenure systems, suitable germplasms, nutrient deficiencies, diseases, etc. Cereals, particularly maize and sorghum, were regarded as depleting soil nutrients while legumes (Mucuna sp., Cajanus cajan and cowpea (Vigna unguiculata) in that order) are regarded as non-depleting. Cajanus cajan is a relatively new crop for smallholders of most African countries. But in recent times its cultivation in the moist savanna agro-ecological zone has gained popularity as a consequence of the increasing need for food and fodder. It is also important as a cash crop. Increasing attention goes also to the N 2 -fixation capacity of Cajanus cajan and its contribution to the subsequent crop in an attempt to develop sustainable cropping systems. Cereal/legume rotation effects on cereal yields have been frequently reported for semi-arid regions of West Africa (Bagayoko et al., 2000). Many authors have reported that a generally proposed cause for such effects is an increased N availability for the cereal crop from symbiotic N 2 -fixation by the preceding legume, which can lead to significant increases in the available soil N pool."},{"index":3,"size":358,"text":"Intercropping is an age-old practice in the tropics, and it has received the attention of researchers. Several studies indicate that this practice offers a considerable yield advantage over a sole cropping system, because of its efficient utilization of plant growth resources. In terms of land use, growing crops in mixed stands is regarded as more productive than growing them separately (Ofori and Stern, 1987). This may be due to some of the established and speculated advantages for intercropping systems such as higher grain yields, greater land use efficiency per unit land area, and improvement of soil fertility through the addition of N by fixation and excretion from the legume. Legumes are often credited with supplying large amounts of N to the succeeding non-leguminous crops grown in rotation (Hesterman et al., 1987). Kumar Rao et al. (1987) estimated that the amount of N 2 -fixed by Cajanus cajan genotypes of different maturity groups ranged between 6 and 60 kg N/ha. Adu-Gyamfi et al. (1997) found that Cajanus cajan fixed between 120-170 kg.ha -1 of atmospheric N throughout the cropping season. Cajanus cajan is unique in that, being a shrubby grain legume, it combines food production with ease of establishment, fast growing, high biomass productivity, and local acceptance. Azam et al. (1985) found with a pot experiment that fertilizer-N uptake by corn was reduced when Sesbania aculeta residues were added to the soil, although only 5 % of the legume's residue-N was absorbed. There are few published data on the relative availability of fertilizer-soil N and Cajanus cajan residue-N to crops in West Africa and particularly in the derived savanna. It was hypothesized that Cajanus cajan could intensify cropping in the derived savanna zone by restoring and maintaining the soil fertility status and by sustaining crop yields in improving the soil nutrient status for the companion crop in the intercrop or subsequent crop in rotation. As a result of the above-mentioned problems, the objectives of this study were (i) to evaluate the agronomic potential of maize and Cajanus cajan in rotation and as intercrop; (ii) to examine the factors influencing the performance of Cajanus cajan and maize in both systems."}]},{"head":"Material and methods","index":2,"paragraphs":[]},{"head":"Site description","index":3,"paragraphs":[{"index":1,"size":166,"text":"The study was carried out at an experimental field belonging to the \"Centre de Recherches Agricoles Sud-Bénin Sekou II˝ (6.625°N, 2.245 ′E) with an altitude of 100 m above sea level in the DS benchmark area, southern Benin. The zone is characterized by a bimodal rainfall distribution: between March and July and from September to November with an annual rainfall ranging from 947 to 1,060 m. A pronounced irregular rainfall pattern is observed during the cropping period. The trial was established on a site referred to as \"terre de barre\" soils, a common local name for the various red soils developed on the continental terminal formation as found in the coastal zone of Benin, Togo and south-western Nigeria. The soil of the site was deep; dark reddish brown with a textural B-horizon developed on Continental Terminal material and is classified as Ferrali-Haplic Acrisols (FAO, 1991). The selected soil chemical properties of the soil profile before the trial implementation at Sekou II are given in Table 1. "}]},{"head":"Experimental details","index":4,"paragraphs":[{"index":1,"size":179,"text":"The experiment started in site, where three years old fallow vegetation dominated by Chromolaena odorata was removed from the trial area. The experiment was a randomized complete block design with four replications and the following treatments (cropping systems) in rotation or in intercropping (Table 2). An amount of 28 kg N, 46 kg P 2 O 5, and 28 kg K 2 O/ha was applied 2 weeks after planting and an additional 46 kg N/ha was applied 6 weeks after planting on the maize. For this trial, simple fertilizers were used such as urea (46 %N), triple superphosphate (46 % P 2 O 5 ) and KCl (60 % K 2 O). The plot area for each treatment was 6.4 m x 6.4 m. In monoculture or in intercropping, maize was planted at 0.80 m x 0.40 m with 2 plants per hill. Cowpea was planted at 0.60 m x 0.20 m with 1 plant per hill. Cajanus cajan was planted at 0.80 m x 1.60 m with 1 plant per hill in monoculture as well as in intercropping."}]},{"head":"Soil sampling","index":5,"paragraphs":[{"index":1,"size":49,"text":"Before the trial implementation in year 1, the field soil were sampled taken at the top soil (0-30 cm) and the following soil chemical characteristics were determined: total C (0.62 %), total N (1.07 %), total phosphorus (13.82 %), pH (H 2 O) (5.40), pH (CaCl 2 ) (6.68). "}]},{"head":"Plant sampling","index":6,"paragraphs":[{"index":1,"size":74,"text":"At harvest, maize grain and stover; cowpea grain and haulms; Cajanus cajan grain, biomass and fresh wood were recorded. For maize, cowpea and Cajanus cajan, four plants were randomly selected in each plot and at harvesting time recorded for dry matter (DM) yield after drying the samples at 65 °C for 72 hours. All samples of the maize parts were analyzed for N and P following the method described by Anderson and Ingram (1993)."}]},{"head":"Calculation of yield efficiency","index":7,"paragraphs":[{"index":1,"size":11,"text":"Fertilizer N use by maize from urea-N was evaluated as follows:"}]},{"head":"Land Equivalent Ratio","index":8,"paragraphs":[{"index":1,"size":50,"text":"The Land Equivalent Ratio (LER) was used to evaluate intercrop efficiencies in yield and N uptake by the plants with respect to simple crops (Willey, 1979). The LER defines yield as a function of area: LER = IC a / MC a + IC b / MC b , where:"},{"index":2,"size":30,"text":"IC and MC refer to intercrop and monocrop yields or N uptake, respectively, and the subscripts a and b indicate the crop yields of the two plants in the mixture."}]},{"head":"Statistical analysis","index":9,"paragraphs":[{"index":1,"size":33,"text":"All data from maize, cowpea, and Cajanus cajan were submitted to analysis of variance with the GLM procedure of the SAS system (SAS, 1992). The LSMEANS statement was used to calculate the means."}]},{"head":"Results","index":10,"paragraphs":[]},{"head":"Crop yields","index":11,"paragraphs":[{"index":1,"size":26,"text":"In year 1 and year 2, both the sole and intercropped maize showed significant responses to N applied at the rate of 74 kg N/ha -1"},{"index":2,"size":53,"text":". The increase in maize grain yield ranged from -1.55 to 215 % compared to the control. Maize grain yield of the intercrop treatment without N-fertilizer in year 1 increased by 9 % compared to the control, while in year 2, it decreased by 2 % compared to the control (1,809 kg.ha -1"},{"index":3,"size":43,"text":"). In year 1 and year 2, maize stover yield increased between -24 and 203 % compared to the control. Maize stover yield in the intercrop treatment without N-fertilizer decreased by 24 % in year 2 compared to the control (3,194 kg.ha -1"},{"index":4,"size":5,"text":") (Tables 3 and 4)."},{"index":5,"size":53,"text":"In the second season of both years, the mean cowpea grain was higher in treatment 2 than the treatment 4. The same trend was observed with cowpea haulms in the second season of year 1. In the second season year 2, cowpea grain and haulms were lower compared to year 1 (Table 5)."},{"index":6,"size":11,"text":"Cajanus cajan grain yield (in intercrop) without N-fertilizer (298 kg.ha -1"},{"index":7,"size":11,"text":") was 56 % higher than with Nfertilizer (132 kg.ha -1"},{"index":8,"size":13,"text":"). Cajanus cajan fallow produced 16 % less grain than intercropped Cajanus cajan."},{"index":9,"size":47,"text":"In the present study, only data of Cajanus cajan in year 1 were evaluated. Cajanus cajan in pure stand as fallow and at the same density as intercropped produced 43 to 62 % more leaf dry matter than intercropped leaf dry matter without N-fertilizer (1,248 kg.ha -1"},{"index":10,"size":62,"text":") and 31 to 48 % more leaf dry matter than intercropped Cajanus cajan leaf dry matter with N-fertilizer. Without fertilization Cajanus cajan in pure stand as fallow produced 73 to 97 % more fresh wood than intercropped and 91 to 118 % with N-fertilizer. Intercropped Cajanus cajan with N-fertilizer produced 11 % less fresh wood than intercropped without Nfertilizer (Table 6)."},{"index":11,"size":50,"text":"A significant correlation was found between the leaf dry matter and the fresh wood of Cajanus cajan (r=0.72). The Cajanus cajan grain yield was significantly inversely related to the maize grain yield (r=-0.51). A significant correlation was found between the maize grain yield and the maize stover (r=0.69) (Table 7)."}]},{"head":"=","index":12,"paragraphs":[]},{"head":"Yield efficiency (kg maize grain DM kg","index":13,"paragraphs":[{"index":1,"size":52,"text":"-1 N) Amount of fertilizer applied Actual maize DM yield -Absolute control DM yield Table 3. Mean of maize grain and stover dry matter yield (kg.ha -1 ) and percentage increase over the cropping system maize non fertilized in monoculture (MZNFm) (T1) in the first season in year 1 and year 2."},{"index":2,"size":29,"text":"Cropping system Year 1 Year 2 grain (kg.ha -1 ) SD % increase stover (kg.ha -1 ) SD % increase grain (kg.ha -1 ) SD % increase stover (kg.ha "}]},{"head":"Total nitrogen content in the maize plants","index":14,"paragraphs":[{"index":1,"size":112,"text":"The total N content in the maize grain increased by 5 to 245 % compared to the control (7.65 kg N/ha). It was 190 % higher than without N-fertilizer (8.02 kg N/ha). A similar trend was observed in the N content of maize stover and the total N content of the maize cobs. In the second season of year 1, treatments without intercropping and receiving N fertilizer had a total N content in the maize grain that varied between 9 and 30.67 kg N/ha. For the stover, it varied between 4.37 and 16.24 kg N/ha, and for the cobs, it ranged between 0.85 and 2.61 kg N/ha (Tables 8, 9 and 10)."}]},{"head":"Total phosphorus content in the maize plants","index":15,"paragraphs":[{"index":1,"size":182,"text":"In the first season of year 1, the total phosphorus content in the maize grain increased between 21 and 366 % compared to the control (1.49 kg P/ha). While the total phosphorus content in the grain of the intercrop Cajanus cajan with N-fertilization was 13 times more than of the intercrop without N-fertilizer. In the stover, it increased by 4.41 to 84.56 % compared to the control (1.36 kg P/ha). The total phosphorus content in the cobs increased by 106 to 176 % compared to the control. But with the intercrop, without fertilizer, it decreased by 11.76 % compared to the control. In the second season of year 1, the treatments without intercropping and receiving N-fertilizer had a total phosphorus content in the maize grain which varied between 2.12 and 5.73 kg P/ha, for stover it varied between 0.43 to 1.29 kg P/ha, and for the cobs, it ranged between 0.08 and 0.28 kg P/ha. However, a significant increase was not observed between the total phosphorus content in the stover when intercropped with N-fertilizer or without N-fertilizer (Tables 8, 9 and 10)."}]},{"head":"Yield efficiency","index":16,"paragraphs":[{"index":1,"size":76,"text":"In year 1, the yield efficiency ranged between 12.18 and 21.95 %.While in year 2, it varied between 23.67 and 33.98 %. It was observed that the efficiency was low in all cropping systems in year 1 (Table 11). The water is one of the main factors, which affect the yield efficiency. When the rainfall pattern was favourable in year 2, the yield efficiency was higher in all-cropping systems receiving N-fertilizer than those in year 1."}]},{"head":"Land Equivalent Ratio","index":17,"paragraphs":[{"index":1,"size":33,"text":"Cajanus cajan/maize intercropping gave a higher LER of 2.41 in grain production than the monoculture cropping but it was the monoculture cropping and intercrop without N-fertilizer that gave the highest LER (Table 12). "}]},{"head":"Discussion","index":18,"paragraphs":[{"index":1,"size":44,"text":"Many authors have raised that the lack of N and P most often limit crop yields and microbial activity. Some cover plants as Cajanus cajan contribute to improve its biodisponibility (Balbino et al., 2007). The fodder plant better recycle part of the ions NO"},{"index":2,"size":83,"text":", Mg 2+ which would be if not lixiviated (Balbino et al., 2007). Consequently in this study, application of N enhanced grain yield as has been found in many studies. The most striking observation made in this study was that grain yields decreased in the intercropped, maize/pigeonpea without N-fertilizer, while it was increased with N fertilizer. Despite pigeonpea and maize generally grown under inter-or mixed cropping system, studies on fertilizer use efficiency (FUE) have mainly focused on sole cropping systems than in mixture."},{"index":3,"size":81,"text":"The response to N-fertilization was remarkable in both years. Intercrop maize with N-fertilization produced the highest yield as compared to the other treatments with N. But intercrop maize without N-fertilization produced the lowest yield and no significant increase was observed as compared to the control. Rao et al. (1987) reported that any beneficial effect from legumes should have been evident when 0 N.ha -1 is applied to the cereal. In fact, the legume reduces the cereal yield at 0 N.ha -1"},{"index":4,"size":160,"text":". He pointed out that these results suggest that the cereal under most field conditions does not derive any beneficial effect from the legume during the current season, particularly when it is grown at full population and without Nfertilization. Therefore, to obtain good yields, fertilizers should be applied in both the inter and sole cropping. Application of N fertilizer to legumes decreases its dependency of the N 2 fixation. Therefore most farmers assume that N application to intercropping system may be antagonistic instead of synergetic (Adu-Gyamfi et al., 1997). N requirements of sorghum when grown as sole crop are reported to be higher than when grown as intercrop (Adu-Gyamfi et al., 1997). However, they pointed out higher nutrient uptake by pigeonpea/maize, pigeonpea/sorghum as compared to sole-cropped pigeonpea. It was reported also in a pigeonpea intercrop treatment that 80 kg N.ha -1 was optimal, where as Adu-Gyamfy et al. (1996) recommended a moderate rate dose of 25-30 kg N.ha -1 ."},{"index":5,"size":200,"text":"The response of maize to N in any studied cropping system is mainly dependent on the seasonal rainfall. In a normal season, it is economical when rainfall is high and well distributed. In this study, in year 1, grain yields decreased with decreasing rainfall compared to the results of year 2. Despite the decreasing rainfall and grain yields in this study, a significant grain yield increase occurred due to N application and current soil fertility status. Sakala et al. (2000) reported that when crops are grown in association, the residues of the different crops become mixed so that residues of different quality decompose simultaneously within the same soil volume. Interaction between decomposing residues can be complex and result in N mineralization patterns which are not readily predicted from N mineralization of the separate component of the mixture. Maize yield in the rotation maize/cowpea or rotation Cajanus cajan fallow/maize, with Nfertilization, produced a good yield as intercrop. Giller (2001) argued that for grain legumes, to play an important role in maintaining soil fertility for other crops in rotation, they must obviously leave behind more N from N 2 -fixation than the amount of soil N that is removed in the crop."},{"index":6,"size":188,"text":"The amount of total N and P in the different plant parts of maize was high in all treatments receiving fertilizers but it was low with intercropping and no fertilizer. A probable explanation is that Nfertilization promotes the mineralization of soil N and consequently enhances N uptake and yield efficiency. Rao et al. (1987) reported that the efficiency of N utilization was less in intercropping, probably because of competition from legumes and their sharing of some N. They pointed out that the difference between a sole and intercropped cereal was less when the associated legume was pigeonpea or groundnut. It was reported that fertilizer N recovery (FNR) by sole-cropped pigeonpea (14 %) was higher than intercropped pigeonpea (2-4 %). The low FNR by intercropped Cajanus cajan is attributed to the fact that no N fertilizer was applied to intercropped pigeonpea (Adu-Gyamfi et al., 1996). These authors suggested that N application to pigeonpea during the pod filling stage (where the N 2 fixing ability is low and N requirement is high) could help to increase the grown yield and the overall productivity of the system (Adu-Gyamfi et al., 1997)."},{"index":7,"size":276,"text":"The Land Equivalent Ratio was higher in the treatment without N-fertilizers and less in the treatments with N-fertilizers. Willey (1979) reported that this trend apparently supports the hypothesis that intercropping is more relevant for poor environments; but the monetary advantage which remained little affected by N does not suggest that intercropping has to be replaced by sole cropping with N-fertilizer. Dalal (1974) reported that intercropping maize with either beans or cowpeas had more adverse effects on the grain yield of the maize than pigeonpea. He attributed this to the fact that high rates of nutrient absorption by the two legumes coincided with uptake by the maize crop, whereas with pigeonpea the greatest nutrient demand occurred after the maize crop had been harvested. N-beneficial effects of the legumes on the associated crop could arise from improved mineralization of soil N by the priming effect of the legume, excretion of nitrogenous compounds from nodulated root systems, N-conserving effects, the greater competitive ability of the companion crop for soil N compared to the legume which generally holds true when legumes are intercropped with cereals, the decay of sloughed-off nodules and roots, leaching of soluble N from leaves, and the decay of fallen leaves (Senaratne et al., 1995). Danso et al. (1987) reported that the well known contribution of a grain legume in an intercrop is that of its ability to fix atmospheric N 2 which therefore presumably reduces the competition for soil N with the associated non-Nfixing crop. This was reported, despite some reports of N transfer from a grain legume to an associated non-legume. Several others have shown that this does not occur, or is of little importance."},{"index":8,"size":234,"text":"Several researchers have reported N transfer from grain legumes to the associated crop i.e. from groundnut, cowpea and mungbean to sorghum, to wheat, from soybean to sorghum and from cowpea to maize. On the other hand, some researchers could not observe any N transfer from legumes to the associated crop, i.e. from fababean to barley. Nitrogen transfer from legumes may depend on the N 2 fixation, the genotype, the interspecies distance, the legume/cereal ratio, the fertility level, the mycorrhizal colonization, etc. (Senaratne et al., 1995). They suggested that further studies on the above mentioned aspects would prove useful in elucidating and promoting N transfer, and in assessing its significance in sustaining the productivity of low-input legume-based intercropping systems. We do not know when intercropping began nor why civilization fostered its use, whether by design or accident. Intercropping dominated early agriculture and it is still practiced in many areas of the worlds (Anders et al., 1996). With regard to that, it is known that legume/cereal intercropping would minimize the application of N-fertilizers in the tropics. In this study, there was no direct evidence that intercropped maize gained N from associated pigeonpea. For further research, it is necessary to draw more attention on plant species (germplasm and cycles), spatial arrangement, date of sowing (to minimize competition), tillage, balanced plant nutrient management and integrate diseases and insect control for optimum performance of maize/pigeonpea intercropping, pigeonpea fallow/maize rotation."}]},{"head":"Conclusion","index":19,"paragraphs":[{"index":1,"size":173,"text":"The increase in maize grain yield ranged from -1.55 to 275 % in all cropping systems (rotation or intercropping with pigeonpea), with or without N-fertilizer application compared to the control (maize/maize in rotation without N-fertilizer). The maize grain yield in intercropping without N-fertilizer increased by 9 %. Pigeonpea grain yield (in intercropping) without N-fertilizer was 56 % higher than this with N-fertilizer. Pigeonpea as fallow produced 73 to 97 % more fresh wood than intercropped pigeonpea without fertilization and 91 to 118 % more fresh wood than intercropped pigeonpea with N-fertilizer. The intercropped pigeonpea with N-fertilizer produced 11 % less fresh wood than intercropped without Nfertilizer. The total N amount in the maize grain increased by 5 to 245 % in all cropping system (rotation and intercropping with Cajanus cajan, with or without N-fertilizers compared to the control. The N yield was low in intercropping without N-fertilizer. The total P followed the same trend as total N. The Land Equivalent Ratio (LER) was higher in cropping systems without N-fertilizer than in those fertilized."},{"index":2,"size":83,"text":"The ultimate result of a cropping system that does not replace the nutrients removed by the crops is impoverishing of soil and poor crop yields. The maize/pigeonpea intercropping without N-fertilizer produced the lowest grain yield and the lowest N yield compared to the cropping systems receiving Nfertilizers. To make more sustainable and efficient maize/pigeonpea intercropping or maize/pigeonpea rotation, a minimun amount of N-fertilizer as well as other biological treatments (e.g. % AMF) are required according to the soil fertility and water use management."}]}],"figures":[{"text":"Table 1 . Selected soil profile physical and chemical characteristics at Sékou II (Derived Savanna, Benin) Depth Soil characteristics 0-8 cm 8-22 cm 22-44 cm 44-94 cm 94-140 cm  Sand (g.kg -1 ) 770 750 620 460 400 Sand (g.kg -1 )770750620460400 Silt (g.kg -1 ) 60 40 40 20 10 Silt (g.kg -1 )6040402010 Clay (g.kg -1 ) 170 210 340 520 590 Clay (g.kg -1 )170210340520590 Total C (%) 0.85 0.65 0.37 0.32 0.25 Total C (%)0.850.650.370.320.25 Total N (%) 0.073 0.056 0.042 0.048 0.037 Total N (%)0.0730.0560.0420.0480.037 C/N 11.7 11.6 8.6 6.7 6.9 C/N11.711.68.66.76.9 Bray P (mg.kg -1 ) 2.20 0.70 0.90 1.40 0.20 Bray P (mg.kg -1 )2.200.700.901.400.20 CEC (cmol. kg -1 ) 4.2 3.7 3.4 4.0 5.7 CEC (cmol. kg -1 )4.23.73.44.05.7 pH(H2O) 5.7 5.7 5.6 5.8 5.8 pH(H2O)5.75.75.65.85.8 PH(KCl) 4.9 4.7 4.6 4.8 5.0 PH(KCl)4.94.74.64.85.0  "},{"text":"Table 2 . Repartition in time and space of the cropping system  Cropping system Identification Year 1 Cropping systemIdentificationYear 1  "},{"text":"Table 4 . Mean of maize grain and stover dry matter yield (kg.ha -1 ) and percentage increase over the cropping system maize non fertilized in monoculture (MZNFm) (T1) in the second season in year 1 and year 2 Cropping system Year 1 Year 2 grain (kg.ha -1 ) SD % increase stover (kg.ha -1 ) SD % increase grain (kg.ha -1 ) SD % increase stover (kg.ha -1 ) SD % increase  -1 ) SD % increase -1 ) SD % increase  "},{"text":"Standard Deviation Bulletin de la Recherche Agronomique du Bénin Numéro 60 -Juin 2008 25Table 5 . Mean of cowpea grain and haulms dry matter (kg.ha -1 ) in the second season in Year 1 and Year 2 Cropping system Year 1 Year 2 grain (kg.ha -1 ) SD haulms (kg.ha -1 ) SD grain (kg.ha -1 ) SD haulms (kg.ha -1 ) SD  MZF/Co (T2) 519 134 3,811 622 181 4 1,887 287 MZF/Co (T2)5191343,81162218141,887287 MZF/Co/Cc (T4) 438 105 3,538 755 - - - - MZF/Co/Cc (T4)4381053,538755---- Cc/MZF/Co (T8) - - - - 83 1 2,468 472 Cc/MZF/Co (T8)----8312,468472 SD: Standard Deviation         SD: Standard Deviation  "},{"text":"Table 6 . Grain, leaves and fresh wood dry matter of Cajanus cajan (kg.ha -1 ) in year 1 Cropping systems grain (kg.ha -1 ) SD leaves dry matter (kg.ha -1 ) SD Fresh wood (kg.ha -1 ) SD  MZNFICc (T3) 298 131 1,249 625 5,857 1,633 MZNFICc (T3)2981311,2496255,8571,633 MZFICc (T7) 132 35 1,361 246 5,300 2,633 MZFICc (T7)132351,3612465,3002,633 Cc/MZF/Co (T8) 249 76 2,022 485 10,136 1,239 Cc/MZF/Co (T8)249762,02248510,1361,239 Cc/MZF/MZF (T9) 249 49 1,784 771 11,543 1,402 Cc/MZF/MZF (T9)249491,78477111,5431,402 SD: Standard Deviation       SD: Standard Deviation  "},{"text":"Table 7 . Correlation coefficient between pigeonpea grain, pigeonpea dry matter leaves, pigeonpea fresh wood and maize grain and stover parameters pigeonpea grain pigeonpea dry matter leaves pigeonpea fresh wood maize grain maize stover  pigeonpea grain - ns Ns -0.51 ns pigeonpea grain-nsNs-0.51ns pigeonpea dry matter leaves ns - 0.72 ns ns pigeonpea dry matter leavesns-0.72nsns pigeonpea fresh wood ns 0.72 - ns ns pigeonpea fresh woodns0.72-nsns maize grain -0.51 ns Ns - 0.69 maize grain-0.51nsNs-0.69 maize stover ns ns Ns 0.69 - maize stovernsnsNs0.69- * significant at p<0.05; **      * significant at p<0.05; **  "},{"text":"significant at p<0.01; ns: not significant   "},{"text":"Table 8 . % total N and % total P in maize grain and stover, and cob in first season year 1  % total N % total N Cropping systems Cropping systems  "},{"text":"Table 9 . Total N and P (kg.ha -1 ) in the different parts of maize and percentage increase over the control (MZNFm) in the first season 1999 Cropping systems  Total N Total N  "},{"text":"Table 10 . Total N and P (kg.ha -1 ) in the different parts of maize and percentage increase over the control (MZNFm) in the second season year 1  Total N Total N Cropping systems Cropping systems  "},{"text":"Table 11 . Maize grain yield efficiency in the first and second season of year 1 and Year 2  Year 1 Year 1 Cropping systems Cropping systems  "},{"text":"kg) Yield Efficiency Grain yield (kg) Yield Efficiency Grain yield (kg) Yield Efficiency Grain yield (kg) Yield Efficiency  MZNFm (T1) 582 - 719 - 1,809 - 349 - MZNFm (T1)582-719-1,809-349- (MZF/Co (T2) 1,737 15.60 - - 4,052 30.31 - - (MZF/Co (T2)1,73715.60--4,05230.31-- MZNFICc (T3) 634 - - - 1,781 - - - MZNFICc (T3)634---1,781--- MZF/Co/Cc (T4) 1,836 16.95 - - -  - - MZF/Co/Cc (T4)1,83616.95----- MZFm (T5) 1,483 12.18 2,344 21.95 3,565 23.72 2,101 23.67 MZFm (T5)1,48312.182,34421.953,56523.722,10123.67 MZF/Cc (T6) 1,780 16.19 2,276 21 - - - - MZF/Cc (T6)1,78016.192,27621---- MZFICc (T7) 1,813 16.64 (15.93) - - 3,991 29.48 (29.86) - - MZFICc (T7)1,81316.64 (15.93)--3,99129.48 (29.86)-- Cc/MF/Co (T8) - - - - 3,982 29.36 - - Cc/MF/Co (T8)----3,98229.36-- Cc/MZF/MZF (T9) - - - - 4,324 33.98 2,352 27.07 Cc/MZF/MZF (T9)----4,32433.982,35227.07  "},{"text":"Values between brackets are yield efficiency of maize in intercropping Bulletin de la Recherche Agronomique du Bénin Numéro 60 -Juin 2008 29 Table 12. Land Equivalent Ratio (LER) in first season of Year 1 Intercropping system   Maize grain yield in intercropping (kg.ha -1 ) Maize in monoculture cropping system Maize grain yield in monoculture (kg.ha -1 ) Cajanus cajan in monoculture Cajanus cajan grain (kg.ha -1 ) yield in monoculture Cajanus cajan in intercropping Cajanus cajan grain (kg.ha -1 ) yield in intercropping LER Maize grain yield in intercropping (kg.ha -1 )Maize in monoculture cropping systemMaize grain yield in monoculture (kg.ha -1 )Cajanus cajan in monocultureCajanus cajan grain (kg.ha -1 ) yield in monocultureCajanus cajan in intercroppingCajanus cajan grain (kg.ha -1 ) yield in intercroppingLER MZNFICc (T3) 634 MZNFm (T1) 582 Cc/MZF/Co (T8) 249 MZNFICc (T3) 298 2.41 MZNFICc (T3)634MZNFm (T1)582Cc/MZF/Co (T8)249MZNFICc (T3)2982.41 MZFICc (T7) 1,813 MZF/Co/Cc (T4) 1,836 Cc/MZF/Co (T8) 249 MZFICc (T7) 132 1.52 MZFICc (T7)1,813MZF/Co/Cc (T4)1,836Cc/MZF/Co (T8)249MZFICc (T7)1321.52 MZFICc (T7) 1,813 MZFm (T5) 1,483 Cc/MZF/Co (T8) 249 MZFICc (T7) 132 1.75 MZFICc (T7)1,813MZFm (T5)1,483Cc/MZF/Co (T8)249MZFICc (T7)1321.75 MZFICc (T7) 1,813 MZF/Cc (T6) 1,780 Cc/MZF/Co (T8) 249 MZFICc (T7) 132 1.55 MZFICc (T7)1,813MZF/Cc (T6)1,780Cc/MZF/Co (T8)249MZFICc (T7)1321.55  "}],"sieverID":"b40d25f9-b967-4a43-9830-843d83bdc006","abstract":"The following nine main cropping systems were evaluated: maize/maize in rotation without N-fertilizer (control); maize/cowpea in rotation where maize received N-fertilizer; maize/pigeonpea intercropping without N-fertilizer; maize/cowpea/pigeonpea in rotation where maize received N-fertilizer; maize/maize in rotation with N-fertilizer; maize/pigeonpea fallow in rotation where maize received N-fertilizer; maize/pigeonpea intercropping where maize received N-fertilizer; pigeonpea/maize/cowpea in rotation where maize received N-fertilizer; pigeonpea/maize/maize where maize received N-fertilizer. The rate of N-fertilizer applied was 74 kg N as urea (28 kg N/ha 2 weeks after planting maize and 46 kg N/ha 6 weeks after planting maize). Compared to the control, the increase in maize grain yield ranged from -1.55 to 215 % for all cropping systems receiving N-fertilizer and intercropping without N-fertilizer, maize grain yield in intercropping without N-fertilizer increased by 9 % in first year and decreased by 1.55 % in second year compared to the control. The maize stover yield with N-fertilizer application increased by -24 up to 203 %. Pigeonpea grain yield (in intercropping) without N-fertilizer was 56 % higher than with N-fertilizer. Pigeonpea as fallow produced 73-97 % more fresh wood than intercropped pigeonpea without fertilization and 91-118 % more fresh wood than intercropped pigeonpea with N-fertilizer. The intercropped Cajanus cajan with N-fertilizer produced 11 % less fresh wood than intercropped without N-fertilizer. The total N amount in the maize grain yield increased by 5-245 % for the first season of year 1 compared to the control and increased by 241-260 % for the second season of year 1 compared to the control. The total N amount in the maize grain of the intercropped pigeonpea/maize with N-fertilizer was 190 % higher than the intercropped pigeonpea/maize without N-fertilizer. The total amount of P follows the same trend as Nfertilizer in intercropped systems. The yield efficiency was low in year 1 compared to year 2. The Land Equivalent Ratio (LER) was higher in cropping system without N-fertilizer than with N-fertilizer."}

data/part_2/07968321e8671d5ae5f06f141ff501d2.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07968321e8671d5ae5f06f141ff501d2","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0ce2d839-448b-4b6d-9051-317e57334078/retrieve"},"pageCount":1,"title":"§ using ICARDA's genebank for farmers § on-station screening and on-farm evaluation § community-based seed multiplication and dissemination","keywords":[],"chapters":[{"head":"Context","index":1,"paragraphs":[{"index":1,"size":25,"text":"• ICARDA exploited the 35,000 accessions of forage, pastures and range genetic resources in its genebank to enrich the forage agrobiodiversity in the MENA region"},{"index":2,"size":10,"text":"• most of them are not tested under agricultural conditions"}]},{"head":"Our innovative approach","index":2,"paragraphs":[{"index":1,"size":46,"text":"• under the project, a total of 1355 forage pastures and range species accessions accessions of fourteen genus from the ICARDA's genebank were tested to field evaluation under rainfed conditions for drought resistance and high biomass yield in the ICARDA research station in Terbol, 2018-2020, Lebanon"},{"index":2,"size":34,"text":"• suitability to cutting, grazing and combination of both have been evaluated using the parameters of biomass yield, sward density and sward height (observation scale from 1 -9) under intensive and extensive dryland systems"}]},{"head":"Future steps","index":3,"paragraphs":[{"index":1,"size":12,"text":"• In a next phase the selected species will be subjected to: "}]}],"figures":[{"text":"• out of 1355 forage and range plant accessions tested, a total of 279 accessions were selected consisting of 109 accessions (8.0 %) and 170 accessions (12.5 %) with high potential of forage production and rangeland improvement under intensive and extensive dryland systems• most of the selected accessions are annual Medicago species (68.1 %) and Trifolium species (22.9 %). The remaining 9.0 % accessions are Trigonella sp., Astragalus sp., Hedysarum sp., Meliotus sp., Coronilla sp. and Hymenocarpos sp. Plot harvesting by hand, Terbol station, photo: A. Shehadeh ENVIRONMENTAL HEALTH & BIODIVERSITY The CGIAR Research Program on Livestock thanks all donors & organizations which globally support its work through their contributions to the CGIAR Trust Fund. cgiar.org/funders This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. June 2020 "},{"text":" (a) assessment of nutritional values (b) on-farm evaluation under grazing and cutting and carry management (c) a community-based seed multiplication and dissemination Matthias Benke, ICARDA [email protected] FEED & FORAGES "}],"sieverID":"b631338b-b260-43da-bfa0-3f29241b7460","abstract":""}

data/part_2/07adf664dd44286ec2f579ee9f1e06e1.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07adf664dd44286ec2f579ee9f1e06e1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8b6dfa3f-4693-4a08-bc26-b11f5108ae36/retrieve"},"pageCount":35,"title":"Cassava Diseases","keywords":[],"chapters":[{"head":"Diseases Caused by Fungi Superelongation disease (Elsinoe brasiliensis)","index":1,"paragraphs":[{"index":1,"size":45,"text":"Importance. Superelongation disease (SED) attacks susceptible cultivars, especially during the rainy seasons. Damage caused by SED is highly variable, depending on the level of cultivar resistance, climatic conditions, concentration of the initial inoculum, and the degree of contamination of planting materials (Álvarez and Llano 2002)."},{"index":2,"size":92,"text":"Losses can exceed 80% of total production in young crops, whereas significant losses do not occur in crops that are more than 6 months old. In Colombia, SED is found in the Eastern Plains, Atlantic Coast, and inter-Andean valleys. The disease is acute in agroecological areas with annual mean temperatures of 28 ºC and annual precipitation of more than 1500 mm. In the greenhouse, 8 h of misting at temperatures of 25 to 30 ºC was sufficient to cause an outbreak, indicating how easily the pathogen develops in the field (Mejía 2001)."},{"index":3,"size":75,"text":"Distribution. Superelongation disease was first observed by Bitancour and Jenkins in 1950, on Manihot glaziovii Muell.-Arg. in Brazil and Nicaragua and on M. esculenta in the Dominican Republic and Guatemala. The disease has since been reported (in order of reporting year) in Costa Rica (Larios and Moreno 1976), Colombia (Lozano and Booth 1979), Mexico (Rodríguez 1979), Cuba (Pino 1980), Venezuela (Rondón and Elizabeth Álvarez 1 , Germán Alberto Llano 2 , and Juan Fernando Mejía "}]},{"head":"B C","index":2,"paragraphs":[{"index":1,"size":60,"text":"Aponte 1981), the Dominican Republic (Sosa 1992), Barbados, Panama (Chávez 1992;Zeigler 2000), Brazil (where it is restricted to the western regions of the country) (Álvarez et al. 2003d), and Trinidad and Tobago (Reeder et al. 2008). At the end of 2008, the disease was detected in Thailand (E Álvarez 2008, pers. comm.). The disease appears to be unknown in Africa."}]},{"head":"Symptoms and epidemiology.","index":3,"paragraphs":[{"index":1,"size":126,"text":"The characteristic symptom of this disease is the exaggerated lengthening of stem internodes (Zeigler et al. 1980), creating thin and weak stems. Diseased plants are much taller and/or weaker and spindlier than healthy ones. In green sections of stems, and in petioles and leaves, deformations develop in associations with cankers. The lens-shaped cankers often have dark margins and are variable in size. In leaves, cankers are found on the underside, along the primary or secondary nervures. In stems, they may be more diffuse. Frequently, young leaves curl, and do not develop fully nor do the leaf blades expand completely. Leaves also develop irregular white spots (Figure 8-1). Sometimes partial or total death of leaves occurs, resulting in considerable defoliation. Dieback of the plant may also occur."},{"index":2,"size":77,"text":"The disease spreads from one place to another through the use of infected stakes. The principal focuses of infection frequently constitute the shoots originating from residues of old plants left in the field after harvest. The disease spreads rapidly during the rainy season. This rapid dissemination is believed to occur through the formation of spores in the cankers. These spores can survive for more than 6 months in infected plants and are carried by rain and wind."},{"index":3,"size":100,"text":"Etiology. Superelongation disease is caused by the fungus Elsinoe brasiliensis, which initially grows on the epidermis of the host and, after penetration, grows in the intercellular spaces in tissues of the epidermis and cortex. The fungus produces gibberellins, which promote the exaggerated growth in the plant's internodes. Gibberellins, as suggested by previous studies for other pathogens (Muromtsev and Globus 1975), play an essential role in the fungus's nutrition. The fungus, which has a low production of hydrolytic enzymes, uses this hormone to obtain sugars from the plant, promoting, at the molecular level, hydrolysis of carbohydrates with greater mass (Mejía 2001)."},{"index":4,"size":59,"text":"According to Álvarez and Molina (2000), the pathogen's genetic diversity in Colombia is broad, presenting differences among isolates within a single location and between locations. Isolates from the Atlantic Coast, Eastern Plains, and inter-Andean valleys of Colombia and from central and southern Brazil comprise two evolutionary units, with each unit relating to its respective country (Álvarez et al, 2001)."},{"index":5,"size":30,"text":"For gene 18S rRNA, obtained from two isolates of E. brasiliensis, the sequencing of a region involving ITS1 and ITS2 was reported to GenBank (accessions AY739018 and AY739019; CIAT 2004)."},{"index":6,"size":54,"text":"Host range. Elsinoe brasiliensis and Sphaceloma species (the asexual state), which both attack cassava, have a wide range of Euphorbiaceae hosts, including Euphorbia brasiliensis L., E. hypericifolia L., Jatropha aconitifolia Muell. var. papaya Arbelaez, J. curcas L., Manihot carthaginensis Muell., M. esculenta, and M. glaziovii. These hosts are cosmopolitan weeds and widely cultivated ornamentals."},{"index":7,"size":68,"text":"Many regions in Africa and Asia have climatic conditions that closely resemble to those of the Eastern Plains, Atlantic Coast, and inter-Andean valleys of Colombia, where the pathogen causes considerable losses. These African and Asian regions therefore face the danger that the pathogen will be introduced through planting materials of ornamentals such as Jatropha spp. L., which are not necessarily restricted by the same sanitary regulations as cassava."},{"index":8,"size":71,"text":"Because the host range is broad, completely eradicating the pathogen is impossible and a certain amount of sufficient inoculum will be present throughout the year. In Brazil, the weed Euphorbia heterophylla L. was shown to be host to strains of Elsinoe brasiliensis that were highly pathogenic to cassava (Álvarez et al. 2003d). Furthermore, the genetically very variable hosts are also able to maintain a variable population of the pathogen (Zeigler 2000)."},{"index":9,"size":79,"text":"Integrated disease management. The use of healthy seed, obtained from disease-free plants or from plants derived from meristem culture, comprises a tool that may be sufficient to maintain disease-free crops. However, one preventive method for eradicating the pathogen is to immerse infected stakes for 10 min in captafol at 4.8 g/L of active ingredient (a.i.). When symptoms are observed in the field, foliar spraying should be carried out with difenoconazole at 0.07 cc/ha, followed by crop rotation with grasses."},{"index":10,"size":56,"text":"In areas where the pathogen is endemic, planting should be carried out during periods with the least precipitation (CIAT 2003b). Infected plants (cassava or other Euphorbiaceae hosts) should be destroyed as soon as they are identified. The best way to eliminate this material is to pull up infected plants and burn them in situ (Zeigler 2000)."},{"index":11,"size":113,"text":"Varietal resistance. The selection of resistant varieties is perhaps the best alternative for controlling SED. Between 1995 and 2007, CIAT evaluated about 6400 genotypes at Villavicencio (Colombia) and found 257 with resistance to SED. On-farm evaluations at Sincelejo (Sucre, Colombia) showed the following as resistant: M Ven 25 and CM 4843-1, followed by ICA Catumare, ICA Cebucán, ICA Negrita, Vergara (CM 6438-14), and CM 4574-7 (CIAT 2001, 2002b, 2003a). Pathogenic races of E. brasiliensis exist and are of high genetic variability. While they should be taken into account when improving resistance to SED (Álvarez and Molina 2000;Álvarez et al. 2003d), they are not thought to pose serious constraints to varietal improvement (Zeigler 2000). "}]},{"head":"Biological control. Spraying with suspensions of","index":4,"paragraphs":[{"index":1,"size":18,"text":"Pseudomonas putida considerably reduced the severity of damage caused by SED, thereby significantly increasing cassava yields (CIAT 1985)."}]},{"head":"Brown leaf spot (Cercospora henningsii)","index":5,"paragraphs":[{"index":1,"size":51,"text":"Importance. Brown leaf spot has a broad geographical distribution, being found in Asia, North America, Africa, and Latin America. It attacks naturally M. esculenta, M. glaziovii, and M. piauhynsis Ule (Ferdinando et al. 1968;Golato and Meossi 1966;Powell 1972). In India, Cercospora henningsii is an important pathogen, causing severe defoliation (Edison 2002)."},{"index":2,"size":90,"text":"Symptoms and epidemiology. Symptoms in cassava leaves are characterized by leaf spots visible on both sides. On the leaves' upper surface, uniform brown spots appear, with defined and dark margins. On the leaves' undersurface, the lesions have less-defined margins and, towards the center, the brown spots have a gray-olive background because of the presence of the fungus's conidiophores and conidia. As these circular lesions grow, from 3 to 12 mm in diameter, they take up an irregular angular form, their expansion being limited by the leaves' major veins (Figure 8-2)."},{"index":3,"size":66,"text":"The veins found within the necrotic area are black. Sometimes, depending on how susceptible the variety is, an undefined yellow halo or discolored area can be observed around the lesions. As the disease progresses, infected leaves become yellow and dry before falling off, possibly because of toxic substances secreted by the pathogen. Susceptible varieties may undergo severe, or even total, defoliation during the hot rainy season."},{"index":4,"size":43,"text":"When wind or rain carry conidia that have dropped from wounds of infected tissues towards leaves of a new planting, primary infections occur. If environmental humidity is sufficiently high, the conidia will germinate, producing branched germinal tubes that frequently anastomose (Chevaugeon 1956;Viégas 1941)."},{"index":5,"size":144,"text":"When lesions mature, stromata appear from which conidiophores emerge. Secondary cycles of the disease are repeated throughout the rainy season, when wind or rain carries conidia to new susceptible tissues of the plant. The fungus survives the dry season in old lesions, frequently those of fallen leaves. It renews activity with the advent of the rainy season and growth of new leaves in the host. Chevaugeon (1956) observed that, in a cassava plant, the lower leaves are more susceptible than the youngest leaves. However, certain susceptible species (e.g., M. carthaginensis Muell.) and M. esculenta cultivars can be severely attacked. Severe symptoms have been observed in young leaves, petioles, and even fruits of M. carthaginensis. Although plants \"hardened\" by unfavorable conditions appear more resistant, no significant differences in susceptibility were found between plants growing in fertile soils and those growing in poor soils (Chevaugeon 1956)."},{"index":6,"size":72,"text":"Etiology. Cercospora henningsii, causal agent of the disease, grows in the intercellular spaces of leaf tissues, producing stromata from which conidiophores are produced in dense fascicles. The conidiophores are pale olive brown, semi-transparent, with uniform width and color, and non-branching. Sometimes, black perithecia appear, disseminated in the necrotic tissue of leaf spots and on the leaves' upper surface (Powell 1972). The perfect state of C. henningsii is Mycosphaerella manihotis (Ghesquière 1932;Chevaugeon 1956)."}]},{"head":"Management and control.","index":6,"paragraphs":[{"index":1,"size":87,"text":"To reduce the severity of infection, recommended cultural practices include reducing excess humidity during planting (Golato and Meossi 1966). Fungicides based on copper oxide and copper oxychloride, suspended in mineral oil, and applied at 12 L/ha also provide good chemical control (Golato and Meossi 1966). The best control over the disease can be achieved by using resistant varieties. Significant differences in varietal resistance have been found in Africa (Chevaugeon 1956;Umanah 1970), Brazil (Viégas 1941), and the extensive collection of cassava varieties held at CIAT, Colombia (CIAT 1972)."}]},{"head":"Diffuse leaf spot (Cercospora vicosae)","index":7,"paragraphs":[{"index":1,"size":41,"text":"Importance. This disease is found where brown leaf spot predominates, that is, in the hot cassavagrowing areas of Brazil and Colombia (CIAT 1972;Viégas 1941). The pathogen causes severe defoliation in susceptible cultivars but, in Colombia, does not cause heavy crop losses."}]},{"head":"Symptoms and epidemiology.","index":8,"paragraphs":[{"index":1,"size":87,"text":"This disease is characterized by the presence of large leaf spots, with undefined margins. Each spot may cover one fifth, or more, of the leaf lobe. On the leaves' upper surfaces, the spots are uniformly brown, whereas, on the lower surfaces, spots also have grayish centers caused by the presence of the fungus's conidia and conidiophores. The spots' general appearance is similar to that of the spots induced by Phoma sp., although lesions induced by the latter have concentric rings on the leaves' upper surfaces (Figure 8-3)."},{"index":2,"size":31,"text":"Defoliation may occur in susceptible cultivars, being more severe at the end of the rainy season and/or vegetative cycle. As the disease progresses, leaves become yellow and dry before falling off."},{"index":3,"size":84,"text":"Symptoms of this disease can be confused with those of cassava bacterial blight (CBB; see below), except that the blight lesions are noticeably aqueous. Etiology. The fungus does not form stromata but sporulates abundantly. The conidiophores are reddish dark brown (Chupp 1953). The fungus has been recorded as a pathogen occurring only on Manihot spp. Mill. As its incidence on a single plant or in a given planting is very low and apparently confined to the plant's lower leaves, its importance is relatively less."}]},{"head":"Management and control. •","index":9,"paragraphs":[{"index":1,"size":15,"text":"Planting with healthy and resistant cultivars • Using cultural practices that reduce humidity during planting"}]},{"head":"White leaf spot (Phaeoramularia manihotis)","index":10,"paragraphs":[{"index":1,"size":49,"text":"Importance. This fungus is commonly found in the cold humid cassava-growing regions of Asia, America, North America, tropical Africa, and Latin America (Castaño 1969;Chevaugeon 1956;CIAT 1972). In these areas, the pathogen may cause considerable defoliation in susceptible varieties of M. esculenta, the only known host species (Chevaugeon 1956;Viégas 1941)."}]},{"head":"Symptoms and epidemiology.","index":11,"paragraphs":[{"index":1,"size":101,"text":"Leaf spots caused by P. manihotis are smaller, with a different color, to those induced by C. henningsii. They vary from circular to angular, with diameters of usually 1 to 7 mm. They are normally white, but sometimes yellowish brown. Lesions are sunken on both sides, to half of the thickness of a healthy leaf blade. On the lower leaf surface, the white spots can be distinguished but they frequently have diffusely colored margins, which sometimes appear as brown-violet irregular lines, surrounded by brown or yellowish halos. The spots' centers have a velvety grayish aspect during the pathogen's fruiting (Figure 8-4)."},{"index":2,"size":80,"text":"The fungus penetrates the host through stomatal cavities and then invades the host's tissues through the intercellular spaces. When leaf spots reach 5 to 7 mm in diameter, a stroma is formed, which produces conidiophores. The disease's secondary cycles are repeated throughout the rainy season as conidia are dispersed by wind or rain splash. The fungus survives the dry season in old infected tissues and renews activity at the beginning of the rainy season and with the host's new growth."},{"index":3,"size":32,"text":"Etiology. Phaeoramularia manihotis, the causal agent, forms thin stromata in lesions on leaves. The stromata produce conidiophores in loose fascicles that emerge through the stromata and are usually olive brown (Powell 1972)."},{"index":4,"size":91,"text":"White leaf spot is very similar to brown leaf spot. However, brown spot usually occurs in warm but not humid areas, whereas white spot appears in cold humid areas. These differences in their geographical distribution are also observed in Africa and Latin America, and are probably the result of different responses of the respective causal agents to temperatures and humidity. The optimal temperature for germinating C. henningsii conidia is 39 ºC, with a maximum temperature of 43 ºC. For P. manihotis, these temperatures are, respectively, 33 and 43 ºC (Chevaugeon 1956)."},{"index":5,"size":35,"text":"Management and control. The control measures recommended for this disease are similar to those for brown leaf spot. Specifically resistant varieties are unknown, but field studies suggest they exist ( JC Lozano 1979, unpublished data). "}]},{"head":"Concentric ring leaf spot (Phoma spp.)","index":12,"paragraphs":[{"index":1,"size":76,"text":"Importance. This fungal disease, caused by Phoma spp., usually appears in the cold cassavagrowing areas of Colombia (CIAT 1972), Brazil (Viégas 1943a), Philippines, tropical Africa, and India (Ferdinando et al. 1968). According to Edison (2002), this disease is an emerging problem in certain areas where cassava cultivation is intensive. During the rainy season and when the temperature is below 22 ºC, the disease may cause severe defoliation in susceptible varieties and almost always produces stem dieback."}]},{"head":"Symptoms and epidemiology.","index":13,"paragraphs":[{"index":1,"size":101,"text":"The disease is characterized by the presence of large dark brown leaf spots, with usually undefined margins. These lesions are commonly found at leaf points, margins of leaf lobes, or along the central vein or other secondary veins. Initially, lesions appear as concentric rings of brown pycnidia on the leaf's upper surface (Figure 8-5). These rings are not found on old injuries because the rain drags away mature pycnidia. In these cases, the spots are uniformly brown, and are very similar to those caused by Cercospora vicosae. On the lower leaf surfaces, very few pycnidia occur. Hence, lesions are uniformly brown."},{"index":2,"size":94,"text":"Under conditions of high relative humidity, lesions may be covered by braid-like chains of grayish-brown hyphae. On the lower leaf surfaces, the nervures within the lesions become necrotic, forming black bands that emerge from the spots. These spots grow, causing leaf blight. The fungus invades the infected leaf and then the petiole, which becomes dark brown as it necroses. Leaves wilt and then fall, resulting in severe defoliation in susceptible cultivars. These cultivars may present dieback during epiphytotes and even total plant death. Necrotic stems become dark brown and frequently appear covered with pycnidia."},{"index":3,"size":33,"text":"Field studies suggest that the more mature lower leaves may be more resistant than the young upper leaves. However, total defoliation, accompanied by partial or total dieback, has been observed in susceptible cultivars."},{"index":4,"size":104,"text":"Favorable conditions for the germination of fungal spores occur at temperatures between 20 and 25 ºC. With artificial inoculation, infection is only achieved when inoculated plants are kept for 48 h at less than 24 ºC and with 100% relative humidity ( JC Lozano 1979, unpublished data). Under field conditions, disease always occurs during the rainy season and in areas where the temperature is less than 22 ºC. The fungus's survival mechanism during dry hot periods is unknown. Viégas (1943b) suggested that the fungus may produce its sexual state on infected stems and leaf residues. However, this has not yet been observed or recorded."},{"index":5,"size":77,"text":"Etiology. The causal agent produces numerous, spherical, dark brown pycnidia, either individually or in small clusters, on surfaces of leaves or stems. Pycnidia measure 100-170 μm in diameter, their walls are formed by polyhedral cells; and their ostiole measures 15-20 μm. Conidiophores are short and hyaline, producing small conidia (15-20 μm) that are unicellular and ovoid or elongated (Ferdinando et al. 1968;Viégas 1943a). On Lima-bean agar, the fungus forms pycnidia in profuse quantities, appearing in concentric rings."},{"index":6,"size":78,"text":"Management and control. To date, no measures of control exist for the disease, even though it causes heavy losses in areas where environmental conditions are propitious for its development. Although no reports exist on varietal resistance, in the field in Colombia, resistance has been observed in naturally infected plantings. Chemical treatments such as carbendazim (3 g/L a.i.) and benomyl (0.6 g/L a.i.) during the rainy season may be equally effective in those areas where the disease is endemic."}]},{"head":"Cassava ash (Oidium manihotis)","index":14,"paragraphs":[{"index":1,"size":76,"text":"Importance. This disease was first recorded in Africa in 1913 (Saccardo 1913) and has since appeared in Latin America (CIAT 1972;Viégas 1943a) and Asia (Park 1934). The disease is characterized by the presence of yellowish undefined spots on M. esculenta leaves. Although it is widely disseminated and frequently occurs during the dry season, the disease is considered to be of minor importance as it usually attacks only the lower leaves, in which it induces some necrosis."},{"index":2,"size":88,"text":"Symptoms and epidemiology. The first symptoms of disease are characterized by the appearance of a white mycelium that grows on the leaf surface (Figure 8-6). The fungus penetrates the host cells, using haustoria. The infected cells become chlorotic and form undefined yellowish lesions. Within these yellowish areas, pale brown necrotic areas frequently appear. These are angular in shape and of different sizes. In some cassava varieties, the disease stops in the state of yellowish undefined lesions, which then may become confused with those induced by insects and mites."},{"index":3,"size":23,"text":"Fully developed mature leaves seem to be most susceptible to pathogenic attack, although the young leaves of some varieties may also present symptoms."},{"index":4,"size":12,"text":"The disease commonly appears during the dry season and in warm areas."},{"index":5,"size":76,"text":"Etiology. The sexual state of the causal agent, Oidium manihotis, is Erysiphe manihotis (Ferdinando et al. 1968). The fungus's mycelium is white, producing numerous haustoria on the host's epidermis. Conidiophores rest in an erect position. They are simple, with the upper parts both longer and wider, as they form the conidia. Conidia are oval or cylindrical, unicellular, hyaline, and measure 12-20 × 20-40 μm. They are produced in basipetal chains (Ferdinando et al. 1968;Saccardo 1913;Viégas 1943b)."}]},{"head":"Management and control.","index":15,"paragraphs":[{"index":1,"size":31,"text":"Although specific control of the disease is considered unnecessary, observations suggest that resistant varieties exist (CIAT 1972). Ferdinando et al. (1968) suggest that spraying with sulfur-based compounds can control the disease."}]},{"head":"Cassava anthracnose (Glomerella manihotis)","index":16,"paragraphs":[{"index":1,"size":54,"text":"Although cassava anthracnose has been known for a long time, it has been considered of minor importance. It is characterized by the presence of sunken leaf spots, 10 mm in diameter, that are similar to those caused by C. henningsii. The latter, however, appear towards the base of leaves, thus causing their total death."},{"index":2,"size":115,"text":"The pathogen also causes young stems to wilt and induces cankers on mature stems (Irvine 1969) (Figure 8-7). New leaves, produced at the beginning of the rainy season, are the most susceptible. The disease tends to disappear when the dry season begins (Irvine 1969). This finding agrees with results obtained from artificial inoculations with an aqueous suspension of spores from the pathogen. Inoculation is successful if incubation is at 100% relative humidity for 60 h. The fungus will stop invading plant tissue when relative humidity drops to 70% (CIAT 1972). The insect Pseudotheraptus devastans Distant is associated with the disease (Fokunang et al. 2000), contributing to the pathogen's dissemination and increasing the severity of symptoms."},{"index":3,"size":40,"text":"The organism causing this disease has been variously called Glomerella manihotis, Colletotrichum manihotis (Vanderweyen 1962), Gloeosporium manihotis (Bouriquet 1946), and Glomerella cingulata (Irvine 1969). All these names possibly refer to one species, but this hypothesis is yet to be confirmed."},{"index":4,"size":91,"text":"Stem anthracnose caused by a Colletotrichum sp. was recorded in Nigeria (IITA 1972). Green portions of the stems presented shallow oval depressions that were pale brown, but with a point of normal green tissue in the center. In the ligneous portions of the stems, lesions were round, swollen, and in bands, forming deep cankers on the epidermis and cortex, and sometimes deforming the stem. Its importance is unknown but its prevalence, occurrence, and dissemination are considerable. In Asia stem anthracnose was recorded in Thailand (E Álvarez 2009, pers. comm.) (Figure 8-8).  "}]},{"head":"A B C","index":17,"paragraphs":[{"index":1,"size":4,"text":"Cassava rust (Uromyces spp.)"},{"index":2,"size":83,"text":"Importance. Although recorded in Brazil and Colombia, this disease is considered to be of minor importance. It appears at the end of dry periods, sometimes causing a type of shoot proliferation in stem apices (Normanha 1970). Etiology. In cassava, several species of rust pathogens have been recorded in different parts of the world. However, its incidence and severity are low. Some species of rust appear to occur only where temperatures are moderate and rainfall is high. Other species predominate during hot dry seasons."}]},{"head":"Stem rots","index":18,"paragraphs":[{"index":1,"size":45,"text":"In many cassava-growing areas, continuous cassava planting is not possible and stakes must be stored for later propagation. Stored stakes are attacked by three diseases that induce necrosis (CIAT 1972). These diseases considerably reduce stake viability, directly and indirectly, by increasing dehydration and causing necrosis."},{"index":2,"size":43,"text":"Although the three different causal agents have been recognized, the diseases these induce are not clearly differentiated in most cases. Macroscopically, the diseases look similar, particularly during their first developmental stages. Furthermore, more than one causal agent may be present, creating a syndrome."},{"index":3,"size":33,"text":"The three diseases causing stem rots are stem necrosis caused by Glomerella cingulata, dry stem and root rot caused by Diplodia sp., and necrosis caused by an unidentified Basidiomycete (Lozano and Booth 1979)."}]},{"head":"Stem necrosis (Glomerella cingulata)","index":19,"paragraphs":[{"index":1,"size":30,"text":"Importance. This disease is the most common of the three that induce rots or necrosis in stored cassava stakes. It also attacks residues of old stems left in cassava plantings."}]},{"head":"Symptoms.","index":20,"paragraphs":[{"index":1,"size":49,"text":"Necrosis of stored stakes appears first at the ends and then progresses slowly towards the middle, before disseminating to all stakes (Figure 8-10). The disease occurs as a black discoloration of vascular bundles. It then develops surface blisters that later break, exposing groups of black perithecia in welldeveloped stromata."}]},{"head":"Etiology.","index":21,"paragraphs":[{"index":1,"size":34,"text":"The causal organism appears to be Glomerella cingulata (Commonwealth Mycological Institute 1979, pers. comm.). Ascospores are hyaline, unicellular, and slightly curved. Infection probably occurs through wounds and is favored by high environmental relative humidity."},{"index":2,"size":43,"text":"The relationship between this fungus and Colletotrichum sp., which causes anthracnose in cassava, has not still been determined. For example, the appearance of two types of symptoms may be due to two different states of the same agent rather than of two agents."}]},{"head":"Dry rot of stem and root (Diplodia sp.)","index":22,"paragraphs":[{"index":1,"size":27,"text":"Importance. This disease attacks stored cassava planting materials and residue stems left in the field. Its occurrence is not as common as necrosis caused by Glomerella spp."}]},{"head":"Symptoms and epidemiology.","index":23,"paragraphs":[{"index":1,"size":41,"text":"The disease has two phases. The first is when root rot starts when soils are infested or when stakes from diseased plants are used. Symptoms, similar to those induced by root pathogens, consist in sudden plant death caused by root deterioration."},{"index":2,"size":89,"text":"The second phase includes stem rot caused by systemic invasion of the fungus from the roots or by penetration through wounds. The disease is characterized by black discoloration and necrosis of the vascular bundles, which extend from the infection sites, that is, wounds in the stem. In the epidermis, they appear as blisters under which the stem's internal tissues are discolored black or dark brown. The blisters break, showing confluent masses of black pycnidia . Gum may be excreted, and partial or total wilting occurs. Dieback may also occur."},{"index":3,"size":37,"text":"The pathogen disseminates across great distances through stakes from infected plantings. Within the same crop, dissemination is by wind and rain during fungal fructifications, use of infested tools and irrigation water, and land preparation for later plantings."},{"index":4,"size":41,"text":"Etiology. The causal agent of dry rot of stem and root is Diplodia manihotis. In both the host and laboratory cultures, this organism produces pycnidia F ig u r e 8 -11. Stem rot in a stake infected by Diplodia sp."},{"index":5,"size":45,"text":"that erupt through the stem or root surface, becoming confluent, stromal, and ostiolate. The conidiophores are short and simple, producing dark two-cell conidia that are slightly elongated on reaching maturity. Infection is believed to occur through wounds, and is favored by high environmental relative humidity."},{"index":6,"size":87,"text":"Management and control. To control the disease, the cassava crop should be rotated with nonsusceptible crops such as maize or sorghum, particularly when incidence is more than 3%. Planting stakes from healthy crops should be used and tools disinfected. Planting materials should be selected and handled carefully both before and after storage. Only viable cuttings or buds should be planted. One recommendation is to immerse cuttings in a solution of captan (3 g/L) and benomyl (3 g/L) for 5 min. Captan may be replaced by copper oxychloride."}]},{"head":"Root rots","index":24,"paragraphs":[{"index":1,"size":62,"text":"Root rots in cassava are important where soils are poorly drained or where excessively rainy seasons occur. In early growth, many microorganisms are capable of inducing not only root rots in young cassava plants, but also in the storage roots of mature plants. Although several root diseases have been reported, little information exists about them. Not even the symptoms are well described."},{"index":2,"size":91,"text":"Usually, infection kills young plants at germination or shortly afterwards. Infection in plants older than 4 months may result in partial or total wilt, depending on whether the root rot is soft or dry. Once invaded by one or more primary pathogens, infected roots may be invaded by a wide spectrum of other microorganisms. These are usually the otherwise weak saprophytic parasites, which become capable of degrading root tissues and masking the identity of the primary causal agent. The resulting root rots therefore appear to have the same syndrome of symptoms."},{"index":3,"size":80,"text":"Pathogens causing root rots include Phytophthora spp., Fusarium sp., Scytalidium lignicola, Rosellinia spp., Sclerotium sp., and Fomes lignosus (Ferdinando et al. 1968;Jennings 1970;Pereira 1998;Viégas 1955). Some of these diseases often develop when cassava is planted immediately after woody crops such as coffee. Soils of such crops are infested with pathogens that attack ligneous plants such as cassava. These pathogens may be fungi or bacteria that cause root deterioration, either as the crop grows or after harvest when roots are stored."},{"index":4,"size":102,"text":"Control measures for these diseases are similar, the best comprising cultural practices such as good drainage, selection of loose-textured soils, crop rotation, early harvest, and avoiding soils prone to flooding. Treatments with fungicides may help establish the crop, preventing root rots from attacking during the crop's first months. Ridomil® (2.5 kg/ha), applied to the soil, and foliar applications of Alliette® (0.4 kg/ha) have shown good results. Fungicides based on plant extracts, oils, and cytokinins help control soil fungi, while offering a nonpolluting organic alternative. Resistant varieties have also been reported (Castaño 1953;CIAT 1998;Drummond and Gonçalves 1957;Fassi 1957;Müller and De Carneiro 1970;Sánchez 1998)."}]},{"head":"Root rot or \"black rot\" (Rosellinia spp.)","index":25,"paragraphs":[{"index":1,"size":61,"text":"Importance. This disease has been reported in many cassava-growing regions with heavy, poorly drained soils that have a high content of organic matter. It is also found in cassava crops planted after forest crops or ligneous perennial species (Castaño 1953;Viégas 1955). The disease has also been called \"black rot\" because of the characteristic black color of infected tissues and root cankers."},{"index":2,"size":30,"text":"In Colombia, dry rots are found in the Coffee Belt and in crops planted where coffee, cacao, or guamo (a shade tree used in coffee plantations) had previously been grown."}]},{"head":"Symptoms and epidemiology.","index":26,"paragraphs":[{"index":1,"size":59,"text":"Initially, the root epidermis is covered with white rhizomorphs that later become black (Figure 8-12). Internally, infected tissues of bulked roots are slightly discolored and exude liquid on pressure. The black mycelial bundles penetrate the tissues, where they grow, forming small cavities that contain mycelium of an off-white color. The infected roots have a characteristic odor of decaying wood."},{"index":2,"size":66,"text":"Etiology. Rosellinia necatrix, the perithecial state of Dematophora necatrix, is the causal agent of this disease (Castaño 1953;Viégas 1955). This fungus induces root rot in other ligneous and herbaceous plants (Castaño 1953;Viégas 1955). However, very little information is available on the epidemiology of the fungus in cassava. Its sexual state is generally believed to occur only very rarely (Castaño 1953). Other Rosellinia species also attack cassava."}]},{"head":"Management and control.","index":27,"paragraphs":[{"index":1,"size":22,"text":"Although the disease has not been reported in young plants, the recommendation is still to avoid selecting planting materials from infected crops."}]},{"head":"•","index":28,"paragraphs":[{"index":1,"size":14,"text":"Rotate with grasses whenever the incidence of plant death or root rot reaches 3%."},{"index":2,"size":15,"text":"• Eliminate infected cassava residues and/or litter from perennial trees (e.g., trunks and decaying branches)."},{"index":3,"size":5,"text":"• Plant in loose-textured soils."},{"index":4,"size":4,"text":"• Improve soil drainage."}]},{"head":"•","index":29,"paragraphs":[{"index":1,"size":12,"text":"Treat by solarization, exposing the soil to the sun for 3 months."},{"index":2,"size":19,"text":"• Chemical control with Topsin (thiophanatemethyl) at 2 g/L of commercial product and applied to the soil before planting."},{"index":3,"size":27,"text":"• Applications of Sincocin (plant extract) to the soil at 1 L/ha are recommended. Stakes may also be immersed in a solution of the product at 1%."}]},{"head":"Root rot (Sclerotium rolfsii)","index":30,"paragraphs":[{"index":1,"size":83,"text":"This disease commonly occurs in young stakes and mature roots, covering affected parts with a cottony mat. It has been reported only in Latin America (CIAT 1972;Ferdinando et al. 1968). The white mycelium, which is found in infected roots or towards the base of stems, is also disseminated through the soil. This mycelium can, sometimes, penetrate roots through wounds, causing subsequent rot. Although it is rarely lethal to young plants, this fungus may cause a high incidence of root necrosis in a plant."},{"index":2,"size":38,"text":"The disease is caused by Sclerotium rolfsii, a common soil organism but a weak pathogen. It has a white mycelium of cottony appearance. It also produces numerous round sclerotia, which characteristically form in the host or laboratory cultures."}]},{"head":"Cottony cassava rot (Fomes lignosus)","index":31,"paragraphs":[{"index":1,"size":88,"text":"Although this disease is known in Latin America, it is currently of minor importance. The disease is identified by the presence of a mass of white mycelium under the cortex of bulked roots and by the presence of white mycelial threads that look like cotton fibers covering part or all the epidermis of infected roots to the base of stems. Internally, the infected tissues look dehydrated and have a characteristic odor of decaying wood. Young plants may become infected and sometimes suffer sudden wilting, defoliation, and root necrosis."},{"index":2,"size":11,"text":"The organism causing the disease is Fomes lignosus (IITA 1972;Jennings 1970)."}]},{"head":"Diseases Caused by Pseudo-fungi","index":32,"paragraphs":[{"index":1,"size":4,"text":"Root rots (Phytophthora spp.)"},{"index":2,"size":87,"text":"Importance. Root rots are a very common problem in cassava production, causing yield losses that may be as high as 80% of total production. Distribution. Root rot caused by Phytophthora spp. affect cassava in different agroecological areas in Africa (Fassi 1957), tropical America (Müller and De Carneiro 1970), and India (Johnson and Palaniswami 1999). In Nigeria, Cameroon, and Benin, the pathogens causing root diseases of economic importance include Sclerotium rolfsii, Botryodiplodia theobromae, Fomes lignosus, Rosellinia necatrix, Rhizoctonia solani, Phytophthora spp., and Fusarium spp. (Hillocks and Wydra 2002)."},{"index":3,"size":63,"text":"Recent reports mention that cassava rots may cause losses between 5% and sometimes 100% in Latin America, Asia, and Africa, specifically, Colombia, Brazil (W Fukuda and C Fukuda 1996, EMBRAPA, Brazil;F Takatsu 1996, University of Brasília, Brazil, pers. comm.), Cuba (M Folgueras 2002, INIVIT, pers.   1970). Phytophthora nicotianae also causes a similar leaf blight in cassava (Erwin and Ribeiro 1996;Lima et al. 1993)."},{"index":4,"size":51,"text":"Etiology. Farmers widely believe that root rots are caused by excess water in the soil. However, a study conducted in different edaphoclimatic areas of Colombia showed that different Phytophthora spp. are the major cause of cassava root rots (Sánchez 1998). Other pathogens also causing root rots include:  CIAT 2000CIAT , 2004))."},{"index":5,"size":166,"text":"The genetic diversity of these pathogens is broad and was determined through studies in Colombia with 80 isolates obtained from roots, young stems, and soils from 19 municipalities. These studies included the pathogen's pathogenicity, virulence, morphology, and molecular analysis of the internal transcribed spacer (ITS) region of the pathogen's ribosomal DNA. Eleven genetic groups were identified through PCR-RFLP (Álvarez et al. 1997a, 1997c, 2000;Sánchez 1998). Phytophthora tropicalis was identified through sequencing of the ITS region of ribosomal DNA and isoenzymes, showing it to be genetically similar to P. capsici (CIAT 2000). The isolate was obtained from cassava roots in Barcelona, Quindío; P. palmivora was isolated from cassava roots at CIAT, Valle del Cauca.  Mae Joana (IM-175) and Zolhudinha (IM-158). Both clones came from the State of Amazonas and are planted in the várzea ecosystem (a type of floodplains) of northern Brazil. The adoption of these clones, together with the application of appropriate cultural practices, increased root yields by more than 80% in this region (Lozano 1991b)."}]},{"head":"Integrated","index":33,"paragraphs":[{"index":1,"size":112,"text":"High yields and resistance to root rot caused by P. drechsleri were obtained in clones MD-33 and Pao (Mendonça et al. 2003). Pereira (1998) reported resistance to P. drechsleri in seven cultivars from a group of 31 evaluated. Barragán and Álvarez (1998) reported 15 resistant genotypes from a group of 60 elite genotypes evaluated. In 2003, Llano et al. reported six individuals from a family of 126 individuals, with high resistance to P. tropicalis, P. palmivora, and P. melonis. Although harvesting roots 14 months after planting resulted in increased yield, it also demonstrated a higher incidence of root rots, thus showing that root rot incidence varies according to clones and harvest time."},{"index":2,"size":45,"text":"In a participatory research study, indigenous communities of the Colombian Amazon adopted cassava clones resistant to Phytophthora spp. (Llano and Álvarez 2008;Llano et al. 2001). These clones were selected in the laboratory (harvested roots) and greenhouse (stems) from 700 genotypes provided by Embrapa and CIAT."},{"index":3,"size":109,"text":"To obtain reliable information on the genetics of such a complex disease, Takatsu and Fukuda (1990) concluded that standardized methods were needed for inoculating and evaluating resistance to each cassava root rot pathogen. CIAT and the National University of Colombia-Palmira identified cassava clones resistant to P. nicotianae var. nicotianae by first inoculating bulked roots of plants that were 10 to 12 months old. They then added a suspension of the fungus to a nutritive solution in which 45-day-old seedlings were growing. The roots of seedlings were colonized by the pathogen. The inoculated roots were evaluated in terms of the percentage of the pathogen's colonization of cortical and parenchymatous tissues."},{"index":4,"size":51,"text":"Inoculated bulked roots demonstrated variation in the severity of symptoms, depending on whether they came from resistant or susceptible clones. The inoculation method was easier to carry out, less expensive, and with faster results than the seedling method. No correlation was found between the two inoculation methods (López and Lozano 1992)."},{"index":5,"size":38,"text":"Cassava seedlings planted in soil were also evaluated. The soil had previously been inoculated with a suspension of each of zoospores, oospores, or chlamydospores applied separately (Lima et al. 1993). Each inoculum type caused wilt and seedling death."},{"index":6,"size":68,"text":"In 1995, Lima and Takatsu (1995) published the reactions of 13 cassava clones that had been steminoculated with three isolates of P. drechsleri in the greenhouse. The isolate with the most virulence was inoculated into roots in the field. To inoculate roots without harvesting them, inoculum was deposited in a small wound. The correlation between inoculated plants in the screenhouse and roots inoculated in the field was +0.24."},{"index":7,"size":52,"text":"In other studies (Loke 2004), several biochemical and morphological markers, and leaf resistance were identified for preselecting clones for resistance to P. tropicalis in cassava populations, based on (1) reduced area of the parenchyma with the presence of scopoletin in roots after harvest; (2) a high relationship between iron and manganese; and"},{"index":8,"size":92,"text":"(3) resistance in leaves 72 h after inoculation. Scopoletin is a coumarin that is found in very low concentrations in fresh roots but which increases considerably after harvest. This substance is easy to quantify in roots, using ultraviolet light, and is related to the cassava root's susceptibility to postharvest physiological deterioration. Loke (2004) also demonstrated the benefits of using an index of resistance to P. tropicalis that includes molecular markers. The objective of this index is to select genotypes with durable resistance, based on a large diversity of resistance or defense mechanisms."},{"index":9,"size":111,"text":"Several studies to identify the genetic base of resistance to Phytophthora have been conducted. For 25 cassava clones, a correlation of +0.31 was observed between resistance during penetration (in the peel, both epidermis and subepidermis) and after penetration (in the parenchyma). This finding indicated that these forms of resistance are moderately associated (Corredor 2005;Loke 2004). Alvarez et al. (2003c), Llano et al. (2004), andLoke (2004) evaluated the cassava K family (150 F 1 individuals from the cross TMS 30572 × CM 2177-2), inoculating root fragments. Nineteen QTLs were identified as associated with resistance to different species of Phytophthora and Pythium, three of which explained between 8.3% and 11% of phenotypic variance."},{"index":10,"size":95,"text":"Those QTLs that were expressed were also found to vary from one cropping cycle to another, depending on prevailing environmental conditions. Minor genes were demonstrated as controlling resistance to P. tropicalis, P. melonis, and P. palmivora, with a high genotype × environment interaction existing. Although the population showed differences within its genetic base for resistance to Phytophthora, levels of resistance were not sufficiently high for use in improvement programs. Hence, identifying contrasting parents for the disease would be useful, as well as developing new populations for determining QTLs (Llano et al. 2004;Loke et al. 2004)."},{"index":11,"size":108,"text":"To identify genomic sequences in cassava that are homologous with genes of resistance to diseases of different plant species, two cassava families were evaluated for their resistance to P. tropicalis (GenBank accession AY 739022), P. melonis (GenBank accession AY 739021), and P. palmivora, all causal agents of root rot. Two strategies were used to search for genes for resistance: (1) hybridization with probes for maize and rice, using RFLP; and (2) amplifying conserved regions of DNA, using the degenerate primers NBS and Pto kinase. Three cassava clones resistant to P. tropicalis and P. palmivora were used, obtaining clones that were sequenced and homologized with known genes of resistance."},{"index":12,"size":97,"text":"With hybridization, cassava demonstrated very low homology with the monocotyledon genes tested. Twenty-eight NBS and 2 Pto kinase clones were obtained, of which 14 showed homologous sequence with resistance gene analogs (RGAs) and NBS-LRR (GenBank accessions: AY730038, AY730040, AY730041, AY737490, AY745762, AY745763, AY745764, AY745765, AY745766, AY745767, AY745768, AY745769, AY745770, and AY745771). Four of these showed an open reading framework (ORF) with conserved motifs in the nucleotide-binding site (NBS) region, which means they were considered to be RGAs. Altogether, three classes of RGAs were identified, none of which showed association with resistance to Phytophthora (Llano et al. 2004)."},{"index":13,"size":16,"text":"Cultural practices. The best cultural practices for the integrated management of root rots are summarized below:"}]},{"head":"•","index":34,"paragraphs":[{"index":1,"size":23,"text":"Selecting an appropriate, well-drained, and moderately deep soil. If the land is flat and soils are clayey, planting should be done on ridges."}]},{"head":"•","index":35,"paragraphs":[{"index":1,"size":20,"text":"To catalyze resistance, fertilizers should be applied in drench form, using potassium sources, and/or as foliar sprays, using potassium phosphites."},{"index":2,"size":19,"text":"• If rot incidence reaches 3%, the cassava crop should be rotated with grasses, at least once a year."}]},{"head":"•","index":36,"paragraphs":[{"index":1,"size":13,"text":"Eradicating diseased plants by removing infected roots from the field and burning them."}]},{"head":"•","index":37,"paragraphs":[{"index":1,"size":7,"text":"Selecting healthy plants to obtain clean seed."},{"index":2,"size":17,"text":"Where the farming area is infested, then stakes should be treated with metalaxyl at 0.3 g/L a.i."}]},{"head":"•","index":38,"paragraphs":[{"index":1,"size":21,"text":"Treating stakes in hot water at 49 ºC for 49 min is an alternative to chemical treatment (Álvarez et al. 2003b)."},{"index":2,"size":118,"text":"Immersing stakes in a suspension of Trichoderma harzianum and T. vi r ide at 2.5 × 10 8 spores/L, and later applying the same suspension in drench form (CIAT 2006(CIAT , 2007)). Biological control of rots with isolates of T. h a r zi a n u m and T. vi r ide is promising (Bedoya et al. 2000;CIAT 2006CIAT , 2007;;Edison 2002). Field trials in different agroecological zones of Colombia have shown that soil inoculated with strains of these types of Trichoderma will increase cassava yield (CIAT 2001(CIAT , 2006(CIAT , 2007)). Isolates of Trichoderma spp. were selected on the basis of in vitro antagonism, production of secondary metabolites that inhibit Phytophthora spp., and bioassays in screenhouses."},{"index":3,"size":72,"text":"To identify practices of disease management that are feasible for indigenous communities in the northwestern region of the Amazon (Colombia), participatory research trials were established, with the women farmers making the evaluations. Soil amendments were incorporated. These were ash, organic matter (dry leaves), and a 1:1 mixture of both materials. Dosage was 200 g/plant. Cassava was also associated with cowpea (Vigna unguiculata), and stakes selected from the middle part of healthy plants."},{"index":4,"size":66,"text":"In these trials, cassava yield increased by 446% with applications of the ash and organic matter mixture. Where only ash was used, yield increased by 272%. Stake selection increased yield by 366%. Compared with traditional management, these practices reduced root rots by 100% (incorporation of the ash and organic matter mixture), 99% (association with cowpea), 94.2% (ash only), and 89.7% (stake selection) (Llano and Álvarez 2008)."}]},{"head":"Other Causal Agents of Cassava Rots Other fungal root rots","index":39,"paragraphs":[{"index":1,"size":100,"text":"Other fungal species can induce root rots in cassava plants at different growth stages, but little information is available on these diseases and their importance. These root rots are caused by: Armillariella mellea, which attacks both the stem base and roots of mature plants (Arraudeau 1967;CIAT 1972) Phaeolus manihotis (Heim 1931) Lasiodiplodia theobromae (Vanderweyen 1962) Pythium sp. (CIAT 1972) Fusarium sp. (CIAT 1972) Clitocybe tabescens (Arraudeau 1967) Sphaceloma manihoticola (Bitancourt and Jenkins 1950) Rhizopus spp. (Majunder et al. 1956) Rhizoctonia sp. (Gonçalves and Franco 1941) Aspergillus spp. (Clerck and Caurie 1968) Nattrassia mangiferae (Scytalidium sp.); Verticillium sp.; and Rigidoporus sp."}]},{"head":"Bacterial root rots","index":40,"paragraphs":[{"index":1,"size":70,"text":"Some bacterial species belonging to the Bacillus, Erwinia, and Corynebacterium genera are also believed to cause soft rots and/or fermentation in bulked cassava roots (Akinrele 1964;Averre 1967). Symptoms of these soft rots are similar and are frequently accompanied by fermentation. These agents probably penetrate roots through wounds produced by farmers during cultivation or by animals, insects, or fungi. They are frequently accompanied by other saprophytic microorganisms that help advance deterioration."},{"index":2,"size":29,"text":"The causal agent of cassava bacterial blight (see below) can also induce necrosis, discoloration, and dry rot in the vascular tissues of infected roots (Lozano 1973;Lozano and Sequeira 1974)."}]},{"head":"Cassava heart rot","index":41,"paragraphs":[{"index":1,"size":59,"text":"This physiological disorder damages bulked roots (Averre 1967). It occurs in moist and poorly drained soils in which roots present a dry internal necrosis that extends irregularly from the center to cortical tissues. This disorder is observed in only 10%-20% of the roots of an infected plant. The larger and thicker roots are believed to be the most susceptible."}]},{"head":"Postharvest physiological deterioration (PPD)","index":42,"paragraphs":[{"index":1,"size":43,"text":"The cause of cassava roots' rapid deterioration after harvest is unknown, whether it results from physiological or pathological effects, or a combination of the two. Numerous microorganisms have nevertheless been isolated from deteriorated roots, with several being known to cause discoloration and rot."}]},{"head":"Bacterial Diseases","index":43,"paragraphs":[{"index":1,"size":34,"text":"Cassava bacterial blight (Xanthomonas axonopodis pv. manihotis) Importance. Cassava bacterial blight (CBB) is regarded as one of the most limiting diseases of cassava production, as it can cause total crop loss in affected areas."},{"index":2,"size":46,"text":"During the 1960s and 1970s, this disease caused major damage to the cassava crop. However, the application of integrated management programs, introduction of quarantine measures in some countries, and identification and planting of resistant varieties have led to its satisfactory control (Hillocks and Wydra 2002;Lozano 1986)."},{"index":3,"size":83,"text":"Distribution. Cassava bacterial blight has been known in Latin America since 1912, when it was reported in Brazil (Kemp 2000). It spread to the cassava-growing regions of Africa and Asia in the 1970s (Boher and Verdier 1994;Bradbury 1986). In Latin America, the disease has been reported from most of the cassava-growing regions of Bolivia, Brazil, Colombia, Cuba, the Dominican Republic, Mexico, Panama, Trinidad and Tobago, and Venezuela (Cajar 1981;Fukuda 1992;Languidey 1981;Lozano and Sequeira 1974;Rajnauth and Pegus 1988;Rodríguez 1979;Rodríguez 1992;Sosa 1992;Trujillo et al. 1982)."},{"index":4,"size":156,"text":"In Asia, CBB has been observed during the rainy season in Thailand (Figure 8-16) as well as in many other countries but it is seldom very severe (E Álvarez 2009, pers. comm.). The disease was first observed in Taiwan before 1945 (Leu 1976), and has since been reported from Malaysia, Indonesia, Thailand (Booth and Lozano 1978;E Álvarez and AC Bellotti 2009, pers. comm.), Vietnam (E Álvarez and AC Bellotti 2009, pers. comm.) and India (Cherian and Mathew 1981). In Africa, the disease causes severe epidemics (Hillocks and Wydra 2002), and appears in the following countries (in order of reporting year): Nigeria (Williams et al. 1973), Zaire (Maraite and Meyer 1975), Ghana (Doku and Lamptey 1977), Benin (Korang-Amoakoh and Oduro  (Notteghem et al. 1980), Republic of South Africa (Manicom et al. 1981), Rwanda (Onyango and Mukunya 1982), Sudan (Kwaje 1984), Togo (Boher and Agboli 1992), Cameroon, Central African Republic, Tanzania, Kenya, and Burundi (Hillocks and Wydra 2002)."},{"index":5,"size":92,"text":"Symptoms and epidemiology. Symptoms characteristic of CBB are small, angular, aqueouslooking leaf spots found on the lower surface of the leaf blade. Or symptoms may be leaf blight or brown leaf burn, wilt, dieback, and a gummy exudation in infected young stems, petioles, and leaf spots . The vascular bundles of infected petioles and stems are also necrotic, appearing as bands of brown or black color. Symptoms occur 11 to 13 days after infection (Lozano and Booth 1979). Some susceptible varieties present dry and putrid spots around necrotic vascular bundles (Verdier 2002)."},{"index":6,"size":59,"text":"The bacterium disseminates widely through stakes from infected plants, from one cropping cycle to another, and from one area to another. Within the crop, the principal means of dispersal are water splash from rain and contaminated tools. The movement of people and animals within the crop, especially during or after rain, may also help disperse the pathogen (Lozano 1973)."},{"index":7,"size":43,"text":"Although the pathogen survives poorly in soil, this can be source of inoculum if it is contaminated, as well as irrigation water, although in reduced proportions. The bacterium can survive epiphytically on many weeds, which serve as sources of inoculum if control is "}]},{"head":"A B C","index":44,"paragraphs":[{"index":1,"size":8,"text":"inadequate. Insects spread the disease over short distances."},{"index":2,"size":41,"text":"The severity of CBB becomes greater when temperatures fluctuate widely between day and night. Hence, the disease is not important in areas of stable temperatures such as the Amazon Region, where the cloud cover does not permit marked fluctuations in temperatures."},{"index":3,"size":41,"text":"Etiology. The causal organism, Xanthomonas axonopodis pv. manihotis (Xam), is a Gram-negative bacterium that is shaped like a slim cane. It is mobile by means of a polar flagellum. Its cells are not encapsulated, and the bacterium does not form spores."},{"index":4,"size":30,"text":"The organism penetrates the host through stomas and wounds in the plant's epidermis. Infection is systemic, moving through the stems and petioles in xylem vessels and possibly also the phloem."},{"index":5,"size":126,"text":"Xam can be detected, using the polymerase chain reaction (PCR), which amplifies a DNA fragment of 898 bp. This methodology permits detection to as low as 300 cfu/mL in leaves and stems infected by CBB (Verdier et al. 1998). When Verdier and Mosquera (1999) used the specific probe P898, they detected the bacterium in raw extracts of infected leaves and stems, and in cassava fruits and sexual seed. According to Verdier et al. (1993), pathogen diversity is narrow in Africa but broad in South America, cassava's center of origin. Restrepo et al. (1996) reported that the diversity of the Colombian strains is very broad, at both pathogenic and genetic levels. Diversity is also high in Brazil (Restrepo et al. 1999) and Venezuela (Verdier et al. 1998)."},{"index":6,"size":97,"text":"Previous studies also revealed geographical differentiation among pathogen populations, according to ecozone. Evidence also exists of pathotypes moving within and between regions, probably because of movements of infected planting materials. In Colombia, analysis of pathogenic characteristics of Xam strains collected in three ecozones led to the definition of different pathotypes specific to each ecozone (Restrepo 1999). An analysis, using the AFLP technique, of the genetic variability of 85 Xam isolates from Brazil, Colombia, Cuba, and Venezuela distinguished three groups: (1) a cluster at a similarity level of 0.6 and formed of isolates from different localities in Colombia;"},{"index":7,"size":114,"text":"(2) a cluster at 0.7 and comprising 81% of the Venezuelan isolates included in this study, and 4 Brazilian isolates; and (3) a cluster at 0.4 and formed by most of the Brazilian isolates, 3 isolates from Venezuela, 1 from Cuba, and 3 from Colombia. In this last group, clustering below the 0.4 similarity level also occurred, indicating great genetic variability within the Brazilian sites, possibly related to the also high level of genetic diversity observed for the host plant (Sánchez et al. 1999). When new pathogen strains are introduced into a given area, the genetic diversity already found within the pathogen population is increased, thereby favoring the development of new pathotypes (Restrepo 1999)."},{"index":8,"size":21,"text":"Integrated disease management. To control the disease, integrated management should be carried out, involving varietal resistance, cultural practices, and biological control."},{"index":9,"size":86,"text":"Varietal resistance. The genetic control of CBB is the most efficient and economic method for the farmer, but the cassava cropping cycle is long, with a very low production of planting materials. Hence, the time involved in producing resistant varieties is very long. At CIAT, resistant varieties are identified through evaluations in the Eastern Plains and the Atlantic Coast, where the disease is acute and endemic. They are also evaluated in the greenhouse, under controlled conditions, with temperatures at 30 °C and relative humidity at 95%."},{"index":10,"size":78,"text":"In several greenhouse studies, plants of different cassava varieties were inoculated with 39 isolates from different regions of Colombia, Venezuela, and Brazil. Fifteen genotypes were identified as having high to intermediate resistance to CBB, scoring between 1.0 and 2.5 on a scale of severity from 1.0 to 5.0. These varieties included M Esc Fla 039, M Esc Fla 021, M Bra 383, M Col 2066, CM 3311-4, CM 7772-13, and SM 1779-8 (CIAT 1999, 2000, 2001, 2002b, 2003a)."},{"index":11,"size":38,"text":"Between 1995 and 2007, about 6400 cassava genotypes were evaluated in Villavicencio (Colombia) for their field resistance to CBB. Of these, 117 were identified as having partial resistance (CIAT 2001(CIAT , 2002b(CIAT , 2003a(CIAT , 2006(CIAT , 2007))."},{"index":12,"size":45,"text":"In a 10 × 10 diallelic study, carried out in Villavicencio, with 45 families and 30 plants per family, the cassava genotype CM 4574-7 was identified as having high general combination ability. Its progenies showed increased resistance to CBB and SED (Calle et al. 2005)."},{"index":13,"size":124,"text":"Tolerant varieties also exist such as M Bra 685, M Bra 886, ICA Catumare, ICA Cebucán, ICA Negrita, Vergara (CM 6438-14), CM 4574-7, and Chiroza. However, the disease has increased in severity in ICA Catumare, for which adequate selection of clean seed was not performed (Álvarez and Llano 2002). Several genotypes have also been identified as having resistance to several pathotypes of the bacterium (Álvarez et al. 1999). Zinsou et al. (2004) recommended the cassava genotype TMS 30572 for farmers in Benin, because of its high yield and relatively stable resistance to CBB across different environments. Kpémoua (1995) showed that resistance to Xam is associated with the production of phenolic compounds and the reinforcement of cell walls in the vascular system during early infection."},{"index":14,"size":109,"text":"To determine the genetic control of resistance, 150 F 1 individuals of the cross TMS 30572 × CM 2177-2 were inoculated with the pathogen and evaluated for resistance under controlled conditions in the greenhouse. Five different Xam strains from the world's major cassava-growing areas were used in the study. Genetic analysis identified six genomic regions that control resistance to all Xam strains. One region controlled >60% of resistance to each of the strains CIO-1 and CIO-136. Two regions accounted for >70% of resistance to strain CIO-84. Another 80% of resistance to strains CIO-136 and ORST X-27 could be explained by 3 loci for each strain (Jorge et al. 2000)."},{"index":15,"size":94,"text":"In three instances, the same genomic regions controlled resistance to two strains. A marker was obtained by Southern hybridization of a PCR amplification product from cassava, using heterologous primers designed from conserved regions of the Xanthomonas resistance gene in rice (Xa21). The region it marked accounted for 60% of phenotypic variance for resistance to strain CIO-136. A backcross population, derived from crossing members of the mapping population, has been developed and will provide more recombinations for fine mapping towards cloning resistance genes, and for studying intra-locus and inter-loci genetic interactions (Jorge et al. 2000)."},{"index":16,"size":214,"text":"A molecular genetic map of cassava was recently constructed from an F 1 cross of noninbred parents. RFLP, AFLP, EST, SSR markers were used to map resistance to CBB. The F 1 cross was evaluated with Xam strains under both field and greenhouse conditions. Nine quantitative trait loci (QTLs), located on linkage groups B, D, L, N, and X, explained the phenotypic variance of the crop's response to Xam in the greenhouse. Jorge et al. (2001) reported eight QTLs associated with resistance to CBB, and found changes in the expression of QTLs from one cropping cycle to another in the field, which could be related to changes in the pathogen's population structure. A QTL, located in linkage group D, was conserved over two cropping cycles and in resistance evaluations in the greenhouse. In a previous study, Jorge et al. (2000) showed that 12 different QTLs control resistance to five Xam strains. Hurtado et al. (2005) detected the molecular marker, microsatellite SSRY 65, that could select resistant genotypes in a cassava family corresponding to the cross CM 9208-13 × M Nga 19. Furthermore, the authors identified two RGAs of the NBS class through amplification with PCR, using two primers designed by Llano (2003). These RGAs could identify plant individuals that were resistant to the bacterium."},{"index":17,"size":73,"text":"One approach to assessing cassava genetic diversity involves the structural analysis of genotypes resistant to CBB. Multiple correspondence analysis of AFLP data, using two primer combinations for cassava genotypes resistant and susceptible to two strains of Xam, elucidated the genetic structure of cassava germplasm resistant to CBB (Sánchez et al. 1999). Results revealed a random distribution of resistance or susceptibility, suggesting that resistance to CBB has arisen independently many times in cassava germplasm."},{"index":18,"size":81,"text":"Phenolic compounds have been implicated in the resistance of cassava (Manihot esculenta) to xanthomonads. Cassava cultivars M Col 22 and CM 523-7 were inoculated with Xam and X. cassavae. CM 523-7 was susceptible to both pathogens, whereas M Col 22 was susceptible to Xam and resistant to X. cassavae. In the resistant interaction, no disease symptoms were observed in leaves. Bacterial growth was greatly reduced, and cell wall-bound peroxidase activity increased twofold, probably related to lignin deposition (Pereira et al. 2000)."},{"index":19,"size":111,"text":"Preformed putative defenses include copious latex production, which contains protease, ß-1,3 glucanase, and lysozyme activities. ESTs from a latex cDNA library revealed a constitutive expression of many defense-related genes including chitinase, glucanase, and PAL. A cDNA-AFLP analysis of cassava leaves suffering a hypersensitive response to Pseudomonas syringae pv. tomato revealed that 78 genes, new to cassava, had expressed differentially. Homologs of a metalloprotease, glucanase, peroxidase, and ACC oxidase were all found to be upregulated. Pathogenicity determinants of Xam are being studied in the disruption of the gum biosynthesis gene (its EPS is produced copiously in plants) and the pel gene (pectate lyase appears as a single isoform) (Kemp et al. 2001)."},{"index":20,"size":56,"text":"RGAs were amplified as a means of elucidating the putative genes involved in cassava's defense response. For the cDNA-AFLP technique, of about 3600 cDNA fragments screened, 353 fragments were specific to a resistant variety. Sequence analyses showed significant homology with resistance genes, NPK-1 related proteins, senescence-related proteins, and other known proteins involved in disease resistance reactions."},{"index":21,"size":114,"text":"Using degenerate primers, 12 classes of RGAs were identified in cassava. Screening a cassava cDNA library (root and leaf) with class-specific RGA probes also led to the identification of 16 expressed gene clones. Sequence analysis of clone L16 confirmed the constitutive expression of a protein that shares characteristics with previously reported resistance genes (Restrepo et al. 2001). López et al. (2004a) identified 6046 unigenes and characterized a group of genes putatively involved in cassava's defense response to Xam infection. López et al. (2004b) identified the RXam1 gene, homolog of Xa21 from rice, in a 3600-bp DNA fragment. The gene is induced in the resistant variety (M Bra 685), 72 h after infection by Xam."},{"index":22,"size":7,"text":"Cultural practices. The following practices are recommended:"}]},{"head":"•","index":45,"paragraphs":[{"index":1,"size":20,"text":"Use of healthy planting materials obtained from disease-free crops, plants derived from meristem culture, and by rooting buds and/or shoots"}]},{"head":"•","index":46,"paragraphs":[{"index":1,"size":26,"text":"Treating stakes by immersing them for 10 min in a solution of cupric fungicides such as copper oxychloride or Orthocide® (captan) at 3 to 6 g/L"},{"index":2,"size":11,"text":"• Immersion in extract of citrus fruit seeds (Lonlife ® )"},{"index":3,"size":123,"text":"• Heat treatment of stakes (Álvarez et al. 2008;CIAT 2007), using hot water at 49 °C for 49 min. Incidence of CBB in untreated stakes was 37%, but dropped to 7% when treated with hot water. It dropped further to 0% when stakes were pretreated at 49 °C for 10 min 24 h before being treated with hot water for 5 h. Treatment with hot water did not, in practical terms, affect stake germination, reducing it by only 18% in the most prolonged treatment (Ramírez et al. 2000). The induction of enzymes that activate under stress conditions is probably responsible for conserving high stake germination, even after prolonged treatment in hot water. Lozano (1986) also mentions the following practices for managing the disease:"}]},{"head":"•","index":47,"paragraphs":[{"index":1,"size":24,"text":"Planting at the end of rainy periods Complementary studies elucidated some mechanisms of resistance at the biochemical and genetic levels and molecular host-pathogen interactions."},{"index":2,"size":45,"text":"New methods for detecting Xanthomonas campestris pv. manihotis (Xcm), using immunological and genetic techniques, were developed. Research results were partly verified under African conditions such as testing the cassava genome mapping population for reaction towards African strains to identify genetic markers and/or resistance related genes."},{"index":3,"size":33,"text":"Biological control. Spraying with suspensions of Pseudomonas putida reduced the severity of damage caused by CBB, while cassava yields increased significantly (CIAT 1985). However, this practice has not been adapted for farming conditions."},{"index":4,"size":6,"text":"Bacterial stem rot (Erwinia carotovora pv."}]},{"head":"carotovora)","index":48,"paragraphs":[{"index":1,"size":18,"text":"Importance. This disease is important for the damage it does to the quality and germinability of planting stakes."},{"index":2,"size":90,"text":"Symptoms. The disease is characterized by an aqueous and smelly stem rot or by medullary necrosis of the plant's ligneous parts (Figure 8-18). Infected plants show bud wilt. The stem's surfaces typically show perforations made by insects of the genus Anastrepha Schiner, which act as vectors for the bacterium. These orifices are easy to distinguish by the presence of dry latex, discharged as the stem is perforated. Diseased stakes used for planting will not germinate or they produce weak spindly plants, with a limited number of bulked roots (CIAT 1972)."}]},{"head":"Management and control. •","index":49,"paragraphs":[{"index":1,"size":16,"text":"Using healthy seed • Planting with varieties resistant to the insect vector • Burning infected stems"}]},{"head":"Bacterial stem gall (Agrobacterium tumefaciens)","index":50,"paragraphs":[{"index":1,"size":82,"text":"Symptoms and epidemiology. This disease generally appears on the lower parts of stems in plants older than 6 months. Characteristic symptoms, found on stem nodes, are galls that often become very large, presenting a proliferation of buds on the epidermis . Infected plants may become weak and spindly, and in the early days of infection, suffer dieback to as far as major galls. A single plant could have several galls on a stem and even along lower branches (Lozano et al 1981)."},{"index":2,"size":23,"text":"The disease is usually initiated by infested soil being rain-splashed onto wounds caused by natural defoliation in stems of the plant's lower parts."}]},{"head":"Management and control.","index":51,"paragraphs":[{"index":1,"size":41,"text":"Control is achieved through rotation with another crop when more than 3% of the planting is infected; disinfecting machetes with 2% sodium hypochlorite; always using planting stakes from healthy crops; and burning diseased materials within the crop (Lozano et al 1981)."},{"index":2,"size":8,"text":"Another bacterial disease is caused by Erwinia herbicola. "}]},{"head":"Diseases caused by 'Candidatus Phytoplasmas'","index":52,"paragraphs":[{"index":1,"size":7,"text":"(previously known as mycoplasma-like organisms or MLOs)"},{"index":2,"size":9,"text":"Cassava frogskin disease (Ca. phytoplasma, subgroup 16SrIII-L and rpIII-H)"},{"index":3,"size":45,"text":"Importance. Cassava frogskin disease (CFSD) is an economically important disease affecting cassava roots. It was reported for the first time in 1971, in the Department of Cauca, southern Colombia. Its origin appears to be the Amazon region of Brazil or Colombia (Pineda et al. 1983)."},{"index":4,"size":74,"text":"Frogskin disease directly affects root production, causing losses of 90% or more. Symptoms consist of small, longitudinal fissures distributed throughout the root. As roots increase in diameter, the fissures tend to heal, giving the injuries a lip form. The root cortex or epidermis appears cork-like and peels off easily. Depending on the severity of symptoms, the depth and number of lesions increase until the root becomes deformed (Álvarez et al. 2003a;Pineda et al. 1983)."},{"index":5,"size":80,"text":"Distribution. In the 1980s, the disease occurred in most cassava-growing regions of Colombia and has continually spread. It has now been reported in Brazil, Costa Rica, Panama, Peru, and Venezuela (Calvert and Cuervo 2002), as well as in Nicaragua and Honduras. In Venezuela, it was reported for the first time in the States of Barinas and Aragua, with incidences between 11.4% and 14.3%, in cassava stakes grafted with 'Secundina', a variety used to diagnose the disease (Chaparro and Trujillo 2001)."}]},{"head":"Symptoms and epidemiology.","index":53,"paragraphs":[{"index":1,"size":62,"text":"Frogskin mostly attacks cassava roots, reducing their diameter, but some varieties may also show symptoms in leaves such as mosaic, chlorosis, curling, and/or curvature in leaf margins (Figure 8-20A). However, these symptoms are difficult to distinguish under field conditions, and may be confused with damage from mites, thrips, viruses, and micronutrient deficiencies, or they can be masked when temperatures are >30 °C."},{"index":2,"size":73,"text":"Characteristic CFSD symptoms in the roots include a woody aspect and the thick, cork-like peel, which is also fragile and opaque. The peel also presents lip-like slits that may join to create a net-like or honeycomb pattern (Figures 8-20B and 8-20C). When roots do not bulk adequately (Figure 20D), the stems tend to be thicker than normal. In contrast, the roots of healthy plants are well developed, with thin, brilliant, and flexible peel. "}]},{"head":"A B C D","index":54,"paragraphs":[{"index":1,"size":46,"text":"Molecular tests, carried out on plants of cassava and pink vinca (Catharanthus roseus (L.) G. Don) after transmission trials with dodder (Cuscuta sp. L.), detected the presence of phytoplasmas associated with the 16SrIII group. Graft transmission could transfer phytoplasmas from infected to healthy plants (CIAT 2005)."},{"index":2,"size":42,"text":"Insects were collected to identify the vector or vectors of the phytoplasma causing the disease. A homology of 90% was found among sequenced fragments from tissue of the insect Scaphytopius marginelineatus Stål (Hemiptera: Auchenorrhyncha: Cicadellidae) and from tissues of two cassava varieties."},{"index":3,"size":96,"text":"Etiology. The CFSD-associated phytoplasmas were identified as group 16SrIII strains by restriction fragment length polymorphism (RFLP) and sequence analyses of amplified rDNA products, and results were corroborated by PCRs employing group 16SrIII-specific rRNA gene or ribosomal protein (rp) gene primers. Collectively, RFLP analyses indicated that CFSD strains differed from all phytoplasmas described previously in group 16SrIII and, on this basis, the strains were tentatively assigned to new ribosomal and ribosomal protein subgroups 16SrIII-L and rpIII-H, respectively. This is the first molecular identification of a phytoplasma associated with CFSD in cassava in Colombia (Álvarez et al. 2009)."},{"index":4,"size":71,"text":"The phytoplasma was not detected in healthy plants from the same varieties harvested in disease-free fields. These results point towards the possible role played by phytoplasmas in this disease (Álvarez et al. 2003a;CIAT 2002a). The importance of the CFSD in cassava production systems has motivated other scientific groups at CIAT, such as the Virology group, to undertake efforts to understand the characteristics of the disease, its symptoms and its management practices."},{"index":5,"size":68,"text":"Cuttings from CFSD-infected plants in the greenhouse were taken, and rooted in deionized water with different doses of chlortetracycline. Inhibition of leaf symptoms caused by CFSD was successful in two experiments when 50 ppm chlortetracycline were used, thus indicating that CFSD is not caused by a virus. Nested PCR also showed that phytoplasmas were present in leaves of infected plants when treated with 0 ppm tetracycline (CIAT 2003b)."},{"index":6,"size":121,"text":"Although the disease spreads mostly through infected stakes, the disease is believed to have insect vectors. Numerous homopteran species (e.g., planthoppers, tree hoppers, and froghoppers) were collected from cassava fields in 9 departments and 17 sites in Colombia. Three genera-Scaphytopius fuliginosus Osborn, Empoasca sp. Walsh, and Stirellus bicolor Van Duzee (Hemiptera: Cicadellidae)were the most frequently collected. These three species are known vectors of viruses and phytoplasmas for other crops. Based on the evidence of high homology (80%) between insect and phytoplasma detected in cassava, Sc. fuliginosus appears to be a potential candidate as the vector for CFSD (CIAT 2003b). However, tests for transmission have not yet effectively confirmed this hypothesis. The whitefly (Bemisia tuberculata) is still associated with the disease transmission."},{"index":7,"size":75,"text":"Integrated disease management. To date, the disease is managed principally by using stakes from healthy plants. Heat treatment, followed by meristem culture, has been used to obtain plants free of CFSD. Grafting with the susceptible variety Secundina is useful for monitoring the effectiveness of the heat treatment (Flor et al. 2001). Treating stakes at temperatures of more than 55 °C appears promising but needs adjusting to reduce losses by the consequent low germination of stakes."},{"index":8,"size":38,"text":"Plantings with more than 10% of incidence (foliage, stakes, and roots) should be burned. Plant health surveillance and quarantine systems need to be strengthened to prevent the entry or mobilization of planting materials from areas with the disease."},{"index":9,"size":49,"text":"Field and greenhouse studies carried out at CIAT have reported 30 genotypes with different levels of resistance. These findings were confirmed through the expression of leaf symptoms in grafts with variety Secundina (CIAT 2003b;Cuervo 2006). The use of tolerant varieties will be a useful tool in controlling this disease."}]},{"head":"Witches' broom","index":55,"paragraphs":[{"index":1,"size":80,"text":"Importance. This disease, known as superbrotamiento in Spanish, has been reported in Brazil,Venezuela,Mexico,. Although its incidence is not significant, the percentage of witches' broom in affected plantings is much higher than that of other diseases caused by American phytoplasmas. Crop losses can reach 80% (Lozano et al. 1981). In Asia a new cassava disease was observed at Quang Ngai, Vietnam (Figure 8   The disease is transmitted mechanically and by the use of stakes from diseased plants (Lozano et al. 1981)."},{"index":2,"size":64,"text":"Etiology. The transmission of cassava phytoplasmas by Cuscuta sp. into pink vinca was 100% positive. Symptoms appeared 3 weeks after implanting the host parasite into pink vinca in growth chambers at 18-20 °C. No transmission was achieved with the insect Scaphytopius fuliginosus, even 3 months after exposure to feeding, whether cassava to cassava, cassava to vinca, or vinca to vinca (Valencia et al. 1993)."},{"index":3,"size":84,"text":"In Vietnam, disease recognition was carried out in the country's central and southern regions (Quang Ngai and Dong Nai provinces). Samples for diagnosing phytoplasmas were collected in southern Vietnam at Hung Loc Agricultural Research Center and from a farmer's plot in Dong Nai province, both sites about 60 km from Ho Chi Minh City. Phytoplasmas were detected in the samples collected in Thailand and Vietnam. Diagnosis results confirm the association of symptoms (high bud proliferation shoots with short internodes, and small leaves) with phytoplasmas."},{"index":4,"size":79,"text":"Phytoplasmas were detected in roots, small leaves, and leaf veins showing symptoms. No phytoplasmas of the 16SrIII group (reported in America) were found in the samples from Thailand and Vietnam. However, only samples from eastern Thailand and southern Vietnam have been evaluated. These results need to be confirmed. Molecular tests based on the 16Sr gene indicated that differences exist between the phytoplasmas detected in eastern Thailand and southern Vietnam (E Álvarez, JF Mejía, and A Bertaccini 2009, pers. comm.)."},{"index":5,"size":61,"text":"Management. The use of healthy planting materials and the elimination of diseased plants in the field are recommended to prevent the disease (Lozano et al. 1981). The disease is reduced by selecting stakes from healthy plants and by restricting the movement of cassava planting stakes, especially from infected areas, and that of related species such as Jatropha. Varietal resistance also exists."}]},{"head":"Antholysis","index":56,"paragraphs":[{"index":1,"size":36,"text":"Importance. Antholysis in cassava was observed in crops in southwestern Colombia in 1981 by Jayasinghe et al. (1983), severely in some experimental clones. However, this disease does not have economic importance and is only sometimes observed."},{"index":2,"size":61,"text":"Symptoms. The disease appears in the inflorescence, with a characteristic virescence in the petals, which, instead of being their normal pink, become green. Hypertrophy of the petals is later observed and they become structures similar to leaves (phyllody). The floral racemes lose their normal appearance and resemble sprouts, giving this syndrome its name \"antholysis\" (antho -flower; lysis -dissolve, loosen) (Figure 8-24). "}]},{"head":"A B C","index":57,"paragraphs":[{"index":1,"size":71,"text":"Infected flowers commonly exhibit a very swollen gynophore and develop internodes in the floral receptacle, a phenomenon known as apostasis. Furthermore, elongation of the receptacle occurs above the insertion of the pistil, with development of sprouts. Flower fertility is lost, resulting in nonfunctional flowers that abort prematurely. Affected plants do not present symptoms in other organs and, moreover, germination did not differ between infected and healthy stakes (Jayasinghe et al. 1983)."},{"index":2,"size":47,"text":"Etiology. By using an electron microscope, Jayasinghe et al. (1983) observed oval or spherical pleomorphic structures only in phloem tissues. Transmission is 100% by stakes. Under greenhouse conditions, symptoms of antholysis appear within 1 month of planting, contrasting with healthy plants, which take 5 months to flower."},{"index":3,"size":36,"text":"Treatment with penicillin (500 to 1000 ppm) did not reduce symptoms, whereas tetracycline reduced antholysis by 90%. This sensitivity and detection by Dienes' stain confirmed that the causal agent is a phytoplasma (Jayasinghe et al. 1983)."},{"index":4,"size":15,"text":"Management. The disease is reduced by selecting stakes from healthy plants. Varietal resistance also exists."}]}],"figures":[{"text":"3 AFigure 8 Figure 8-1. Symptoms of superelongation disease in cassava: (A) cankers on leaves, (B) cankers on petioles and stem, and (C) elongated stem. "},{"text":"Figure 8 Figure 8-2. Leaf spots caused by Cercospora henningsii. "},{"text":"Figure 8 Figure 8-3. Leaf spots caused by Cercospora vicosae in a cassava leaf. "},{"text":"Figure 8 Figure 8-4. Leaf spots caused by Phaeoramularia manihotis. "},{"text":"Figure 8 Figure 8-5. Leaf spots caused by Phoma sp. in cassava. "},{"text":"Figure 8 Figure 8-6. Cassava ash symptoms, caused by Oidium sp. "},{"text":"Figure 8 Figure 8 -7. Leaves and stem show cankers caused by Glomerella manihotis. "},{"text":"Figure 8 Figure 8-8. Disease symptoms observed on cassava stems. "},{"text":"Figure 8 Figure 8-9. Symptoms of cassava rust characterized by pustule formation on (A) leaf, and (B) and (C) stems. "},{"text":" Symptoms and epidemiology. Infection is characterized by pustule formation on leaf veins, petioles, or green branches (Figure 8-9). Pustules are light to dark brown, depending on their age or class of fungal fructification. Mature pustules are readily parasitized by the fungus Darluca filum. They are sometimes surrounded by chlorotic halos and, usually, induce deformation of affected parts. Wind is the principal dissemination agent. "},{"text":"Figure 8 - Figure 8-10. Necrosis caused by Glomerella cingulata in cassava stakes. "},{"text":"Figure 8 - Figure 8-12. Rot caused by Rosellinia necatrix in cassava roots. "},{"text":" Figure 8-14. Cassava root rot symptoms observed in Rayong and at the Thai Tapioca Development Institute (TTDI) in Huay Bong, Nakhon Ratchasima Province. "},{"text":"Figure 8 -B Figure 8-13. Cassava plants showing symptoms of root rot and wilting in (A) Buriram Province and (B) Nakhon Ratchasima Province, Thailand. "},{"text":" Rhizoctonia sp. Rhizopus sp. Rosellinia necatrix (Lozano and Booth 1979) Pythium chamaehyphon (GenBank accession AY745748; CIAT 2004) Eleven species of Phytophthora have been reported as causing root rot. These are: P. arecae (Coleman) Pethybridge (Álvarez et al. 1997c) P. capsici Leonian (Lima et al. 1993) P. citricola (CIAT 1999, 2000) P. cryptogea Pethybr. & Lafferty P. drechsleri Tucker (Figueiredo and Albuquerque 1970; Muller and De Carneiro 1970) P. erythroseptica Pethybridge (Fassi 1957) P. meadii (Barragán and Álvarez 1998) P. melonis (GenBank accession AY 739021; CIAT 2000, 2004) P. nicotianae Breda de Haan var. nicotinae (Dastur) (Soto et al. 1988) P. palmivora (Johnson and Palaniswami 1999; (Álvarez and Llano 2002) P. tropicalis (GenBank accession AY 739022; "},{"text":" disease management. The integrated management of root rots includes the use of varietal resistance and/or cultural practices. "},{"text":"C Varietal resistance. A principal tool for managing root rots caused by various Phytophthora species is the use of varietal resistance. Various examples exist of the successful adoption of cassava clones resistant to Phytophthora spp. In 1990, the Brazilian Agricultural Research Corporation (Embrapa) and the Agricultural Research Center for the Humid Tropics (CPATU) released two cassava clones resistant to root rots: cvs. "},{"text":"Figure 8 - Figure 8-16. Cassava bacterial blight (CBB) symptoms observed on cassava leaves of cv. Rayong 5 in Thailand. "},{"text":"Figure 8 - Figure 8 -17. Symptoms of cassava bacterial blight, induced by the bacterium Xanthomonas axonopodis pv. manihotis: (A) angular leaf spots and leaf blight, (B) exudate on stem, and (C) plant wilt. "},{"text":"Figure 8 - Figure 8-18. Symptoms caused by Erwinia carotovora: (A) wilt, and (B) damage to the medulla.A B "},{"text":"Figure 8 - Figure 8-20. Symptoms of cassava frogskin disease in (A) leaves, (B) and (C) presence of lips in root, and (D) reduced root bulking. "},{"text":" -22). Typical symptoms similar to witches' broom are widespread in southern Vietnam, in Plangyao, Chacheoengsao, Thailand, and also in the Philippines (Figure 8-23). The disease may seriously affect yields and the availability of clean planting material.Symptoms. Several symptomatologies exist:1. Plants exhibit dwarfism and an exaggerated proliferation of buds. Sprouts have short internodes and small leaves, but do not show deformation or chlorosis. 2. Proliferation of weak spindly sprouts on the stakes. "},{"text":"Figure 8 - Figure 8-23. Disease symptoms observed on cassava plants in the Philippines. "},{"text":"Figure 8 - Figure 8-21. Symptoms of \"superbrotamiento\" in cassava.(Photo: B Pineda.) "},{"text":"Figure 8 - Figure 8-24. Symptoms of antholysis in cassava: (A) healthy flower, (B) virescence, and (C) phyllody. (Photos: B Pineda.) "}],"sieverID":"cfc8bd39-c689-4d67-b3ff-1a7db3948b88","abstract":"World production of cassava roots was estimated at 233 million tons in 2008. Africa was the largest producer with 118 million tons on almost 12 million hectares, followed by Asia with 78.7 million tons on 3.97 million ha. Cassava (Manihot esculenta Crantz) is a significant staple, providing a basic daily source of dietary energy for almost one billion people in 105 countries. It also has numerous agroindustrial uses. Cassava grows on marginal lands, tolerates drought, and can grow in low-fertility soils. Cassava is also the most inexpensive source of starch that exists, being used in more than 300 industrial products (FAOSTAT, 2010).Cassava is still widely cultivated under traditional management. This suggests that large numbers of farmers may be ignorant of the crop's diseases and their integrated management. Hence, several diseases threaten the sustainability of cassava production and its profitability. The principal diseases attacking the crop are: Cassava bacterial blight (CBB 4 ; Xanthomonas axonopodis pv. manihotis or Xam) Phytophthora root rots (PRR; Phytophthora spp.) Superelongation disease (SED; Sphaceloma manihoticola) Cassava frogskin disease (CFSD; Candidatus phytoplasma, Cfdp of the 16SrIII-L and rpIII-H subgroups) Cassava mosaic disease (CMD; begomovirus complex) Cassava brown streak disease (CBSD; an ipomovirus) Brown leaf spot (Cercosporidium henningsii) Diffuse leaf spot (Cercospora vicosae) White leaf spot (Phaeoramularia manihotis) Anthracnose (Colletotrichum spp."}

data/part_2/07fa2502cbad86903c08649ed04315d4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07fa2502cbad86903c08649ed04315d4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/538b566d-116a-4396-8fad-9f9336155619/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"  "},{"text":"  "},{"text":"Table 1 . Summary For more information on the IBLI project, visit http://livestockinsurance.wordpress.com. Index Area Loiyangalani Index AreaLoiyangalani Year 2013 Year2013 Season LRLD SeasonLRLD Date of the most recent data 22 Mar 2013 -6 Apr 2013 Date of the most recent data22 Mar 2013 -6 Apr 2013 Predicted Livestock Mortality 0.04 Predicted Livestock Mortality0.04 Czndvi_pre -1.83 Czndvi_pre-1.83 Czndvi_pos -1.68 Czndvi_pos-1.68 CNzndvi 0.91 CNzndvi0.91 CPzndvi 0.30 CPzndvi0.30  "}],"sieverID":"9516c9d2-153a-4f05-a8fd-0bc09679deea","abstract":""}

data/part_2/084cdd6b5d6264665b3bff0ce3b33b79.json

@@ -0,0 +1 @@
+{"metadata":{"id":"084cdd6b5d6264665b3bff0ce3b33b79","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9071b040-0a4a-40f1-955f-c91c4c348abb/retrieve"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"What is NATURE+?","index":1,"paragraphs":[{"index":1,"size":36,"text":"The CGIAR Initiative on Nature-Positive Solutions aims to re-imagine, collaboratively create and implement nature-positive solutions for agri-food systems that equitably support food and livelihoods and ensure that agriculture is a net-positive contributor to biodiversity and nature."},{"index":2,"size":131,"text":"In Kenya, we work in the neighboring counties of Kisumu and Vihiga in the west, Turkana in the northwest, and Kajiado in the southeast. Kisumu and Vihiga have ideal climates for agriculture, but once-fertile soils are highly degraded and eroded. Turkana and Kajiado are in Kenya's Rift Valley region, have very low rainfall, high temperatures, and its inhabitants are known for their now-threatened nomadic livestock-dependent traditions. The counties are home to some 4 million people. Kenya's young population -the median age is below 20 -is generally disengaged from agriculture but signs of renewed interest abound: young agricultural professionals focus their expertise on increasing land production; demand for food -especially healthier options -is increasing; and researchers, development agencies and governments are enacting nature-based plans to improve Kenya's food security, nutrition and livelihoods."},{"index":3,"size":64,"text":"Land degradation and climate change hamper Kenya's food production. Cheap, calorie-dense, nutritionally lacking foods are replacing traditional fare, contributing to malnutrition that affects millions. The many organizations collaborating to reverse these trends face challenges in uniting the required experts and there are no easy fixes or one-sizefits-all answers. But a better understanding of the challenges is leading to increased collaboration, especially for nature-based solutions."},{"index":4,"size":68,"text":"NATURE+ and our partners bring their expertise to the field but begin work directly with the stakeholders who matter the most: the communities at the forefront climate change, biodiversity loss and food insecurity. By adapting to their needs, collaborating with them on the design of activities, gaining their endorsement, and having them take ownership of solutions, we are seeing the beginnings of the long-term benefits of nature-based practices."},{"index":5,"size":16,"text":"Women in Kisumu, Kenya, celebrate their growing business ventures supported by NATURE+'s RECYCLE work in 2023."},{"index":6,"size":62,"text":"• Two aggregated farms for smallholders to access economies of scale, restore landscapes, and increase agrobiodiversity, and diversify incomes The aggregated farms will formally launch based on designs created by farmers. Implementation will include apiculture, pisciculture, monitoring of native agrobiodiversity and livelihood improvements, and creation of operational frameworks. My Farm Trees will expand with at least two community nurseries for native trees."},{"index":7,"size":46,"text":"Green circular economy activities will continue to scale, with a focus on aggregated farms, women's cooperatives and other NATURE+ research sites. The work aims to unlock the high potential for rural waste to be turned into fertilizer, energy and economic opportunities while reducing its negative impact."},{"index":8,"size":45,"text":"To strengthen support for nature-positive action, an agroecology policy for Vihiga will be presented for public consultation and approval by county authorities. Tools for true-cost accounting will be deployed for authorities to address the burden food systems impose on nature, human health and the economy."},{"index":9,"size":79,"text":"NATURE+ research projects will continue to produce new applicable knowledge. The Initiative will further work on underutilized crop varieties for increased food security, agrobiodiversity, conservation, sustainability, and improved livelihoods. Ongoing research is assessing intercropping for yield improvement and the cultivation of shrub species to avoid encroachment on protected areas.  Vernooy, R., et al. (2023). Policies, laws, and regulations in support of farmer-managed seed systems: still a long way to go. A review of 14 countries in Africa. . ISSD"}]}],"figures":[{"text":" . et al. (2023). On the margins: A review of policies and laws in support of farmer-managed seed systems in Africa.ISSD Africa, and Alliance of Bioversity  International and CIAT     The CGIAR Initiative on Nature-Positive NATURE+ in Kenya in 2023 had outstanding media coverage. A full report of Kenyan media coverage in outlets including The Nation, The Standard, the Kenya Broadcasting Corporation and The Star can be found in this report. Solutions has five work packages focused on nature and biodiversity: CONSERVE, MANAGE, The following are a few other highlights: rejuvenating farming. More than 2,400 farmers in Siaya, Laikipia and Turkana registered with My Farm Trees, and 700-plus hectares were brought under restoration using primarily native trees chosen by farming communities, who co-designed the platform. 2024 and beyond The CGIAR Initiative on Nature-Positive NATURE+ in Kenya in 2023 had outstanding media coverage. A full report of Kenyan media coverage in outlets including The Nation, The Standard, the Kenya Broadcasting Corporation and The Star can be found in this report. Solutions has five work packages focused on nature and biodiversity: CONSERVE, MANAGE, The following are a few other highlights:rejuvenating farming. More than 2,400 farmers in Siaya, Laikipia and Turkana registered with My Farm Trees, and 700-plus hectares were brought under restoration using primarily native trees chosen by farming communities, who co-designed the platform. 2024 and beyond Let us rethink food systems, environmental sustainability RESTORE, RECYCLE and ENGAGE. These work -Opinion piece by Carlo Fadda, leader NATURE+, in concert at most research and intervention sites. Cross-cutting implementation is key to published in The Nation, Kenya  Let us rethink food systems, environmental sustainability RESTORE, RECYCLE and ENGAGE. These work -Opinion piece by Carlo Fadda, leader NATURE+, in concert at most research and intervention sites. Cross-cutting implementation is key to published in The Nation, Kenya nature-positive results. The following are some Forest restoration at risk from seed shortage -Research highlights and next steps for our collaborative work, much of which engages women and youth highlight, Nature Africa  nature-positive results. The following are some Forest restoration at risk from seed shortage -Research highlights and next steps for our collaborative work, much of which engages women and youth highlight, Nature Africa in agriculture and related value chains. On two small islands in the Indian Ocean, an endangered palm with the world's largest seed sows a lesson about CONSERVE landscape restoration -EurekAlert! RECYCLE What we've done in agriculture and related value chains. On two small islands in the Indian Ocean, an endangered palm with the world's largest seed sows a lesson about CONSERVE landscape restoration -EurekAlert!RECYCLE What we've done What we've done Africa Climate Week advanced tree restoration pledges  What we've done Africa Climate Week advanced tree restoration pledges but a big seed shortage remains -EurekAlert!  but a big seed shortage remains -EurekAlert! Turkana, Kenya: Reaping Immense Benefits of Tools Turkana, Kenya: Reaping Immense Benefits ofTools Vegetables Production -CGIAR  Vegetables Production -CGIAR Underutilized yet important wild edible plants threatened in Kenya -CGIAR 2024 and beyond Partners Underutilized yet important wild edible plants threatened in Kenya -CGIAR2024 and beyond Partners What is the real cost of food? NATURE+, IFPRI aim to 2024 and beyond add up a reality-based food bill (blog) and webinar -  What is the real cost of food? NATURE+, IFPRI aim to 2024 and beyond add up a reality-based food bill (blog) and webinar - CGIAR  CGIAR NATURE+ Initiative to provide policymakers with tools  NATURE+ Initiative to provide policymakers with tools needed to incentivize nature-positive agriculture -CGIAR  needed to incentivize nature-positive agriculture -CGIAR From informal to formal: Empowering women in circular ENGAGE From informal to formal: Empowering women in circularENGAGE bioeconomy business in Kenya -CGIAR What we've done bioeconomy business in Kenya -CGIARWhat we've done MANAGE What we've done Publications & reports  MANAGE What we've done Publications & reports Giacomini, F.L., et al. Seeding African Forest and  Giacomini, F.L., et al. Seeding African Forest and Landscape Restoration: Evaluating Native Tree Seed  Landscape Restoration: Evaluating Native Tree Seed Systems in Four African Countries. Diversity 2023, 15,  Systems in Four African Countries. Diversity 2023, 15, 981.  981. ISSD Africa and Vernooy, R. 2023. The multiple benefits 2024 and beyond ISSD Africa and Vernooy, R. 2023. The multiple benefits2024 and beyond of crop diversity. Video.  of crop diversity. Video. Oduor, F.O et al. (2023) Diversity and utilization of  Oduor, F.O et al. (2023) Diversity and utilization of indigenous wild edible plants and their contribution 2024 and beyond to food security in Turkana County, Kenya. Frontiers in  indigenous wild edible plants and their contribution 2024 and beyond to food security in Turkana County, Kenya. Frontiers in Sustainable Food Systems  Sustainable Food Systems Oluoch, W.A., et al. Indigenous communities'  Oluoch, W.A., et al. Indigenous communities' perceptions reveal threats and management options  perceptions reveal threats and management options of wild edible plants in semiarid lands of northwestern  of wild edible plants in semiarid lands of northwestern Kenya. J Ethnobiology Ethnomedicine  Kenya. J Ethnobiology Ethnomedicine RESTORE  RESTORE What we've done  What we've done December 2023 | NATURE+ in Kenya Report 2023 & Outlook 2024 December 2023 | NATURE+ in Kenya Report 2023 & Outlook 2024 December 2023 | NATURE+ in Kenya Report 2023 & Outlook 2024December 2023 | NATURE+ in Kenya Report 2023 & Outlook 2024  "}],"sieverID":"a51b65f2-333d-4018-b22b-846cca5abd38","abstract":"In Kenya, NATURE+ unites people to solve shared challenges in food and natural systems. Farmers are putting their land and expertise together to tap into economies of scale and restore natural landscapes and agricultural productivity. Scientists and innovators are improving community seedbanks, restoring land with native trees, and creating value-added products -including from rural waste. NATURE+ shows that winning solutions begin where the best interests of people and nature intersect."}

data/part_2/08729c258e2330ec442416741cf05b6f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08729c258e2330ec442416741cf05b6f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4bf518c4-8d07-4ea8-b1b2-07465364104b/retrieve"},"pageCount":1,"title":"Agronomic evaluation of 25 accessions of Clitoria ternatea in time of maximum and minimum rainfall in Colombia","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[]},{"head":"Forage production","index":2,"paragraphs":[{"index":1,"size":46,"text":"• The average production of the accessions evaluated between the cutting stages, showed that the 3rd cutting (49 days after cutting) was the best (Figure 1.) with a production of 5.61 Ton DM/Ha/Cut, followed by the 1st cutting with 5.43 and the 2nd cutting with 5.27."}]},{"head":"Results and analysis","index":3,"paragraphs":[{"index":1,"size":90,"text":"• Agronomic evaluation of 25 accessions of Clitoria ternatea obtained from the Genetic Resources Bank of The Alliance Bioversity International and CIAT, in Palmira, Colombia. • Data was collected for 14 months, between 2020 and 2021, including periods of maximum and minimum precipitation. • The size of the plots was 9m 2 with three repetitions per treatment. » Clitoria ternatea is a suitable forage alternative for the American tropics where livestock production is important (e.g Llanos Orientales and Caquetá, Colombia), particularly when the forage supply is limited to associate grasses-legumes."},{"index":2,"size":42,"text":"» The inclusion of forage species in the grasslands can contribute to improving the productive parameters and the livelihoods of smallholder farmers, since with the greater supply of forage and the quality of the diet, productivity will be increased, improving household income."}]},{"head":"Methodology","index":4,"paragraphs":[{"index":1,"size":15,"text":"Sotelo M; Peters M; Arango J; Cardoso JA. Alliance Bioversity-CIAT, Tropical Forages Program CONTACT: [email protected]"}]},{"head":"Further reading","index":5,"paragraphs":[{"index":1,"size":44,"text":"Heinritz • The best accession in terms of forage production was CIAT 17768 with a production of 7.61 Ton DM/Ha/Cut, followed by CIAT9336 with 6.74 and CIAT712 with 6.73 respectively. On the other hand, the control, CIAT 20692 produced 5.36 Ton DM/Ha/Cut. (Figure 2.)"},{"index":2,"size":54,"text":"• In the 3rd cutting of the 24 accessions evaluated, 23 of them, including the control, exceeded the average production of 4.74 Ton DM/Ha/Cut. This shows that there is a wide diversity of materials within this species that have the potential to be included as a forage alternative under conditions of the American tropics.    "}]}],"figures":[{"text":" SN; Hoedtke S; Martens S; Peters M; Zeyner, A. 2012. Evaluation of ten tropical legume forages for their potential as pig feed supplement. Livestock Research for Rural Development 24, #7. http://www.lrrd.org/lrrd24/1/hein24007.htm Peters M; Franco LH; Schmidt A; Hincapie B. 2011. Especies forrajeras multipropósito: opciones para productores del trópico Americano. Publicación CIAT no. 374. Centro Internacional de Agricultura Tropical (CIAT); Cali, CO. https://hdl.handle.net/10568/54681 This poster is licensed for use under the Creative Commons Attribution 4.0 International license (CC BY 4.0) 2022-08. Design: A Yedra/CIAT. Main Photo: Wilfredor -CC0 1.0 "},{"text":"Figure 1 . Figure 1. Comparison of forage production averaging cutting stages. Source: own elaboration.Figure 2. Average forage production based on DM per accession according to cutting stage. Source: own elaboration. "},{"text":"Figure 2 . Figure 1. Comparison of forage production averaging cutting stages. Source: own elaboration.Figure 2. Average forage production based on DM per accession according to cutting stage. Source: own elaboration. "}],"sieverID":"b8295c0c-d1fd-4651-a3aa-501f341e105a","abstract":"is one of the main sources of animal protein for human consumption.• Most of the fattening systems are found in extensive grazing systems under native pastures that, although they have good nutritional quality, have a limited supply of forage, especially in critical seasons.• The above added to other factors have led to cattle ranching becoming a seasonal activity in the tropics, since in periods of low rainfall, farmers struggle with their animals to keep their weight and, in the worst case, to keep them alive.• This leads to an inefficient use of the area used for livestock, obtaining a very low stocking rate per hectare. • In Colombia there are around 33.8 million hectares under grazing with a livestock inventory of around 29.3 million head of cattle and a stocking rate of 0.86 animals/ha; being necessary to introduce new forage materials adapted to the conditions of the American tropics to increase the forage supply available for animals in critical times."}

data/part_2/0886a7819ecef50946cdae1c863b4bf4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0886a7819ecef50946cdae1c863b4bf4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/34a1609b-1594-4497-a50a-c774bce09b3d/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":42,"text":"With climatic uncertainty, including floods, droughts, cyclones and heat waves, projected to increase in the future, agriculture and food security are more vulnerable than ever. This instability puts productivity, incomes and ecosystems at risk. Poor smallholder farming communities will be hardest hit."},{"index":2,"size":27,"text":"In 11 countries, Bioversity International is working through its Seeds for Needs initiative to help farmers adapt better to climate change through the use of agricultural biodiversity."},{"index":3,"size":58,"text":"The Seeds for Needs concept is simple -if an array of different crops is grown on a farm or in a landscape, farmers are more likely to be able to cope with unpredictable weather. But farmers do not always have access to information or planting material to help them choose different crops or varieties that suit their conditions."},{"index":4,"size":55,"text":"Seeds for Needs started in Ethiopia in 2009 and now has project sites in eleven countries. Cambodia: rice, sweet potato; Colombia: beans; Ethiopia: barley, wheat; Honduras: beans; India: rice, wheat; Kenya and Tanzania: sorghum, pigeon pea, cowpea; Laos: cucumber, long bean, rice, sweet corn, watermelon; Papua New Guinea: taro, sweet potato; Rwanda and Uganda: beans"}]},{"head":"BIOVERSITY INTERNATIONAL","index":2,"paragraphs":[]},{"head":"Seeds for Needs","index":3,"paragraphs":[{"index":1,"size":21,"text":"Farmer involved in the Seeds for Needs initiative, India. Credit: Bioversity Intenational/ C.Zanzanaini Seeds for Needs addresses both these issues by:"},{"index":2,"size":13,"text":"• Exposing farmers to more crop varieties, increasing their knowledge about different traits."},{"index":3,"size":16,"text":"• Strengthening their local seed systems so they have access to seeds that fit changing needs."},{"index":4,"size":86,"text":"Farmers are directly part of evaluating and selecting varieties throughout the growing season, providing feedback on their preferred traits to scientists. Since 2011, the initiative has been using a crowdsourcing approach: each farmer is given three randomly-assigned varieties out of a broader selection to compare with their own varieties. By carrying out these mini trials with such a small number of varieties, more farmers can participate as 'citizen scientists'. The initiative is also using mobile technology as a cheap and accessible way to communicate with farmers."},{"index":5,"size":48,"text":"The Seeds for Needs initiative is now working with around 10,000 farmers worldwide. From 25,000 varieties of durum wheat and barley, 500 were short listed using geographic information system (GIS) technology and characterization. Out of this short list, farmers and scientists selected 50 to test for local adaptation."},{"index":6,"size":26,"text":"All of the 500 varieties have been made available to farmers either through established or new community seedbanks in the three regions where Bioversity International works."},{"index":7,"size":48,"text":"Seeds for Needs in India started with some 30 farmers in 2011 and has exponentially increased to 5,000 farmers through crowdsourcing. In the coming two years, Bioversity International hopes to work with over 30,000 famers, with a strong focus on increasing women farmers' access to knowledge and information."},{"index":8,"size":55,"text":"The initiative has also set up weather sensors, known as iButtons, in farmers' fields to record local temperature and humidity. This data is then compared with feedback from farmers on crop performance. Bioversity International is developing a data analysis software called ClimMob to help identify trends and give farmers feedback based on the collected data."},{"index":9,"size":19,"text":"Farmers scoring durum wheat varieties according to their preferred traits in a field trail, Northern Ethiopia. Credit: Bioversity International/C.Fadda"},{"index":10,"size":76,"text":"Farmer observing neighbour's wheat trials in India. Credit: Bioversity International/C.Zanzanaini Bioversity International's Seeds for Needs initiative provides an effective and cost-efficient way to provide farmers with vital information and improve their seed systems. The aim is to test and then develop solutions at scale, ensuring more potential benefits to more farmers and their families. Now more than ever, there is the potential to create lasting solutions for resilience and climate adaptation for smallholder farming communities worldwide."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":" Ethiopia was the first country where the Seeds for Needs initiative started in 2009. Bioversity International worked closely with partners to identify seeds from the national genebank that would resist drought and elevated temperatures. Honduras   Laos HondurasLaos Colombia  India Cambodia ColombiaIndiaCambodia Uganda   Uganda Rwanda Ethiopia  RwandaEthiopia  Kenya Papua New Guinea KenyaPapua New Guinea  Tanzania  Tanzania  "}],"sieverID":"28553360-0cda-47c3-8b9f-e0bddd66aa7e","abstract":""}

data/part_2/092027b34b21e72348b1fcf4f8527558.json

@@ -0,0 +1 @@
+{"metadata":{"id":"092027b34b21e72348b1fcf4f8527558","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a8d91843-69af-4314-9142-c91a4503eec3/retrieve"},"pageCount":2,"title":"Restoring Amazonia: Promoting Eco-Efficient Land Use Alternatives International Center for Tropical Agriculture (CIAT)","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":99,"text":"T he Amazon Basin, home to approximately half of the world's tropical forests and a quarter of global biodiversity, has experienced alarming rates of deforestation, land degradation, and loss of ecosystem services since the 1960s. These processes have largely been driven by unsustainable, low-productivity agriculture, which has left a legacy of persistent rural poverty and over 30 million hectares of abandoned or severely degraded land. The vast deforested and degraded regions of the Amazon are in great need of restoration by 'eco-efficient' land use alternatives that efficiently utilize resources to produce sustainable livelihood benefits while also providing environmental services."},{"index":2,"size":106,"text":"Promising examples of eco-efficient agriculture that have the potential to restore Amazonian landscapes include production systems such as improved fallows, multistory agroforestry systems, silvo-pastoral systems, and improved pastures. Although uptake of these strategies in the Amazon remains low, opportunities to promote these more sustainable land uses are quickly emerging, as concern for environmental issues increases, new markets for environmental services open up, consumer interest in niche and novel products rises, and market access improves. CIAT is working to improve the environmental and socioeconomic conditions in the Amazon by developing eco-efficient options for restoring degraded landscapes and by supporting the long-term success of these land use alternatives."}]},{"head":"Developing options for Amazonian restoration","index":2,"paragraphs":[{"index":1,"size":89,"text":"Measuring eco-efficiency and understanding its drivers Knowledge gaps regarding the conditions that lead to ecoefficiency, and systematic methods for measuring it, are major hurdles to the design and development of productive, sustainable Amazonian landscapes. CIAT has recently been working to resolve these research needs by analyzing how a wide range of socioeconomic, landscape, and biodiversity variables influence carbon sequestration, hydrological functioning, soil fertility, and agricultural production in the Amazon. This work has contributed to the development of practical methods for measuring eco-efficiency and guiding landscape restoration in the basin."}]},{"head":"Examining the connections between land use, soil functioning, and eco-efficiency","index":3,"paragraphs":[{"index":1,"size":83,"text":"Amazonian soils play a key role in influencing agricultural productivity and the provision of environmental services such as carbon sequestration and hydrologic functioning. Perhaps one of the greatest challenges to eco-efficient land use in the Amazon is the ease with which the region's soils are degraded by poor land management. CIAT's extensive experience in investigating the relationship between land use and soil functioning in the Amazon is a valuable asset for developing alternative land use options that address soil degradation in the region."}]},{"head":"Supporting the success of alternative production systems","index":4,"paragraphs":[{"index":1,"size":86,"text":"Optimizing production systems for today and tomorrow Eco-efficient agricultural systems in the Amazon often face biophysical constraints on production that limit their economic viability, and hence, adoption. In order to relieve these constraints, research must further the development of high-quality germplasm and methods for controlling pests and diseases. These research fields have been cornerstones of CIAT's activities since its establishment in 1967. The center's work in this area currently focuses on a number of the Amazon's most important crops (e.g., cassava, rice, forages, and tropical fruits)."},{"index":2,"size":125,"text":"While there is clearly great value in addressing the production constraints currently facing eco-efficient agricultural systems in the Amazon, it is becoming increasingly evident that the sustained productivity of these systems relies on their successful adaptation to the challenges of progressive climate change. CIAT is a global leader in anticipating the impacts that climate change will likely have on tropical agriculture and developing adaptation strategies to meet these challenges. This work is critical to ensuring that the eco-efficient land use alternatives promoted today will continue to thrive in the context of climate change. As the leading research center of the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS), CIAT is well positioned to expand the scope of these studies to the Amazon."}]},{"head":"Creating equitable and efficient value chains","index":5,"paragraphs":[{"index":1,"size":85,"text":"Another major limitation on the adoption of eco-efficient agricultural systems in the Amazon is the inefficiency of value chains, which limits the economic benefits that producers reap. For over a decade, CIAT has been using participatory methods to promote the development of technologies, business models, and policies that increase value chain efficiency and smallholder benefits. Although this work has been focused on regions of Latin America outside the Amazon Basin, CIAT plans to extend and apply its work on value chain efficiency to the Amazon."}]},{"head":"Conclusion","index":6,"paragraphs":[{"index":1,"size":115,"text":"Attention to the Amazon often focuses on the region's vast areas of intact forest, but it is important not to forget the landscapes on the other side of the forest frontier, the ones that deforestation has left in its wake. Approximately 40% of this land currently persists in an unproductive, degraded state that contributes little to economic development or environmental sustainability. Fortunately, this does not have to be the case. Economically, socially, and technologically feasible land use alternatives exist that can greatly increase the contributions that these lands make to local livelihoods and ecosystem services. CIAT sees great value in continuing and expanding its support of these options for the restoration of degraded Amazonian landscapes."}]}],"figures":[{"text":"  "}],"sieverID":"bc88a72c-15fc-4f2a-ba4b-624adb24f4cc","abstract":""}

data/part_2/09ae78e53e8b5220a0aa7d765a3d6d06.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09ae78e53e8b5220a0aa7d765a3d6d06","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d6c8fd5a-97e4-4ea1-99bf-c6f90344cc29/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":434,"text":"Pour bâtir des consensus et des décisions pertinentes et planifier les actions favorables au changement des mentalités, de comportement et d'éveil de conscience, les journalistes offrent indubitablement un avantage certain. On ne peut pas faire changer les mentalités et les comportements et éveiller la conscience des populations sans une touche d'information et de communication. Une option chère au Programme de Recherche sur les Changements Climatiques et la Sécurité Alimentaire (CCAFS) qui veut faire du développement durable la centralité de ses actions. Comme vous le savez le Programme de Recherche sur les Changements Climatiques et la Sécurité Alimentaire (CCAFS) fait la promotion du développement de l'agriculture intelligente face au climat, soutenue par une approche qui vise simultanément l'augmentation de la productivité, celle de la résilience des producteurs et la réduction des Gaz à Effet de Serre (REGES) . Les défis pour l'agriculture dans le cadre du changement climatique sont énormes. Face à ce constat, le Programme CCAFS a accéléré la cadence face à la mise en place dans ses zones d'intervention l'agriculture climato-intelligente en vue d'anticiper afin d'intégrer les paramètres de ces dérèglements ainsi que des transformations agricoles dans une perspective de développement durable. Au-delà le Programme CCAFS a mis en place des plateformes nationales déclinées en plateformes locales au niveau des pays d'intervention pour baliser le terrain d'accueil de ces mutations agricoles qui ne se feront pas sans des politiques publiques hardies et des mécanismes financiers innovants. C'est tout le sens de l'atelier qui a réuni à Dakar au Sénégal une vingtaine de participants journalistes internationaux, régionaux et nationaux, experts de l'Agence Nationale de l'Aviation Civile et de la Météorologie (ANACIM), des Chercheurs de l'Institut Sénégalais de Recherches Agricoles (ISRA), et des Techniciens du Ministère de l'agriculture et de l'équipement rural, et qui a permis de mettre ensemble ces acteurs qui travaillent dans le domaine des changements climatiques; ils ont échangé sur les notions de changements climatiques et sur les actions développées au Sénégal par le programme CCAFS. Les responsables du Programme CCAFS ont compris qu'avec le concours de la presse, la question des changements climatiques gagnera en acquis et en visibilité ; elle sera projetée au centre des préoccupations ; d'où l'intérêt de questionner l'efficacité des actions entreprises pour promouvoir la lutte contre les changements climatiques. C'est dans ce cadre que se justifie la formation reçue par les journalistes dont l'objectif est de faire en sorte qu'ils soient outillés afin de pouvoir porter le message et d'apporter à la COP 21 de Paris 2015 les preuves de cas de succès obtenus sur l'agriculture intelligente face au climat aussi bien au Sénégal qu'en Afrique.  "}]}],"figures":[{"text":" Que les journalistes puissent s'approprier du projet et d'assurer une large diffusion des informations climatiques. Cette approche communicationnelle et participative attendue des journalistes va jouer un rôle prépondérant voire capital pour développer les villages d'agriculture climato-intelligente issus des terroirs et des exploitations familiales. Pour cela il urge de faire en sorte que les informations scientifiques et techniques qui sont générées dans le cadre des villages d'agriculture intelligente face au climat puissent faire écho et être portées et aller loin jusqu'à influencer aussi bien les politiques les décideurs mais également les bénéficiaires finaux . Au cours de l'atelier les journalistes internationaux ont interagit avec les journalistes nationaux du Sénégal et d'Afrique et ont pu échanger autour des questions de l'information climatique son utilité au Sénégal pour avoir une perception commune de l'importance accordée à la lutte contre les changements climatiques et les mesures adaptatives et d'atténuation mises en place Les discussions qui en sont issues démontrent à suffisance que les journalistes doivent s'orienter d'avantage vers une information et une communication offensives pour la promotion de la lutte contre les effets néfastes des changements climatiques ; les africains doivent également apprendre de leurs confrères européens comment peuvent ils impacter leur participation aux conférences internationales à l'instar de la COP 21 qui s'annonce en décembre prochain et peser de tout leur poids dans la couverture des négociations Les solutions africaines existent l'exemple des Villages Intelligents en est la preuve réelle ; au Sénégal l'ISRA, l'ANACIM , le MAER et le Programme CCAFS sont entrain de développer au niveau du département de Kaffrine un modèle de village intelligent face au climat; cette notion est basée sur un certain nombre d'éléments notamment l'information locale le développement et l'utilisation des services climatiques le déve-loppement de raccourcis et de politiques intelligents face au climat et de notions de développement du futur village. De telles solutions doivent être portées à l'attention de la communauté internationale; et pour ce faire l'appui des médias est plus que nécessaire et toute forme confondue pour que ces derniers puissent s'approprier notamment le concept en lui-même mais également tous les produits qui en sont issus ;le climat pose des enjeux multiples et multiformes; beaucoup d'initiatives ont été entreprises par d'autres acteurs dont la mutualisation des moyens et la mise en synergie d'actions doivent être confortées pour mieux porter le plaidoyer africain basé sur des arguments solides Au sortir de l'atelier les journalistes ont tous témoigné de la bonne compréhension des meilleures pratiques en matière de reportage sur les changements climatiques et sur les voies et moyens d'améliorer la couverture à l'aide des ressources scientifiques en ligne et du concept de villages intelligents face au climat et l'impact des services d'information sur le climat au niveau local régional et mondial. Auparavant les participants ont suivi le panel sur l'utilisation de la science dans le rapportage sur les changements climatiques animé par des scientifiques expérimentés qui ont axé leurs interventions sur les meilleures pratiques et des écueils à éviter en matière de reportage sur les changements climatiques ;les participants se sont ensuite soumis à l'exercice d'exploration des outils en ligne pour les rédacteurs scientifiques avant de passer en revue les solutions relatives aux changements climatiques mettant en relief le concept de villages intelligents face au climat et le partage des expériences au Sénégal ;un panel suivi de discussion a mis fin à l'atelier ;une occasion où les experts en changements climatiques des différents secteurs au Sénégal notamment le ministère de l'agriculture et de l'équipement rural à travers la direction de l'agriculture, l'Agence Nationale de l'Aviation Civile et de la Météorologie, l'Union des Radios Associatives Communautaires qui ont discuté de l'impact des changements climatiques sur le Sénégal et de la manière dont le pays s'y adapte et des mesures d'atténuation de ses effets. Ainsi le CCAFS a compris que l'aboutissement de telles options relève d'un ensemble d'actions coordonnées entre les agriculteurs, les chercheurs et les journalistes pour non seulement réorienter l'agriculture mais aussi bénéficier de politiques endogènes soutenues de mécanismes financiers revisités.Babacar sene "},{"text":"Des Journalistes renforcent leurs capacités sur les changements climatiques Les médias sont potentiellement des instruments de changement social participatif et interactif Dr Robert ZOUMORE Coordinateur du Programme CCAFS PROGRAMME DE RECHERCHE SUR LES CHANGEMENTS CLIMATIQUES ET LA SÉCURITÉ ALIMENTAIRE (CLIMATE CHANGE AGRICULTURE AND FOOD SECURITY, CCAFS) de la Cop 21 de Paris 2015 et du concept de village intelligent, Dr ZOUMORE les lie au sens de la formation qui a pour objectif de faire en sorte que les journalistes soient outillés afin de pouvoir porter le message qui sera issu des villages AIC pour pouvoir apporter au COP et démontrer et montrer qu'il y a des cas de succès que ce soit pour le cas spécifique du Sénégal mais aussi d'autres options dans la sous-région . En ce qui concerne les Villages intelli- En ce qui concerne les Villages intelli- gents comme solution ou mesures gents comme solution ou mesures adaptatives face au climat, Dr Robert adaptatives face au climat, Dr Robert ZOUMORE considère que ces villages ZOUMORE considère que ces villages constituent des modèles de développe- constituent des modèles de développe- ment durable, mais aussi qui soient ment durable, mais aussi qui soient focalisés essentiellement sur l'utilisa- focalisés essentiellement sur l'utilisa- tion de l'information climatique pour tion de l'information climatique pour réunir toutes les autres actions de déve- réunir toutes les autres actions de déve- loppement et de protection de l'environ- loppement et de protection de l'environ- nement dans ces villages. Il considère nement dans ces villages. Il considère que ce qui est important dans ces que ce qui est important dans ces approches c'est aussi l'approche partici- approches c'est aussi l'approche partici- pative ; parce que c'est une approche pative ; parce que c'est une approche pour aussi bien les connaissances endo- pour aussi bien les connaissances endo- gènes qu'exogènes mises ensemble sur gènes qu'exogènes mises ensemble sur la table et décidées à la fin par les béné- la table et décidées à la fin par les béné- ficiaires finaux pour lesquels des ficiaires finaux pour lesquels des options technologiques sont destinées. options technologiques sont destin��es. S'agissant S'agissant  "}],"sieverID":"28f3f859-6c4e-4b01-82ca-5a7c107200fc","abstract":""}

data/part_2/0a65df829a28ae0c5092d401f6b833b6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a65df829a28ae0c5092d401f6b833b6","source":"gardian_index","url":"https://www.iwmi.cgiar.org/Publications/Water_Issue_Briefs/PDF/Water_Issue_Brief_5.pdf"},"pageCount":4,"title":"Different systems of water governance are required for different contexts and scales","keywords":["water governance / international waters Carolyn Fry","Writer; Mark Giordano","Theme Leader -Water and Society"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":18,"text":"It is often better to incorporate informal systems when reforming water governance programmes than to simply replace them."},{"index":2,"size":16,"text":"Governance of water resources spanning state or national boundaries needs particularly careful handling to avoid conflict."}]},{"head":"The context","index":2,"paragraphs":[{"index":1,"size":99,"text":"IWMI's analysis of water issues affecting the world's farmers in the book, Water for Food, Water for Life, cited poor governance as one reason for some forms of water scarcity. In calling for action to face the threat of a catastrophic water crisis, former UN Secretary General, Kofi Annan, said we must adopt a new spirit of stewardship. \"There must be solidarity in international and regional governance; there must be solidarity between sectors and stakeholders; and there must be political will amongst governments to work in good faith both with their neighbors and with their own people,\" he urged."}]},{"head":"SCIENCEBRIEFSERIES ISSuE 5","index":3,"paragraphs":[]},{"head":"IWMI's position on water governance","index":4,"paragraphs":[{"index":1,"size":234,"text":"What exactly is good governance of water? And how does one go about improving poor governance? These are questions that IWMI scientists are currently trying to answer through a variety of projects at scales from community and irrigation-system to river-basin and transboundary levels. For example, its project on Water Governance Benchmarking aims to analyze different forms of governance and provide benchmarks for understanding strengths and weaknesses. Ultimately, it aims to help countries assess how well societies are governing their water resources and, if need be, outline ways in which they can define, make and monitor improvements. \"Governance is the framework for the system that you operate in,\" explains Mark Giordano, Theme Leader of IWMI's research theme on Water and Society. \"However, many people confuse water governance and water management. For example, you might say that irrigation works well in a particular country because the system for managing it is effective. But if society placed a higher value on the water for another use -say, fisheries or hydropower -then continuing with 'effective' irrigation might be a mistake, so that's not good governance of water resources. At IWMI, our belief is that good governance requires a transparent system with mechanisms for broad participation, so that a diverse range of stakeholders contribute opinions. Basically, there must be a good process for determining where you want to go and then making inclusive decisions that will get you there.\""}]},{"head":"Action needed","index":5,"paragraphs":[{"index":1,"size":172,"text":"What is clear from IWMI's work in this field is that different systems of water governance are required for different contexts and scales. What works well at transboundary level might not be effective for managing water resources within a small community. Similarly, countries with a low level of economic prosperity and minimal water resources development require a different system of governance to those that are economically advanced with a high degree of water resources development. \"Consultants often take a model that works well in the developed world, where there are high levels of economic development and water resources development, and try to use it in the developing world,\" says Giordano. \"They then find it doesn't work within the developing world context.\" The Mekong River is an example of where such 'blueprints' of the developed world failed to deliver effective water governance in a developing world context at river-basin scale. For example, in a review Irrigation in Sri Lanka. Water runs along Mahabage Canal near Kitulgala, Sri Lanka (Photo Credit: Karen Conniff, IWMI)."}]},{"head":"WAtERISSuE","index":6,"paragraphs":[{"index":1,"size":191,"text":"of policies in six countries that rely on the Mekong River for water, IWMI found that Cambodia's draft water law was much more complex than it needed to be. The plan involved a system of water use licences, water resource monitoring and fees. However, levels of water abstraction were low, there were very few conflicts over water allocation and there were minimal hydrological measurements. The scientists also found that thorough and transparent cost-benefit analyses and environmental impact assessments were rarely undertaken in any of the Mekong countries. Water governance reforms are often unsuitable for the socioeconomic context at community scale too. Community-based water governance is often guided by a collection of informal institutional, socioeconomic and cultural arrangements that have developed over time. Often existing only in oral form, they have frequently been ignored when formal water governance reforms are made. However, IWMI research in Latin America, sub-Saharan Africa and Asia has shown that informal community-based water law can provide a system of governance that is just as effective as more formal systems. It is often better to incorporate such informal systems when reforming water governance programmes than to simply replace them."}]},{"head":"How IWMI can help","index":7,"paragraphs":[{"index":1,"size":172,"text":"Governance of water resources spanning state or national boundaries needs particularly careful handling to avoid conflict. When the Soviet Union broke up in 1990 its vast farms and irrigation systems became fragmented and chaotic. Since 2001, IWMI has worked in the Ferghana Valley, spanning Uzbekistan, Tajikistan and Kyrgyzstan, to reinstate systems of governance that promote efficient, equitable and sustainable use of water supplies. An assessment of the impact of the project showed that, in addition to improving water use, conflicts over water resources were eradicated. IWMI hopes to repeat this success with a programme planned to provide advice on water governance in the Krishna Basin, which spans the Indian states of Karnataka, Andhra Pradesh and Maharashtra in South India. Here, there is not enough water to meet the needs of all users and the environment, so effective governance is likely to focus on allocating water resources and formally valuing the environment as a water user in its own right. \"Successful water governance is about understanding what works where and why,\" says Giordano."},{"index":2,"size":15,"text":"Farmers planting onion seedlings on irrigated farm plots in Ethiopia (Photo Credit: Mastewal Degefa, IWMI)."}]}],"figures":[{"text":"  "},{"text":"  "}],"sieverID":"6e53f102-a4c2-4161-ba7a-a716c3e7aef5","abstract":"Putting Research Knowledge into Action"}

data/part_2/0aa7f3f5358747b458644a25f6ac5ecf.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0aa7f3f5358747b458644a25f6ac5ecf","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c64924b7-4e38-47e3-a3b9-a23f9f77b717/retrieve"},"pageCount":6,"title":"Buy Burkinabè! Yam Pukri's Agripol advocacy platform in Burkina Faso ICTs for agriculture CTA Technical Brief","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":65,"text":"women's rice-marketing cooperatives in Burkina Faso. Locally grown rice was slightly more expensive than imported grain, and big imports in the previous years meant that small-scale rice farmers and cooperatives were no longer able to sell their grain. Their national association, UNERIZ, was left with over 2,000 tonnes of unsold stock. Growers who had borrowed to invest in production were unable to repay their debts."},{"index":2,"size":68,"text":"A change in government policy to prioritise locally grown grain and to deter imports would help. But the Comité Interprofessionnel du Riz du Burkina, the group mandated to lobby on the growers' behalf, lacked the tools to put pressure on the government. So Agripol, a CTA-supported project run by Yam Pukri, stepped in to help. It used social media to call on people to choose locally grown rice."},{"index":3,"size":78,"text":"The campaign reached thousands. It created so much pressure on the government that the Prime Minister's office ordered public procurement to prioritise the local grain. Previously, only institutions had purchased only 16% of the national rice output; after the policy change the share rose to 30%, and the sellers were able to shift their excess stock. This story illustrates the approach used by Agripol, a CTA-financed pilot project that uses information and communication technologies to promote agricultural policy"}]},{"head":"The project","index":2,"paragraphs":[{"index":1,"size":10,"text":"Project holder Association Yam Pukri, agripol.faso-dev.net Application Agripol (lobbying website)"},{"index":2,"size":18,"text":"CTA project @gripol: Citizens' inquiry into the monitoring and implementation of agricultural policies through ICTs in Burkina Faso"}]},{"head":"Location Burkina Faso","index":3,"paragraphs":[{"index":1,"size":50,"text":"Clients Farmers' organizations, government, public Topic Developing electronic platforms to support advocacy for agriculture Project description Yam Pukri formed an alliance of producer organisations to strengthen their advocacy activities and internal management using electronic tools. It developed a website, trained staff on ICTs and advocacy, and provided backup and support."},{"index":2,"size":4,"text":"Where are the 10%?"},{"index":3,"size":45,"text":"The 2003 Maputo Declaration on Agriculture and Food Security in Africa commits signatory governments to spend at least 10% of their national budgets on agriculture and rural development. Burkina Faso has been a model pupil: it has surpassed this goal for the last 5 years."},{"index":4,"size":63,"text":"But has it made a difference on the ground? Rural producers still face the same problems: a lack of credit, a lack of inputs and poor access to local and foreign markets. Most of the 10% seems to go on the salaries and operational costs of the Ministry of Agriculture. Farmers and their organisations have little say in who the money is spent."}]},{"head":"The Agripol project","index":4,"paragraphs":[{"index":1,"size":32,"text":"A diagnostic study at the start of the project identified various clients: umbrella organizations, advocacy groups, farmers' organizations and the government. Each had a different reason to work with Agripol (see box)."},{"index":2,"size":33,"text":"The project has focused on three main types of activity: the development of the Agripol website to facilitate information exchange, training on ICTs and advocacy, and support for client organisations on these topics."}]},{"head":"The Agripol website","index":5,"paragraphs":[{"index":1,"size":62,"text":"Many agricultural organisations use mobile phones and perhaps email, but otherwise ignore the potential of ICTs for internal management, contact with members and external communication. If they have a website, they fail to maintain it, or it may fall victim to ageing software or a hacking attack. Many organisations also lack advocacy skills, so cannot effectively plead their case with the government."}]},{"head":"Project partners","index":6,"paragraphs":[{"index":1,"size":67,"text":"The Confédération Paysanne du Faso (CPF) is a confederation of 14 umbrella organizations covering various farming sectors. CPF acts as their voice in dealing with the government. It has been active since 2002, but much of its work has been one-time efforts and has not been documented or made available to members online. CPF saw in Agripol an opportunity to make its work more visible and accessible."},{"index":2,"size":45,"text":"The Comité Interprofessionnel du Riz du Burkina (CIRB) links actors in the rice value chain. It promotes the production, processing and consumption of this staple commodity. It uses classic advocacy methods such as billboards, but these are expensive and do not necessarily reach their target."},{"index":3,"size":62,"text":"The Réseau des Organisations Paysannes et de Producteurs de l'Afrique de l'Ouest (ROPPA) is a large organization working across West Africa on advocacy and advice to national groups. ROPPA has a long-standing collaboration with CTA, so the link with Agripol was able to build synergies with its activities. ROPPA was eager to work with Agripol to further a knowledge-management project it implements."},{"index":4,"size":50,"text":"The ICT and agriculture group within Burkina-ntic, a development portal devoted to Burkina Faso, includes ten rural development organizations that deal with advocacy in agriculture. This group is an integral part of Agripol: Yam Pukri coordinates Burkina-ntic, and the group's expertise in ICT and agriculture was vital to Agripol's work."},{"index":5,"size":37,"text":"The Réseau de Veille sur la Commercialisation des Céréales (RVCC) is a network of organisations and farmers' associations that monitors cereal marketing and does advocacy on related issues. This network wanted Agripol to build its ICT capacity."},{"index":6,"size":57,"text":"The Union Nationale des Mini Laiteries et des Producteurs Laitiers du Burkina (UNMLPL) brings together mini-dairies, milk producers and other stakeholders in the dairy industry. It is concerned with the organization of the milk sector, promotes milk consumption and is engaged in dairy policy. It was interested in innovative advocacy strategies and ways to influence the government."},{"index":7,"size":56,"text":"The Fédération des Unions de Groupements et Coopératives Maraîchères du Bam (FUGCOM-Bam) is a federation of market gardeners in Bam in north-central Burkina Faso. This group wanted to learn how to use modern communication techniques and wanted to promote its efforts to buy inputs for its members in bulk -a scheme that suffered from government indifference."},{"index":8,"size":17,"text":"The Ministry of Agriculture's Directorate-General for Rural Economy was interested in better identifying and targeting key issues."},{"index":9,"size":98,"text":"The Agripol website (agripol.faso-dev. net/) acts as a gateway to various types of agriculture-related information. It presents news related to agricultural policy, highlights the activities of farmers' organizations working on policy issues, and alerts visitors to innovative ICT services. It records current and past advocacy initiatives: an important resource for future work in organisations where staff turnover is high and institutional memories fade quickly. It contains a database of organisations and information resources relevant to the agriculture sector in Burkina Faso, making it possible for users to get in touch with each other and collaborate on joint concerns."},{"index":10,"size":25,"text":"The project operates two Facebook pages and has developed a mobile application to gather information about farmers' organisations and to act as a demonstration tool."}]},{"head":"Training on ICTs and advocacy","index":7,"paragraphs":[{"index":1,"size":10,"text":"The project created three training modules to overcome these barriers:"}]},{"head":"Data processing and computer security","index":8,"paragraphs":[{"index":1,"size":79,"text":"The use of social networks -such as how to create and maintain a Facebook page or blog and how to use them in advocacy Techniques and strategies for lobbying and advocacy. The project's technical team and the Ministry of Agriculture checked these modules, then used them in a series of four workshops attended by 100 agricultural trainers from the organisations listed in the box. These participants then went on to use the modules to train members of their organisations."}]},{"head":"Support on ICTs and advocacy","index":9,"paragraphs":[{"index":1,"size":40,"text":"Advocacy carries more weight if several organisations with similar views and interests work together. Bringing information from these organisations into a common platform reduces management and maintenance costs, helps maintain continuity and enables organisations to benefit from each other's initiatives."},{"index":2,"size":34,"text":"Training on ICTs and advocacy is not enough: the diagnostic study revealed that farmers' organisations also needed technical support and advice on these topics. The Agripol project has tried to do this. Some examples:"}]},{"head":"Agripol uses cartoons to carry its message","index":10,"paragraphs":[]},{"head":"Leveraging social media","index":11,"paragraphs":[{"index":1,"size":23,"text":"Agripol uses two Facebook pages to publicise its causes: facebook.com/Agripol-135010676574816/ with news on the Agripol project facebook.com/Burkinantic/ with updates on the Burkina-ntic group."},{"index":2,"size":64,"text":"It created a database where CPF can enter information on its constituent organisations, showing details such as their contact details, member numbers, activities, production area, etc. This helps CPF itself understand what each organisation is doing and enables them to coordinate activities and get in touch with them quickly. This database is being integrated into the CPF website, which Yam Pukri is building (cpf-bf.org)."},{"index":3,"size":25,"text":"Together with RVCC, it conducted a study of government funding for agriculture. This will help target the funding of farmers' organizations and of government contributions."},{"index":4,"size":99,"text":"It helped several of the client organisations to create two \"buy Burkinabè\" posters to promote local products, aimed at government agencies and professional associations and NGOs. They urge that half the food and drink budget at training courses and other events be spent on Burkinabè products. Over 100 trainings and workshops are held every day in Burkina Faso; many of the organisers advocate local products but do not buy them for their own events. Agripol planned to send postcards bearing the same message to government officials, but postponed this action because of political turmoil at the end of 2015."},{"index":5,"size":14,"text":"Agripol has made videos to support the advocacy work of both CPF and FUGCOM."}]},{"head":"Drawing on experience","index":12,"paragraphs":[{"index":1,"size":58,"text":"Agripol has drawn on the wealth of experience that Yam Pukri has gained over the years, including its work coordinating the Burkina-ntic network since 2002, in managing the national development portal (faso-dev. net) since 2006, a democracy project funded by the United Nations, and its experience with Web 2.0 and Social Media Learning Opportunities, a previous CTA-supported project."},{"index":2,"size":43,"text":"Yam Pukri relied on consultants to assist with one-off activities: the diagnostic survey and advocacy training. It used its own staff to develop the web platforms and mobile applications. That makes it possible to maintain and further develop these services in the future."},{"index":3,"size":140,"text":"Experimentation is an important part of Yam Pukri's strategy. It allows the organisation to find out what works and to build successful models that others can then replicate. The Agripol project has been an excellent example of this: it has enabled Yam Pukri to test the use of ICTs in agricultural advocacy. It has also led to deeper relationships with many of the partners. We have already described the work with RVCC (on government funding) and CPF (on its website and knowledge management) above. Yam Pukri also took part in the national farmers' day, a national meeting of UNMLPL (the dairy organisation) and the national week of the internet, all in 2015. Some organisations have replicated the project's activities, such the training courses on ICTs and advocacy. RVCC offered such a course for 30 of its members in June 2016."},{"index":4,"size":55,"text":"Other organisations have contacted Yam Pukri after visiting the Agripol website and asked for help in building their own sites. These include the Association Burkinabè d'Action Communautaire, which wanted a platform on the maize and soybean value chains (abac-bf.org/vacisbf/), and the Réseau Africain de l'Économie Sociale et Solidaire, which supports social projects across Africa (labo-raess.org)."},{"index":5,"size":22,"text":"Within Burkina Faso, the Ministry of Agriculture has begun to invite Yam Pukri to be involved in activities that involve new technologies."}]},{"head":"The Agripol website opens the door to agricultural advocacy in Burkina Faso","index":13,"paragraphs":[{"index":1,"size":2,"text":"Buy Burkinabè!"}]},{"head":"Sustaining the effort","index":14,"paragraphs":[{"index":1,"size":48,"text":"Some 60% of the Agripol project funds were spent on training and capacity building activities, 20% to develop the web platforms and mobile apps, and the remaining 20% for administration and telecommunications. Some 80% of the budget was supported by CTA, while Yam Pukri itself contributed the rest."},{"index":2,"size":46,"text":"Yam Pukri will continue to work on the Agripol website and incorporate it into the Burkina-Ntic portal. This has become the national portal for development issues, and is supported by the Bukinabè government as well as various donors, so it is not dependent on short-term funding."},{"index":3,"size":72,"text":"For Agripol to achieve wider recognition, it is necessary to continue investing in it and in associated activities, such as demonstrations, social networks, radio broadcasts and posters. Even though it does not generate funds directly, Agripol is an excellent advertisement for Yam Pukri's web-design and consulting services, for which it charges a fee. The demand for such services can be expected to rise as more organisations realise the need to get digital."},{"index":4,"size":29,"text":"Even as electronic communication reduces the distance between service policymakers, service providers, customers and producers, skilled humans are needed to design and develop the platforms that make this possible."},{"index":5,"size":35,"text":"Agripol has the potential to become a wider initiative that serves several countries. To achieve this, Yam Pukri faces the challenge of developing it further and making it more versatile. But each organization tends to "}]},{"head":"Business model","index":15,"paragraphs":[{"index":1,"size":103,"text":"Agripol is a platform that facilitates lobbying and advocacy of government, decision makers and the public  by farmers' organisations and others interested in agricultural development . Yam Pukri, which maintains the site, runs workshops and training courses  to help its clients gain lobbying skills and learn to use the information on the platform. Agripol lobbies via the website itself, as well as with posters, flyers, newspapers and The views expressed in this information product are those of the author(s) and do not necessarily reflect the views of CTA. This document has been produced with the financial assistance of the European Union."},{"index":2,"size":26,"text":"The contents of this document are the sole responsibility of CTA and can under no circumstances be regarded as reflecting the position of the European Union."},{"index":3,"size":2,"text":"Buy Burkinabè!"}]},{"head":"About the series","index":16,"paragraphs":[{"index":1,"size":86,"text":"CTA Technical Briefs document experience and learning in topical issues of interest to the ACP agricultural development community. They are intended as a practical guide for people involved in an issue professionally or for people with a strong interest in the topic. Photo credits: Yam Pukri want its own platform rather using one that already exists. It is necessary to find ways for platforms to relate to and complement each other, and to find ways to continue to maintain them after the end of project funding."}]},{"head":"Sheets in this series","index":17,"paragraphs":[{"index":1,"size":75,"text":"Finally, organisations that promote information technology must devote a lot of time to understand the needs of their clients and to make sure that the solutions proposed actually take these into account. Many clients show a lot of enthusiasm for ICTs at the start, but over time revert to the old methods of information management. A tool that properly fills a need will avoid this problem by becoming a vital part of the organisation's work."},{"index":2,"size":10,"text":"Poster calling on the government and NGOs to buy Burkinabè"}]}],"figures":[{"text":" video . Activities to provide these services have included developing and maintain the website, training the client organisations on information technology, and support on advocacy . The key resources have been staff skills and data . Major partners are the Ministry of Agriculture (which is itself a target of lobbying), research institutes, and civil society . Most of the income has come from a development organisation (CTA) ; the biggest costs have been training and the development of the app . "},{"text":"6 Paul Mundy, Benjamin Kwasi Addom and Krishan Bheenick. Beyond the hype: Mobile phones and the web to improve agricultural value chains. 7 Solomon Elorm Allavi and Mary Coleman. Where, exactly, is your farm? Syecomp's eFARMS farmmapping service in Ghana. 8 Remco Dost and Amgad Khalifa. Water next Tuesday: eLEAF's irrigation-advice service in the Gezira Scheme in Sudan. 9 Julien Gonnet and Sékongo Soungari. Cashew on your phone: N'kalô: RONGEAD's market-advice app in West Africa. 10 Kim Ingrid Mallalieu and Amanda Suraj. An app for fishers: The University of the West Indies' multifunctional mFisheries app. 11 Sylvestre Ouédraogo and Théophile Assane Sawadogo. Buy Burkinabè! Yam Pukri's Agripol advocacy platform in Burkina Faso. 12 Gerald Otim and Alfred Tokwiny. Learning to pay by phone: MOBIS, Ensibuuko's mobile-money app in Uganda. 13 Patrick Sakyi and Mohammed Abdul-Fatawu. Advice on beans: Farmerline's Mergdata farm-advice service in Ghana. Technical Centre for Agricultural and Rural Cooperation P.O. Box 380 -6700 AJ Wageningen -The Netherlands Tel: +31 (0) 317 467 100 | E-mail: [email protected] | www.cta.int Authors: Sylvestre Ouédraogo 1 and Théophile Assane Sawadogo 2 1 Association Yam Pukri, 2 Fédération des Unions et Groupements et Coopératives Maraichers du Bam "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"6a72bf15-b09a-47ab-b1c3-eaa0ffeb6fe5","abstract":"T he 2014-15 season was a difficult one for advocacy. Yam Pukri, which manages the Agripol initiative, is an association specialising on training, information and advice on information and communication technologies. Founded in 1998, it works mainly in Burkina Faso, but since 2000 has also launched initiatives in Mali and Niger."}

data/part_2/0aeea8c56f92224c9965ce2542f081c3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0aeea8c56f92224c9965ce2542f081c3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b1418e5e-cd39-40f5-8623-0df2e40106bb/retrieve"},"pageCount":23,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":8,"text":"The idea… to treat not to treat OR"}]},{"head":"The idea…","index":2,"paragraphs":[{"index":1,"size":28,"text":"Today, sick animals are often treated with antimicrobials, regardless of the cause of disease. A diagnostic that differentiates between viral and bacterial infections could potentially reduce this overuse."}]},{"head":"to treat not to treat OR","index":3,"paragraphs":[]},{"head":"The idea…","index":4,"paragraphs":[{"index":1,"size":20,"text":"To test the possibility of developing an easy-to-use and cheap diagnostic test that can differentiate between bacterial and viral infections."}]},{"head":"Bacterial and viral infections typically induce slightly different responses in the hosts","index":5,"paragraphs":[{"index":1,"size":18,"text":"We are testing the possibility of using these host markers to develop a quick and easy-to-use field test."},{"index":2,"size":12,"text":"This may reduce the use of antibiotics to animals infected with viruses."}]},{"head":"to treat not to treat OR","index":6,"paragraphs":[{"index":1,"size":7,"text":"Responses induced by pathogen associated molecular patterns  "}]},{"head":"Pathways upregulated in the studies","index":7,"paragraphs":[{"index":1,"size":2,"text":"The analysis"}]},{"head":"Clean and merge data from all selected studies","index":8,"paragraphs":[{"index":1,"size":27,"text":"ØThere are many gaps in the data, e.g there are no genes where we have data from all pathogen infections. ØDifferent methods used for measuring gene expression "}]},{"head":"Identify genes with similar expression profiles by clustering","index":9,"paragraphs":[]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Infection of dendritic cells and monocytes with S. suis and PRRSV. Final datasets chosen for comparison Genes UR by bacterial infection in at least 2 studies Genes UR by viral infection in at least 2 studies What's next? Final datasets chosen for comparison Genes UR by bacterial infection in at least 2 studies Genes UR by viral infection in at least 2 studies What's next? Function SYMBOL Gene description FunctionSYMBOLGene description Ø UR in viral-infected but DR in bacterial-infected Ø UR in bacterial-infected but DR in viral-infected 1. Microarray datasets 1. Dang et al., 2014 o Infection with H1N1, Streptococcus suis, and co-infection with both in porcine tracheal epithelial cells SLC2A1 Solute carrier family 2 (facilitated glucose transporter), member 1 Cytokines, chemokines, and related receptors CSF2 colony stimulating factor 2 SPP1 Secreted phosphoprotein 1 Lipid metabolism LDLR Defence response MX2 myxovirus (influenza virus) resistance 2 (mouse) Low density lipoprotein receptor IFNB1 interferon beta 1 Cytoskeleton/actin rearrangement TMOD4 tropomodulin 4 RSAD2 radical S-adenosyl methionine domain containing 2 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 MX1 MX dynamin like GTPase 1 BRSV cattle 54 RNAlater • Transfer to penside format AFS pigs 17 5 RNAlater • Expand to other livestock CBPP cattle 31 9 RNAlater Long term: CCPP goats 40 28 paxgene 2. Lin et al., 2015 Function SYMBOL Gene description Biological and metabolic processes HK2 Hexokinase 2 PLAT plasminogen activator, tissue Biological & metabolic processes USP18 ubiquitin specific peptidase 18 ZBP1 Z-DNA binding protein 1 BCR Cytokine signalling EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 TRIM21 tripartite motif containing 21 Cytokines, chemokines, & related receptors CCL4 C-C motif chemokine ligand 4 TNFSF10 TNF superfamily member 10 CBPP cattle 15 15 paxgene • Collect more samples disease species healthy disease (full blood) • Test more biomarkers sample type BCR activator of RhoGEF and GTPase Short term: Samples collected for future use Ø UR in viral-infected but DR in bacterial-infected Ø UR in bacterial-infected but DR in viral-infected 1. Microarray datasets 1. Dang et al., 2014 o Infection with H1N1, Streptococcus suis, and co-infection with both in porcine tracheal epithelial cells SLC2A1 Solute carrier family 2 (facilitated glucose transporter), member 1 Cytokines, chemokines, and related receptors CSF2 colony stimulating factor 2 SPP1 Secreted phosphoprotein 1 Lipid metabolism LDLR Defence response MX2 myxovirus (influenza virus) resistance 2 (mouse) Low density lipoprotein receptor IFNB1 interferon beta 1 Cytoskeleton/actin rearrangement TMOD4 tropomodulin 4 RSAD2 radical S-adenosyl methionine domain containing 2 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 MX1 MX dynamin like GTPase 1 BRSV cattle 54 RNAlater • Transfer to penside format AFS pigs 17 5 RNAlater • Expand to other livestock CBPP cattle 31 9 RNAlater Long term: CCPP goats 40 28 paxgene 2. Lin et al., 2015 Function SYMBOL Gene description Biological and metabolic processes HK2 Hexokinase 2 PLAT plasminogen activator, tissue Biological & metabolic processes USP18 ubiquitin specific peptidase 18 ZBP1 Z-DNA binding protein 1 BCR Cytokine signalling EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 TRIM21 tripartite motif containing 21 Cytokines, chemokines, & related receptors CCL4 C-C motif chemokine ligand 4 TNFSF10 TNF superfamily member 10 CBPP cattle 15 15 paxgene • Collect more samples disease species healthy disease (full blood) • Test more biomarkers sample type BCR activator of RhoGEF and GTPase Short term: Samples collected for future use Transcriptional and translational regulation DDX58 AGO2 OAS2 DExD/H-box helicase 58 argonaute RISC catalytic component 2 2'-5'-oligoadenylate synthetase 2 Transcriptional and translational regulationDDX58 AGO2 OAS2DExD/H-box helicase 58 argonaute RISC catalytic component 2 2'-5'-oligoadenylate synthetase 2  GBP1 guanylate binding protein 1, interferon-inducible GBP1guanylate binding protein 1, interferon-inducible  IFIH1 interferon induced with helicase C domain 1 IFIH1interferon induced with helicase C domain 1 Transcriptional & translational regulation PARP12 PARP14 poly(ADP-ribose) polymerase family member 12 poly(ADP-ribose) polymerase family member 14 Transcriptional & translational regulationPARP12 PARP14poly(ADP-ribose) polymerase family member 12 poly(ADP-ribose) polymerase family member 14  "}],"sieverID":"c1c91f24-7e57-4831-a736-6d02eb34e197","abstract":""}

data/part_2/0b91447ff761ccf857f36bb2cdfbed40.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b91447ff761ccf857f36bb2cdfbed40","source":"gardian_index","url":"http://www.mag.go.cr/rev_meso/v06n01_050.pdf"},"pageCount":11,"title":"INTERACCION ENTRE GENOTIPOS DE FRIJOL Y AISLAMIENTO DE Rhizoctonia solani KUHN. HEREDABILIDAD DE LA RESISTENCIA A LA MUSTIA HILACHOSA Thanatephorus cucumeris (FRANK) (DONK) EN CULTIVARES Y POBLACIONES F 1 Y F 2 DE FRIJOL COMÚN Phaseolus vulgaris L. 1","keywords":[],"chapters":[{"head":"RESUMEN","index":1,"paragraphs":[{"index":1,"size":289,"text":"Interacción entre genotipos de frijol y aislamiento de Rhizoctonia solani Kuhn. heredabilidad de la resistencia a la mustia hilachosa Thanatephorus cucumeris (Frank) (Donk) en cuItivares y poblaciones F, y F2 de frijol común Phaseolus vulgaris L. Se inocularon genotipos mesoamericanos y andinos de frijol común con micelio de Thanalephorus cucumeris (Frank), Donk, con el objeto de determinar: l. La interacción entre diferentes aislamientos de Rhizoclonia solani, Kuhn y genotipos de frijol de dos acervos genéticos diferentes; 2. La heredabilidad de la resistencia a la mustia hilachosa; 3. La complementación génica que existe entre el acervo mesoamericano y andino respectivamente. Los resultados encontrados en el presente estudio fueron los siguientes: Las cepas varían dependiendo de su lugar de origen. Así las cepas de Colombia y República Dominicana causan el menor daño a las plantas de frijol, el aislamiento Panamá #1 es moderadamente lento y los de Panamá #2 y Costa Rica son los que mayor daño cau-san a este cultivo. La cepa RS-32-Cr resultó ser la más virulenta de todas. La heredabilidad mostrada por los cruzamientos fue alta, lo que nos indica que si existe complementación génica entre el acervo mesoamericano y andino respectivamente. El cruzamiento AFR-251 x BAT-1155, en forma directa y recíproca, mostraron diferencias tanto en la F 1 como en la F 2 lo que nos indica que la resistencia a la enfermedad está controlada tanto por gcnes del citoplasma corno por genes del núcleo. El tipo de resistencia que mostraron los diferentes cruzamientos evaluados fue el de resistencia horizontal y no el de resistencia vertical. común, por la defoliación rápida y drástica que causa a las plantas afectadas, provocando en la mayoría de los casos pérdida total de la cosecha (Gálvez et al., 1980;Rodríguez, E., 1993)."},{"index":2,"size":129,"text":"Los síntomas de la enfermedad son manchas acuosas de 1-3 mm de diámetro. A medida que las manchas crecen, su color se torna más claro que el tejido sano circundante, hasta tomar una coloración café delimitada por un borde más oscuro. Posteriormente las lesiones coalescen pudiendo cubrir la totalidad de la hoja, dando la apariencia de haber sufrido escaldaduras por agua caliente. En las vainas la infección se manifiesta como manchas de forma irregular, de color café a negro, las cuales pueden causar la destrucción total de la vaina. Sobre el tejido enfermo se producen esclerocios y basidiosporas, aparentemente la producción de uno u otro tipo de propágulo depende de las condiciones ambientales predominantes, como son: la precipitación, humedad relativa, humedad en el suelo y temperatura (Rodríguez, E., 1993)."},{"index":3,"size":97,"text":"En la actualidad, la enfermedad se encuentra en todos los países de América Tropical y se indica como una de las principales limitantes en la región Amazónica de Brasil, el sureste de México y la región de Africa Oriental. En algunos países la mustia adquiere cada día mayor importancia económica debido al desplazamiento del cultivo del frijol a las zonas bajas húmedas, en donde la enfermedad se ve favorecida por lluvias intensas y temperaturas altas. En algunas regiones de Centroamérica, el cultivo del frijol ha sido abandonado debido a la severidad de la enfermedad (Rodríguez, E., 1993)."},{"index":4,"size":62,"text":"Incorporar resistencia genética a líneas y cultivares de frijol, con el cual se abata el patógeno, es un componente importante en el control de esta enfermedad, pero no se ha podido avanzar con rapidez. La capacidad de adaptación del patógeno y el gran número de hospederos son las principales razones que han hecho difícil encontrar resistencia a este patógeno (Acosta, 1988;Rodríguez, 1992)."},{"index":5,"size":90,"text":"Se tenían muchas dudas de la posibilidad de aumentar la resistencia a este patógeno hasta que se evaluó el EP (Ensayo Preliminar) del CIAT en 1981. En este vivero, se pudo observar variabilidad amplia y consistente, y en particular unas líneas que tenían como progenitor a Turrialba. A partir de este año el número de cruzas aumentó, con el propósito de encontrar resistencia superior a través de segregación transgresiva. Así se pudo demostrar una amplia ventaja de la cruza HT -7716, sobre el testigo \"resistente\" Porrillo 70 (Beebe, 1986;Rodríguez, 1992)."},{"index":6,"size":72,"text":"En la evaluación del Vivero Internacional de Mustia 1988, compuesto por 100 líneas, ninguna superó significativamente la resistencia de Talamanca, testigo que ha sido utilizado desde 1983, lo que sugiere que los intentos por mejorar el nivel de resistencia a mustia, hasta esta fecha, no han tenido éxito; probablemente por la estrecha variabilidad genética del germoplasma utilizado y por la ineficiencia de las evaluaciones de campo para tamizar poblaciones numerosas (Rodríguez, 1992)."},{"index":7,"size":68,"text":"Desde la creación del VIM se han detectado algunos genotipos de frijol que reaccionan como muy susceptibles en ciertos países, mientras que en otros presentan un alto grado de resistencia a la enfermedad. Una de las hipótesis para explicar esta diferencia es que en los países en que se siembra el VIM, existen poblaciones de R. solani más compatibles con unas variedades que con otras (Frías 1991;Rodríguez, 1992)."},{"index":8,"size":82,"text":"Los resultados encontrados en el estudio de la variabilidad patogénica de Thanatephorus cucumeris = Rhizoctonia solani, agente causal de la mustia hilachosa del frijol sugieren que la reacción de una variedad puede variar de un lugar dependiendo de la población del patógeno en la región donde se evalúa el material. Esto y el efecto que la precipitación tiene en la reacción de la resistencia deberán se considerados en los esquemas de mejoramiento genético de la resistencia a la mustia hilachosa (Rodríguez, 1993)."},{"index":9,"size":95,"text":"En evaluaciones de germoplasma promisorio, proveniente de CIAT, realizadas en Panamá durante los años 1988, 1989 y 1990 se han tamizado más de 1500 líneas. Encontrándose que los materiales AFR-251 y PVA-800 han mostrado reacción de resistencia a la mustia hilachosa con un porcentaje de severidad de 5 y 15 porciento respectivamente. El rendimiento obtenido para estos cul-tivares ha sido de 2,751 y 1591 kg .respecti vamente, mientras que el testigo local (Var. Barriles) mostró hasta 100 por ciento de severidad y rendimiento desde O kg/ha hasta 468 kg/ha (Rodríguez y González, 1988, 1989Y 1990)."},{"index":10,"size":177,"text":"Los objetivos de este trabajo fueron: 1. Determinar la interacción existente entre diferentes aislamientos de Rhizoctonia solani, Kuhn y genotipos de frijol de dos acervos genéticos diferentes, 2. Determinar la heredabilidad de la resistencia a la mustia hilachosa encontrada en dos cultivares de frijol de diferente origen, producto de cruzamientos realizados con materiales intermedios y susceptibles a la enfermedad, 3. Determinar los efectos de complementación génica que existe entre el acervo mesoamericano y andino respectivamente, y las siguientes hipótesis: 1. Los aislamientos de Rhizoctonia solani obtenidos en cuatro países de la región de Centroamérica y el Caribe ocasionan igual efecto en los cultivares de frijol independientemente del origen de los mismos, 2. La heredabilidad de la resistencia a la mustia hilachosa está dada por genes de herencia simple que pueden ser transmitidos a variedades susceptibles e intermedias que actualmente se cultivan en áreas frijoleras de la región de Centroamérica y el Caribe, 3. Las líneas obtenidas de progenitores resistentes de origen Mesoamericano poseen los mismos genes de resistencia que las obtenidas de progenitores resistentes de origen Andino."}]},{"head":"MATERIALES Y METODOS Ubicación","index":2,"paragraphs":[{"index":1,"size":56,"text":"El presente trabajo se llevó a cabo en las instalaciones de la Universidad Autónoma Agraria \"Antonio Narro\" (UAAAN) ubicada en Buenavista, Saltillo, Coahuila, México. Se encuentra entre las coordenadas geográficas 25°23' de latitud norte y 101°03' de longitud oeste, con una altitud de 1743 msnm, temperatura promedio anual de 16,7°C y precipitación anual de 459 mm."}]},{"head":"Material Genético a Evaluar","index":3,"paragraphs":[{"index":1,"size":40,"text":"En el experimento número uno, donde se determinó la interacción existente entre aislamientos de Rhizoctonia solani, Kuhn y genotipos de frijol de dos acervos genéticos diferentes, se evaluaron las variedades y poblaciones F) que se muestran en el Cuadro l."},{"index":2,"size":25,"text":"Para el experimento número dos, donde se midió la heredabilidad a la mustia hilachosa, se utilizaron los cultivares que se observan en el Cuadro 2."},{"index":3,"size":23,"text":"Para el experimento tres, donde se midieron los efectos de complementación génica, se utilizaron los cultivares que se presentan en el Cuadro 3."},{"index":4,"size":44,"text":"En las instalaciones de CIAT, Cali, Colombia, se procedió a realizar los cruzamientos combinando materiales de diferente origen y de diferente reacción ante el ataque del patógeno, así como también cruzamientos de materiales del mismo origen con diferente grado de reacción a la enfermedad."},{"index":5,"size":26,"text":"Posteriormente en la UAAAN, en las instalaciones del programa de frijol, se realizó el avance generacional de dichas plantas hasta alcanzar las poblaciones F 2 ."}]},{"head":"Evaluación de la Severidad de la Enfermedad","index":4,"paragraphs":[{"index":1,"size":43,"text":"Se utilizó la escala internacional de evaluación de mustia propuesta por el grupo de mejoradores que trabajan en busca de la resistencia genética a la mustia hilachosa y la cual fue aceptada por el CIAT y que se encuentra en el Cuadro 4."},{"index":2,"size":69,"text":"Se estimó visualmente el area foliar en cada hoja que fue afectada por el patógeno, dicho daño fue expresado en porcentaje el cual fue transformado a una variable no paramétrica para el caso del experimento uno, mientras que para el experimento dos y tres los datos fueron transformados a través de seno 1 √/100 * 57,2958 y el análisis de varianza fue realizado a través del programa de SAS."},{"index":3,"size":24,"text":"Las evaluaciones de la enfermedad fueron realizadas hasta que alguno de los tratamientos alcanzara el 100 por ciento de tejido afectado por la enfermedad."}]},{"head":"Diseño experimental y modelo genético","index":5,"paragraphs":[{"index":1,"size":17,"text":"El diseño experimental a utilizar en los tres experimentos fue el completamente al azar con cuatro repeticiones."},{"index":2,"size":18,"text":"Los modelos genéticos que se usaron para los experimento dos y tres se presentan en el Cuadro 5."}]},{"head":"RESULTADOS Y DISCUSIÓN Interacción aislamiento x cultivar","index":6,"paragraphs":[{"index":1,"size":45,"text":"Como se observa en el Cuadro 6 existió un efecto altamente significativo para cepa, cultivares y para la interacción cultivar x cepa. Es importante observar que la interacción cultivar x cepa fue altamente significativa, por lo que realizó una prueba de Duncan a los datos."},{"index":2,"size":15,"text":"Al realizar el análisis de Duncan correspondiente a este experimento se encontraron los siguientes resultados:"},{"index":3,"size":73,"text":"Como se observa en el Cuadro 7 las cepas son diferentes unas de otras dependiendo del lugar donde fueron colectadas. Se manifestaron de la siguiente manera: las cepas colectadas en Colombia y República Dominicana fueron los de menor virulenta para atacar el cultivo de frijol, la cepa Panamá 1 fue de colonización intermedia y las cepas Panamá 2 y la de Costa Rica las de mayor severidad al atacar los cultivares de frijol."},{"index":4,"size":67,"text":"La interacción entre los aislamientos y los cultivares de frijol se manifestó al analizar la población FI de AFR-251 x PVA-800 donde se encontraron seis grupos diferentes para los aislamientos de R. solani. Por otro lado al observar el comportamiento del cultivar BAT-1155 se forman tres grupos el Duncan, sin embargo, genotipo no se conserva el orden esperado para los aislamientos La heredabilidad se calculó como sigue:"},{"index":5,"size":55,"text":"G 2 p = G 2 + G 2 g r siendo el de menor virulencia el RS-5-COL y el de mayor ataque la Panamá #2. De igual manera varía el cultivar AFR-25I donde se manifiesta el aislamiento RS-5-COL como el de menor ataque y los de mayor virulencia los aislamientos Panamá #2 y RS-32-CR."},{"index":6,"size":69,"text":"Hubo interacción significativa, esto indica que los datos que se obtengan en evaluaciones de ensayos y/o viveros en estos lugares no deben ser combinados, debido a que la virulencia de los aislamientos varía de acuerdo a la localidad. Esto sugiere manejar la información de acuerdo a la virulencia del aislamiento. La información que se obtenga al realizar estas evaluaciones deberá ser manejada independientemente para evitar errores en su interpretación."},{"index":7,"size":106,"text":"Por otro lado como era de esperarse, los cultivares utilizados en esta evaluación manifestaron diferentes grados de reacción ante el ataque del patógeno. Así con las cepas RS-93-COL manifestaron su menor severidad con las poblaciones F 1 , BAT-1155 X PVA-800 (R) y AFR-25I X BA T-1155; con la cepa RS-10-RD fue la población BA T-1155 X FR-251 (R) la que mostró severidad menor ante el ataque del patógeno; para las cepas Panamá 1 y Panamá 2 fueron los cultivares PVA-800 y AFR-25I, mientras que para la cepa RS-32-CR fue la población F 1 de PVA-800 x bat-1155 en la que causó menor daño el patógeno."},{"index":8,"size":104,"text":"Por otro lado como era de esperarse, los cultivares utilizados en esta evaluación manifestaron diferentes grados de reacción ante el ataque del patógeno. Así con las cepas RS-93-COL manifestaron su menor severidad con las poblaciones F 1 , BAT-1155 X PVA-800 (R) y AFR-251X BA T-1155; con la cepa RS-10-RD fue la población BAT-1155 X FR-251 (R) la que mostró severidad menor ante el ataque del patógeno; para las cepas Panamá 1 y Panamá 2 fueron los cultivares PVA-800 y AFR-251, mientras que para la cepa RS-32-CR fue la población F 1 de PVA-800 x bat-1155 en la que causó menor daño el patógeno."}]},{"head":"Heredabilidad y complementación génica","index":7,"paragraphs":[{"index":1,"size":54,"text":"Para el análisis de varianza de los datos utilizados para estimar la heredabilidad en sentido amplio y la complementación génica existente entre el acervo genético mesoamericano y andino se utilizó la transformación del arco seno ya que por regla general, los datos en porcentaje tienen una distribución binomial en vez de una distribución normal."},{"index":2,"size":12,"text":"Esta transformación se hizo mediante la fórmula: seno -1 x/100 * 57,2958."},{"index":3,"size":142,"text":"Al realizar el análisis de varianza de la F 2 en la cruza número uno, es decir PVA-800 x BAT-1155 en forma directa y recíproca, donde se evaluaron ambos progenitores así como la F 1 y F 2 de ambos cruzamientos, se obtuvo una heredabilidad de 85,62% y 91,22% respectivamente; estos resultados indican que este caracter, resistencia a la enfermedad, es de alta heredabilidad para esta cruza. Sin embargo, Kornegay (1988) señala que aunque la evidencia empírica de los viveros de mejoramiento sugiere que la resistencia al añublo de Ascochyta, al mosaico dorado del frijol, a la mustia hilachosa, a los barrenadores de vainas (Apion spp), a la mosca africana, así como la fijación de nitrógeno en el frijol y los mecanismos genéticos de tolerancia a la sequía también pueden ser controlados poligénicamente con niveles de bajos a moderadamente altos de heredabilidad."},{"index":4,"size":22,"text":"Por otro lado también Agrios (1985) señala que los caracteres de alta heredabilidad están basados en genes mayores, es decir resistencia cualitativa."},{"index":5,"size":80,"text":"Sin embargo, la alta heredabilidad del caracter para esta cruza se debe básicamente a los genes de resistencia existentes que al unirse dan un alto grado de resistencia en algunas plantas de la población F 2 ; este efecto que causan ambos acervos genéticos es el que se llama complementación génica o segregación transgresiva puesto que existe descendencia que supera a ambos progenitores y es esta descendencia la que hace que la heredabilidad se manifieste como alta para este cruzamiento."},{"index":6,"size":42,"text":"Estos datos se encuentran en los Cuadro 8 y 9 donde se muestran el análisis de varianza para ambas cruzas así como el cálculo de varianza genética (G 2 g), la varianza fenotípica (G 2 p) y de heredabilidad (h 2 )."},{"index":7,"size":94,"text":"Para el cruzamiento número dos, AFR-251 x BAT-1155 en forma directa y recíproca se encontró una heredabilidad de 94,53% y de 87,79 por ciento respectivamente indicando que en este cruzamiento la heredabilidad es alta para el caracter bajo estudio. En este caso nuevamente se manifiesta el efecto de complementación génica existente para estos acervos genéticos ya que el AFR-251 ha sido considerado como resistente y el BAT-1155 como susceptible en las mismas pruebas realizadas, con anterioridad, por lo que se asume que los genes de resistencia que po-seen ambos progenitores son diferentes y complementarios."},{"index":8,"size":278,"text":"Por otro lado si se comparan los cruzamientos de BAT-1155 x AFR-251 y AFR-251 x BAT-1155 (R); en el primer caso existieron un total de 8 plantas F 2 por debajo del 10 por ciento de severidad de la enfermedad, 7 plantas entre 10 y 20 por ciento, 14 plantas entre 20 y 30 por ciento, 12 plantas entre 30,1 y 40 por ciento, 11 plantas entre 40,1 y 50 por ciento, 20 plantas entre 50,1 y 60 por ciento, 10 plantas entre 60,1 y 70 por ciento, ocho plantas entre 70,1 y 80 por ciento, 13 plantas entre 80,1 y 90 por ciento y dos plantas entre 90,1 y 100 por ciento. Mientras que para el cruzamiento de AFR-251 x BAT-1155(R) se encontraron 72 plantas F 2 con el porcentaje de severidad menor del 10 por ciento, 17 plantas F 2 entre 10,1 y 20 por ciento, cinco plantas entre 20,1 y 30 por ciento, una planta entre 30, l y 40 por ciento y tres plantas entre 60, 1 y 70 por ciento de severidad. Lo que indica que existen diferencias entre la cruza directa y recíproca, al comparar la severidad promedio en las F 1 de los cruzamientos directos y recíprocos (29,36 y 74,66 por ciento respectivamente) Pudo determinarse que no solamente existen genes del núcleo que influyendo en la resistencia sino genes del núcleo tienen que ver con esta resistencia. Son precisamente los genes del citoplasma aportados por AFR-251, los que están influyendo para que esta diferencia ocurra. Por lo tanto, este fue un cruzamiento que presenta alta heredabilidad, existe complementación génica entre ambos acervos genéticos y existen efectos citoplásmieos por parte de AFR-251."},{"index":9,"size":262,"text":"Si fuera posible graficar el comportamiento de los cruzamientos AFR-251 x BAT-1155 y AFR-251 x PVA-800 y suponer, de acuerdo a la distribución de frecuencias, que el caracter de resistencia está controlado por genes dominantes. Sin embargo, al observar el cruzamiento recíproco de BAT-1155 x AFR-251 se obtuvo una distribución de frecuencia que tiende a ser normal; este concepto reafirma aún más el hecho de que son genes del citoplasma aportados por AFR-251 los que hacen que la curva se comporte de esta manera. Para el cruzamiento número tres, AFR-25l X PVA-800 se obtuvo un valor de heredabilidad de 90,15 por ciento, el que se considera alto para este caracter (Cuadro 12). Al realizar una distribución de frecuencias se puede distinguir que existen 72 genotipos con un valor menor a 10% de severidad, siete genotipos con un porcentaje menor a 20 por ciento, un genotipo entre 20 y 30 por ciento, un genotipo entre 30 y 40 por ciento y un genotipo con un valor mayor al 40 por ciento; lamentablemente no se contaba con el cruzamiento recíproco de esta cruza para ver el efecto citoplasmático que origina el cultivar AFR-251. Para este cruzamiento el alto valor de heredabilidad obtenido se debe nuevamente a la complementación génica que existe entre los acervos mesoamericano y andino. Cabe señalar que las reacciones de resistencia estuvieron dados por la hipersensibilidad que se manifestó como un amarillamiento que varió de lento a rápido en las hojas inoculadas con el patógeno, así como también se observaron reacciones de necrosis vascular que también fueron llamadas reacciones de hipersensibilidad."},{"index":10,"size":94,"text":"Para el cruzamiento número cuatro, donde se cruzó PV A-800 X ICA-15399 (D), nuevamente se observó un porcentaje de heredabilidad de 89,34 por ciento el que al igual a los anteriores fue considerado como alto para el caracter que se estaba estudiando, Este efecto se debió posiblemente a la existencia de genes de resistencia que tienen tanto el PVA-800 como el ICA-15399 y que al unirse causan efectos de acumulación y complementación entre sí; este efecto es el que se conoce como segregantes transgresivos. El análisis de varianza se muestra en el Cuadro 13."},{"index":11,"size":78,"text":"Por otro lado, Vander Plank (1968) al hacer una discusión sobre resistencia vertical y horizontal señala que en un análisis de varianza donde se incluyan cepas y variedades y se manifieste la interacción significativa, ésta será debido a efectos de resistencia vertical, cuando la interacción no es significativa es debido a que se está manifestando la resistencia horizontal y cuando se manifieste cepas, variedades y variedades por cepas como significativo es que se poseen ambos tipos de resistencia."},{"index":12,"size":57,"text":"Sin embargo, en nuestro caso que poseemos tanto variedades, cepas y variedades por cepa como significativos, lo que ocurre es que la acumulación de genes ha llegado a tal extremo que permite que se confundan los efectos de resistencia horizontal con los de resistencia vertical, como son, las reacciones de hipersensibilidad, característica típica de la resistencia vertical."},{"index":13,"size":51,"text":"Conociendo como se ha manejado los programas de mejoramiento en la región centroamericana, sabemos que se han ido acumulando genes de resistencia con el paso de los años y al juntar genotipos de dos acervos genéticos que han sido manejados independientemente para este carácter, es obvio que deberán obtenerse genotipos superiores. "}]},{"head":"CONCLUSIONES Y RECOMENDACIONES","index":8,"paragraphs":[{"index":1,"size":25,"text":"1-El análisis de varianza para el experimento donde se evaluó la interacción variedad x cepa, muestra diferencias altamente significativas tanto para cepa, variedades x cepa."},{"index":2,"size":45,"text":"2-La agresividad de las cepas varió dependiendo de su lugar de origen. Así las cepas de Colombia y República Dominicana causan el menor daño a las plantas de frijol, el aislamiento Panamá 2 y Costa Rica son los que mayor daño causan a este cultivo."},{"index":3,"size":28,"text":"3-La cepa RS-32-CR, resultó ser la más virulenta de todas, rompiendo la resistencia mostrada en evaluaciones éstas no se pueden diferenciar estadísticamente cuando se inocularon con esta cepa."},{"index":4,"size":23,"text":"4-La heredabilidad mostrada por todos los cruzamientos fue alta, lo que indica que existe complementación génica entre el acervo mesoamericano y andino, respectivamente."},{"index":5,"size":41,"text":"5-El cruzamiento AFR-251 y BAT-1155, en forma directa y recíproca, mostraron diferencias en F 1 y la F 2 , lo que indica que la resistencia a la enfermedad está controlada por gene s del citoplasma y gene s del núcleo."},{"index":6,"size":21,"text":"6-El tipo de resistencia que mostraron los diferentes cruzamientos evaluados fue el de resistencia horizontal y no el de resistencia vertical."},{"index":7,"size":28,"text":"7-Se recomienda la metodología de inoculación usada en la presente investigación como una manera más segura y más fácil de obtener materiales de alta resistencia a este patógeno."},{"index":8,"size":19,"text":"8-Esta metodología representa una excelente ventaja para tamizar grandes volúmenes de germoplasma porque permite ahorrar tiempo, espacio y dinero."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"4aa1d3c0-c86a-443c-a740-ec6a35897b31","abstract":"La mustia hilachosa del frijol común Phaseolus vulgaris L. producida por el hongo Thanatephorus cucume-ris (Frank) Donk., representa una de las principales limitantes de este cultivo en zonas tropicales con altas precipitaciones y temperaturas. En esta zona es considerada como la enfermedad más destructiva del cultivo de frijol"}

data/part_2/0b9bb15c7a07c09e35e7c6b31de66196.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b9bb15c7a07c09e35e7c6b31de66196","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/607d73a7-807b-4c2d-acf9-fa3136520d10/retrieve"},"pageCount":1,"title":"Production des variétés de haricot (Phaseolus vulgaris) biofortifié sous engrais verts et fumures minérales dans le Haut-Katanga Par : ILUNGA MALOBA MakI ¹ Promoteur : Professeur KANYENGA LUBOBO Antoine ²","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":171,"text":"Actuellement, l'agriculture africaine est confrontée à des nombreux défis dont le climat caractérisé par une irrégularité tant quantitative que qualitative des pluies, la pauvreté des sols en éléments nutritifs ce qui se traduit par le niveau moins fertiles de sols suite à l'érosion du sol, causant leur détérioration et la perte d'éléments nutritifs. Cette dernière s'exprime à son tour par une diminution brusque ou graduelle de rendement selon le type de sol. En effet, il apparaît nécessaire d'utiliser pour l'agriculture les techniques pouvant apporter les nutriments disponibles aux sols et à un faible coût (la Commission économique pour l' Afrique, 2001 ;Kasongo.E et al, 2013, Tejada et al. 2008). L'utilisation des amendements minéraux et organiques est une option possible pour renverser cette tendance de perte de rendement et donc pour améliorer la sécurité alimentaire. Dans le cadre de l'approvisionnement de façon durable des sols en éléments fertilisants, à partir de l'enfouissement de la biomasse végétale en combinaison avec les fumures minérales; des recherches seront conduites pour l'amélioration du rendement du haricot."}]},{"head":"Objectifs de l'étude","index":2,"paragraphs":[{"index":1,"size":142,"text":" de déterminer dans les conditions climatiques et édaphiques de la province du haut Katanga la meilleure réponse du haricot par rapport à la combinaison des fumures organiques et inorganiques;  de déterminer dans les conditions climatiques et édaphiques de la province du haut Katanga la meilleure formulation de fumure minérale (NPK) pour la culture du haricot commun sur les différents sols; d'évaluer les potentialités réelles et les limitations des biomasses de Tithonia en tant qu'amendement du sol en combinaison avec les engrais minéraux pour la culture du haricot d'accorder ou ajuster les recommandations d'utilisation d'engrais basée sur des résultats obtenus (Malta et al, 2012). Le haricot commun, de par l'engouement suscite aux populations, pourrait constituer une importante source de revenus pour le paysan. En plus de ses teneurs en protéines (22%), lipides (1,6%) et glucides (57,8%) à l'état sec (Purseglove, 1984) "}]},{"head":"Matériels: Importance du Haricot","index":3,"paragraphs":[]},{"head":"Le haricot commun connait un regain d'intérêt et une amélioration de niveau de consommation comme une source importante de protéines pour les ménages d'Afrique en raison de l'augmentation scandaleuse des prix d'animaux","index":4,"paragraphs":[]},{"head":"Matériels:","index":5,"paragraphs":[{"index":1,"size":22,"text":"Trois techniques de gestion de la fertilité des sols sont testées dans trois sols différents: l'apport d'engrais verts (Tithonia), l'apport d'engrais minéraux   "}]},{"head":"et la combinaison de ces engrais. En effet, les engrais verts et les engrais minéraux apportent des éléments nutritifs sous forme organique, assimilable après minéralisation, mais aussi sous forme minérale, directement assimilable par les cultures. La dose recommandée d'engrais","index":6,"paragraphs":[]},{"head":"Comportements agronomiques","index":7,"paragraphs":[{"index":1,"size":45,"text":"Les paramètres à mesurer le taux de levé de la semence, le nombre des jours à la floraison, le nombre des jours à la maturité, la hauteur de la tige principale, le nombre de gousses/plante, le nombre de grains/gousse et le rendement en grains /plante."}]},{"head":"Poids de 100 graines","index":8,"paragraphs":[]},{"head":"Composition en micronutriments de grain es et minéraux du sol","index":9,"paragraphs":[{"index":1,"size":94,"text":"Les paramètres à mesurer sont la teneur en fer et en zinc dans les graines de haricot et au début de l'étude, trois échantillons composites de sol seront collectés sur toute la parcelle à 0-15 cm de profondeur. A la fin de l'essai, les échantillons de sol seront également collectés à la même profondeur dans chacune des 24 parcelles expérimentales. Ces échantillons de sol seront analysés pour déterminer les caractéristiques suivantes: le pH, le carbone organique, l'azote total, les bases échangeables (K), le phosphore disponible et également la teneur en fer et en zinc. "}]}],"figures":[{"text":" , et sa teneur en micronutriments (Kanyenga 2016) il occupe une place de choix dans la lutte contre la l'insécurité alimentaire, la malnutrition et la pauvreté de populations. . Cette culture est cultivée un peu partout en RD Congo, mais les bons rendements s'obtiennent dans les régions d'altitudes du pays, principalement en Province Orientale et le Kivu dans les plantations familiales, pour la consommation du ménage. Malgré sa plasticité dans le sens de l'adaptation à presque tous les systèmes de production agricole rencontré en RD Congo (Kanyenga, 2012a); la productivité du haricot dépend d'abord du niveau de fertilité du sol et des conditions pluviométriques qui sont aussi tres variables. INERA Recherche Agronomique pour le Développement Durable de la RD Congo Station de KIPOPO Milieu Trois sites avec trois sols différents ont été retenus dans la province du Haut Katanga, à savoir le site de CRAA (Centre de recherche Agro-Alimentaire) (), le site expérimental Kipopo (latitude de 11°33' 56'' S, longitude de 27°21'48'' E et altitude de 1250 m) et le Caractéristiques de la Variété de Haricot utilisée : K 132 Habitus : Nain Durée moyenne à la maturité : 80 à 95 jours Rendement potentiel : 1,5 -2 tonnes par ha Taille de graine : Moyenne Couleur de graine : Rouge strié de blanc Nombre moyen de gousse par plant : 10 à 12 Nombre moyen de graine par gousse : 5 à 6 Longueur moyenne de gousse : 115 à 118 mm Hauteur de la plante : 25 à 30 cm Poids de 100 graines : 48 grammes Synthèse de Résultats globaux des démonstrations sur la fertilisation minérale du haricot au sud Katanga en 1998 "},{"text":" NPK est de 200 kg et de tithonia 10 t à l'hectare. Une seule variété du Haricot commun biofortifié K 132 était semée pour notre étude. "},{"text":"MéthodesL 'essai est en blocs compléments randomisés (8*3) à trois répétitions avec un seul facteur les amendements. La parcelle élémentaire c'est à dire le traitement est constituée de 4 lignes de 3 m de long espacées entre elles de 40 cm et dont l'écartement entre les plants est de 20 cm avec deux graines par poquet. Les 8 parcelles seront séparées entre elles de 0,6 m et les trois blocs seront entre elles de 1,5 m. Etant donné la complexité de ce genre de recherche sur l'interaction Génotype x Environnement (G x E ), les analyses statistiques ciaprès seront effectués sur toutes les données du rendement et de la teneur en fer et en zinc ; l'analyse de la variance (ANOVA) séparée pour chaque essai et chaque site, l'analyse de la variance ( ANOVA) combinée , le nouveau test de Duncan pour les analyses multiples ( Duncan's New Multiple Range Test = DNMRT), la régression pour déterminer les corrélations entre la teneur en Fe des graines, la teneur en zinc et le rendement à l'aide des logiciels R "}],"sieverID":"4233cb81-a72d-4ad0-b695-07073ade1cc9","abstract":""}

data/part_2/0bc28bbb6c252069d82770f97f9be239.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bc28bbb6c252069d82770f97f9be239","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/181c6706-ca9d-4396-99f5-276dae68596f/retrieve"},"pageCount":8,"title":"","keywords":[],"chapters":[{"head":"> CONTEXTE","index":1,"paragraphs":[{"index":1,"size":45,"text":"L'espace du CLE Bougouriba 7 se situe dans la région du Sud-Ouest, dans le sous-bassin du Mouhoun inférieur. La rivière Bougouriba est un des affluents du fleuve Mouhoun. Le CLE Bougouriba 7 couvre 11 communes des provinces de la Bougouriba, du Ioba et du Poni. "}]},{"head":"> MÉTHODES ET APPROCHE","index":2,"paragraphs":[{"index":1,"size":99,"text":"Le travail de recherche sur le terrain s'est déroulé durant environ trois semaines au début de l'année 2017. Il a permis de mener des entretiens avec une trentaine de personnes dont 10 membres du Bureau exécutif du CLE Bougouriba 7 qui ont participé à un atelier de base. Par ailleurs, des usagers de l'eau rencontrés sur les sites de l'étude ont été interrogés, notamment sur les sites d'orpaillage. Le travail de recherche a inclus un atelier diagnostic avec les acteurs durant lequel des outils spécifiques de collecte des données ont été utilisés dans une démarche de recherche participative :"},{"index":2,"size":107,"text":"• la chronologie de la gestion de l'eau, méthode graphique montrant les changements perçus et l'enchaînement des événements marquants qui concernent les ressources en eau et leur gestion dans le temps. • La loi d'orientation sur la gestion de l'eau de 2001 reconnaît le droit à l'eau et définit le domaine public de l'eau. Elle détermine les structures de gestion de l'eau ainsi que les conditions de l'utilisation de l'eau. Son article 13 précise : « le Ministère chargé de l'eau est le garant institutionnel de la GIRE. » La loi indique que les décisions relatives à la gestion de l'eau sont prises par les autorités locales."},{"index":3,"size":43,"text":"• La loi de 2009 portant institution d'une taxe parafiscale au profit des agences de l'eau met en place une contribution financière en matière d'eau (CFE) sur le prélèvement de l'eau brute, la modification du régime de l'eau et la pollution de l'eau."},{"index":4,"size":37,"text":"• La loi de 2013 portant Code de l'environnement institue l'obligation de réaliser des études d'impact environnemental et social avant toute activité susceptible d'avoir des incidences sur l'environnement. Elle règlemente aussi les rejets de polluants dans l'eau."},{"index":5,"size":33,"text":"Plusieurs textes règlementaires ont été élaborés pour permettre la mise en oeuvre de la loi d'orientation relative à la gestion de l'eau et de la loi sur la contribution financière en matière d'eau. "}]},{"head":"Elle nécessite une communication interne pour un meilleur fonctionnement du CLE et une communication externe pour favoriser sa visibilité.","index":3,"paragraphs":[]},{"head":"Messages-clés :","index":4,"paragraphs":[]},{"head":"Le CLE BGB7 connaît depuis sa création d'importantes difficultés de fonctionnement l'empêchant de remplir son rôle pourtant central dans la gestion intégrée des ressources en eau au niveau local. L'amélioration de la gouvernance du CLE BGB7 repose sur une application effective des textes et leur vulgarisation.","index":5,"paragraphs":[]},{"head":"Problèmes de gouvernance","index":6,"paragraphs":[{"index":1,"size":34,"text":"• Trop grande mobilité des membres du bureau, notamment ceux du collège de l'administration, du fait des affectations des fonctionnaires : le CLE a eu 4 Présidents en moins de 6 ans de fonctionnement."},{"index":2,"size":31,"text":"• La présidence accordée de fait au Haut-Commissaire, si elle est un gage de visibilité et d'efficacité, limite la libre expression des membres qui n'osent pas s'exprimer face à une autorité."}]},{"head":"Manque de moyens financiers","index":7,"paragraphs":[{"index":1,"size":19,"text":"• Les partenaires sont hésitants à accompagner financièrement les structures de l'Etat, incertains de la bonne utilisation des fonds."},{"index":2,"size":11,"text":"• La lourdeur administrative peut, parfois, décourager et démotiver certains partenaires."}]},{"head":"Manque d'autonomie","index":8,"paragraphs":[{"index":1,"size":35,"text":"• Le programme de Valorisation des Ressources en Eau de l'Ouest s'est achevé juste après la création du CLE en 2010. Il avait contribué à sa mise en place et aurait été un partenaire important."},{"index":2,"size":83,"text":"• De manière générale, la fin des programmes et projets d'appui au CLE entraîne à chaque fois une perte de dynamisme. Il ressort globalement de cette étude que la connaissance et le respect des normes juridiques, le développement de l'esprit de communication ainsi que le développement et la promotion de bonnes pratiques de gestion des ressources en eau favoriseraient l'amélioration de la gouvernance de l'eau dans l'espace du CLE BGB7.  Appui à la rédaction : Elise Cannuel / Conception graphique : Laura Delhommeau"}]},{"head":"Insuffisance de communication interne et externe","index":9,"paragraphs":[]}],"figures":[{"text":" L'espace du CLE Bougouriba 7 est confronté à la raréfaction des pluies et la mauvaise répartition de la pluviométrie, causes du tarissement de certains points d'eau. La forte pression démographique entraîne par ailleurs une augmentation des besoins en eau. Les enjeux spécifiques sont énumérés dans le Plan de Gestion de l'Eau (PGE) du CLE : • insuffisance d'infrastructures hydrauliques pour la consommation et pour la production • pollution de l'eau liée à la pêche, à l'orpaillage et à la culture du coton • problèmes sanitaires et conflits liés au partage des mêmes points d'eau entre les usages domestiques, l'agriculture et l'élevage • ensablement des réservoirs et des cours d'eau dû aux cultures agricoles et maraîchères sur les berges. "},{"text":" photo : Manon Koningstein /IWMI "},{"text":"« Planification participative pour une gestion plus inclusive et durable de l'eau en milieu rural au Burkina Faso » Le projet de recherche « Planification participative pour une gestion plus inclusive et durable de l'eau en milieu rural au Burkina Faso » (PP4MIS) d'une durée de trois ans a pour objectif de renforcer les institutions de la GIRE, de favoriser l'élaboration de politiques de gestion de l'eau et d'améliorer la gestion communautaire des ressources en eau.Plus d'informations sur le projet PP4MIS sur le site Internet : http://pwgbf.iwmi.org/ Ou contactez la Responsable du projet Dr. Liza Debevec à l'adresse : [email protected] NOTE TECHNIQUE : Femmes et ressources en eau : premières à utiliser, dernières à décider L'International Water Management Institute (IWMI), en charge de la coordination du projet et de la recherche scientifique L'Agence de l'Eau du Mouhoun (AEM), partenaire principal et intermédiaire entre le projet et le gouvernement ainsi qu'entre les institutions existantes de la GIRE et les chercheurs Le programme de Master Agrinovia en développement rural durable à l'Université Joseph Ki-Zerbo, en charge de l'accompagnement du volet recherche et du renforcement des capacités des chercheurs nationaux Le Programme de doctorat sur les systèmes de ressources en eau au centre pour les systèmes de ressources en eau de l'Université Technique de Vienne (VUT) en Autriche, en charge de l'accompagnement de la recherche scientifique et de l'appui consultatif à la coordination Partenaires INTERNATIONAL WATER MANAGEMENT INSTITUTE (IWMI) IWMI Sri Lanka Office : 127 Sunil Mawatha, Pelawatte, Battaramulla, Colombo, Sri Lanka Adresse postale : P.O. Box 2075, Colombo, Sri Lanka Tél. : +94 11 2880000, 2784080 -Fax : +94 11 2786854 -E-mail : [email protected] En Afrique de l'Ouest : IWMI Accra Office IWMI c/o CSIR Main Campus, Airport Residential Area (opposite Chinese Embassy), Accra, Ghana Adresse postale : IWMI, PMB CT 112, Cantonments, Accra, Ghana Tél. : +233 302 784 753/4 -+233 289 109 561 -+233 544 088 277 Fax : +233 302 784 752 -E-mail : [email protected] www.iwmi.org Ce travail a été rendu possible grâce au financement de la Coopération Autrichienne de Développement, le Ministère autrichien des Finances et le Programme de recherche Water, Land and Ecosystems (WLE). "},{"text":"  "},{"text":"un travail de groupe Cette chronologie fait ressortir l'historique de la gestion de l'eau dans l'espace du CLE BGB7.  L'espace de gestion du Comité Local de l'Eau Bougouriba 7 En mai 2003, le Plan d'Action pour la Gestion Intégrée des Ressources en Eau (PAGIRE) a défini les Comités Locaux de l'Eau : « en fonction de l'acuité des problèmes d'aménagement et de gestion des eaux […], il pourra être mis en place, en conformité avec les Schémas Directeurs d'Aménagement et de Gestion de l'Eau, des Comités Locaux de l'Eau ». Un document-guide donne des orientations sur la mise en place, le fonctionnement et les attributions des CLE, qualifiés de « maillons de base du cadre institutionnel de la GIRE ». Le document précise : « la mise en oeuvre du CLE est un domaine d'initiative partagée pour toute personne publique ou privée désireuse de développer des solutions concertées face aux problématiques locales d'aménagement ou de ges-tion de l'eau ». Ce document-guide n'a pas de valeur juridique, il donne seulement des orientations. L'espace de gestion du Comité Local de l'Eau Bougouriba 7 En mai 2003, le Plan d'Action pour la Gestion Intégrée des Ressources en Eau (PAGIRE) a défini les Comités Locaux de l'Eau : « en fonction de l'acuité des problèmes d'aménagement et de gestion des eaux […], il pourra être mis en place, en conformité avec les Schémas Directeurs d'Aménagement et de Gestion de l'Eau, des Comités Locaux de l'Eau ». Un document-guide donne des orientations sur la mise en place, le fonctionnement et les attributions des CLE, qualifiés de « maillons de base du cadre institutionnel de la GIRE ». Le document précise : « la mise en oeuvre du CLE est un domaine d'initiative partagée pour toute personne publique ou privée désireuse de développer des solutions concertées face aux problématiques locales d'aménagement ou de ges-tion de l'eau ». Ce document-guide n'a pas de valeur juridique, il donne seulement des orientations. Le CLE comporte une Assemblée Générale, un Bureau Exécutif et une cellule de contrôle. La fonction des membres élus du bureau ne leur donne pas droit à une rémunération. Trois types d'acteurs sont impliqués au sein de trois collèges : l'administration au niveau déconcentré, les collectivités territoriales et les usagers de l'eau. Le CLE comporte une Assemblée Générale, un Bureau Exécutif et une cellule de contrôle. La fonction des membres élus du bureau ne leur donne pas droit à une rémunération. Trois types d'acteurs sont impliqués au sein de trois collèges : l'administration au niveau déconcentré, les collectivités territoriales et les usagers de l'eau. • L'arbre à problèmes, méthode visuelle et participa-tive permettant d'établir une cartographie structurée des relations de cause à effet entre les problèmes. La chronologie des ressources en eau : un état des lieux établi par les acteurs eux-mêmes lors d'Un membre du bu-reau du CLE • L'arbre à solutions, méthode liée à la précédente, permettant la conversion de ces problèmes en ob-« • L'arbre à problèmes, méthode visuelle et participa-tive permettant d'établir une cartographie structurée des relations de cause à effet entre les problèmes. La chronologie des ressources en eau : un état des lieux établi par les acteurs eux-mêmes lors d'Un membre du bu-reau du CLE • L'arbre à solutions, méthode liée à la précédente, permettant la conversion de ces problèmes en ob-« jectifs, avec les moyens pour obtenir des résultats. jectifs, avec les moyens pour obtenir des résultats. • La cartographie des réseaux d'acteurs identifiant • La cartographie des réseaux d'acteurs identifiant les parties prenantes selon leurs attributs, interre- les parties prenantes selon leurs attributs, interre- lations et intérêts. lations et intérêts. gstein /IWMI gstein /IWMI Konin Konin Manon Manon : : photo photo  "},{"text":"Auparavant, il y avait une organisation traditionnelle autour des points d'eau. Les gens s'organisaient pour curer les points d'eau et les protéger parce qu'ils servaient aussi bien de boisson pour les humains que d'abreuvoir pour les animaux. »  Un éleveur membre du bureau du CLE et représentant du collège des usagers Un éleveur membre du bureau du CLE et représentant du collège des usagers « «  "},{"text":"Avant, c'était uni- quement le chef de terre qui pouvait réunir les gens. En 1987, il y a eu une prise de conscience à travers la création de groupements pour permettre aux gens de se rencontrer pour discuter des choses les concernant. »  La Coordinatrice pro-vinciale des femmes La Coordinatrice pro-vinciale des femmes « «  "},{"text":"Les techniciens nous ont dit que c'est l'insuffisance de la ressource eau, nous n'avons plus assez de ressources dans le sous-sol et donc ça pose un sé- rieux problème, nous n'avons plus d'eau potable en quantité suffisante dans la ville de Diébougou. »  Un pêcheur de la ri-vière Bougouriba Un pêcheur de la ri-vière Bougouriba « C' « C'  "},{"text":"est incroyable que le débit de l'eau de cette rivière peut baisser jusqu'à ce niveau. Avant, on ne souffrait pas pour pêcher. Il y avait beaucoup d'eau et de poissons, c'est dom- mage que la rivière se trouve dans cet état aujourd'hui. » La Constitution indique dans son article 14 que « les richesses et les ressources naturelles appartiennent au peuple ». Les ressources en eau comptent donc parmi les biens publics dont la propriété est accordée au peuple. L'article 29 reconnaît le droit à un environnement sain et charge chaque Burkinabè de sa protection, de sa défense et de sa promotion. Le Président d'un groupement de pê-cheurs Le Président d'un groupement de pê-cheurs « Les sables prove- « Les sables prove- nant des trous creu- nant des trous creu- sés par les orpailleurs sés par les orpailleurs sont drainés par les sont drainés par les eaux de pluie dans eaux de pluie dans la rivière Bougou- la rivière Bougou- riba, causant l'en- riba, causant l'en- sablement du cours sablement du cours d'eau. » d'eau. »  "},{"text":" Le CLE Mouhoun Tâ, créé en 2013, compte des membres ayant un haut niveau de responsabilités administratives, plus sollicités par celles-ci que par le fonctionnement du CLE, ce qui ne permet pas au CLE de tenir normalement ses rencontres statutaires et de mener à bien ses activités. Ainsi, le CLE n'a pu tenir qu'une AG par an depuis sa mise en place en 2013 et non 2 comme le prévoit le règlement intérieur.On constate que les communes et le CLE évoluent indépendamment. Il apparaît que le CLE ne consulte pas les autorités communales avant la mise en oeuvre de ses activités. Cela est dû notamment aux bouleversements politiques (insurrection, coup d'État, transition). L'ensemble des autorités territoriales décentralisées du pays (maires et conseillers) ont été renouvelées, y compris dans l'espace du CLE Mouhoun Tâ. Les problématiques du CLE Mouhoun Tâ, dans le sous- L'insuffisance de communication a également été Les problématiques du CLE Mouhoun Tâ, dans le sous-L'insuffisance de communication a également été bassin du Mouhoun supérieur aval, sont similaires à relevée : sur 101 personnes enquêtées, 70 disent ne bassin du Mouhoun supérieur aval, sont similaires àrelevée : sur 101 personnes enquêtées, 70 disent ne celles du CLE Bougouriba 7. Elles ont été étudiées, pas connaître le CLE. celles du CLE Bougouriba 7. Elles ont été étudiées,pas connaître le CLE. en 2017, par Adama Bambara, étudiant du Master Agrinovia à l'Université Joseph Ki-Zerbo à Ouagadougou, avec l'accompagnement de l'International Water Management Institute. Les membres du CLE Mouhoun Tâ ont conscience des dysfonctionnements. Ils estiment que son fonctionnement repose généralement dans les seules mains des services techniques. en 2017, par Adama Bambara, étudiant du Master Agrinovia à l'Université Joseph Ki-Zerbo à Ouagadougou, avec l'accompagnement de l'International Water Management Institute.Les membres du CLE Mouhoun Tâ ont conscience des dysfonctionnements. Ils estiment que son fonctionnement repose généralement dans les seules mains des services techniques. Au niveau du CLE : • la relecture du règlement intérieur par le bureau Au niveau des partenaires mettant en oeuvre des projets en GIRE : Au niveau du CLE : • la relecture du règlement intérieur par le bureauAu niveau des partenaires mettant en oeuvre des projets en GIRE : exécutif pour déterminer clairement les rôles et • la prise en compte des atouts et contraintes des exécutif pour déterminer clairement les rôles et• la prise en compte des atouts et contraintes des responsabilités des membres du CLE et prendre localités d'intervention. Les atouts doivent être responsabilités des membres du CLE et prendrelocalités d'intervention. Les atouts doivent être en compte le genre reconnus à leur juste valeur. Les contraintes doivent en compte le genrereconnus à leur juste valeur. Les contraintes doivent • l'application du règlement intérieur, notamment servir de leviers d'intervention • l'application du règlement intérieur, notammentservir de leviers d'intervention l'effectivité de la Commission de Programmation, • l'identification des besoins avec la population pour l'effectivité de la Commission de Programmation,• l'identification des besoins avec la population pour d'Animation et de Suivi (CPAS) sa participation dans les activités et la réussite du d'Animation et de Suivi (CPAS)sa participation dans les activités et la réussite du • une meilleure communication au sein du CLE dont projet • une meilleure communication au sein du CLE dontprojet la responsabilité incombe à chaque membre et • la prise en compte des membres du CLE comme la responsabilité incombe à chaque membre et• la prise en compte des membres du CLE comme particulièrement aux chargés d'information au sein partenaires actifs et responsables et non comme particulièrement aux chargés d'information au seinpartenaires actifs et responsables et non comme du bureau bénéficiaires du projet du bureaubénéficiaires du projet • une meilleure visibilité du CLE à travers des actions • la conclusion d'accords de financement au bénéfice • une meilleure visibilité du CLE à travers des actions• la conclusion d'accords de financement au bénéfice pour des appuis techniques et financiers. • la mise en place de partenariats et leur maintien respectueuses des ressources • la promotion de pratiques locales innovantes et de communication régulières ne sont pas faits au sein des collèges. sont tardivement. Les comptes rendus des AG mêmes ne sont pas informés des activités ou le du CLE et souvent les membres du bureau eux-• Déficit de communication interne : les membres du CLE. pour des appuis techniques et financiers. • la mise en place de partenariats et leur maintien respectueuses des ressources • la promotion de pratiques locales innovantes et de communication régulièresne sont pas faits au sein des collèges. sont tardivement. Les comptes rendus des AG mêmes ne sont pas informés des activités ou le du CLE et souvent les membres du bureau eux-• Déficit de communication interne : les membres du CLE.  • L'absence de passation entre Présidents du • L'absence de passation entre Présidents du  Bureau exécutif sortant et entrant qui ne permet la Bureau exécutif sortant et entrant qui ne permet la  transmission d'aucune information ou indication. transmission d'aucune information ou indication.  "},{"text":" Le cas du CLE Mouhoun Tâ Gouvernance de l'eau dans l'espace du Comité Local de l'Eau de la Bougouriba 7 (CLE BGB7). Mémoire de Master II. Programme Agrinovia, Université Joseph Ki-Zerbo, 89 p.Le mémoire de Master II qui a servi de base à la rédaction de cette note technique est disponible sur la page Publications/Outputs du site Internet du projet PP4MIS à l'adresse http://pwgbf.iwmi.org/ Références Références GARANE, A. (2007) : Schéma analytique de la législa-tion nationale des ressources en eau du Burkina Faso, Série des Études juridiques de la FAO en ligne, n°67, juillet 2007, 16 p. http://www.fao.org/legal/prs-ol/paper-e.htm Ministère de l'Eau, des Aménagements Hydrauliques et de l'Assainissement (2004) : Les CLE, maillons de base du cadre institutionnel de la GIRE, document-guide de conception, création et fonctionnement, 36 p. SOMDA L. (2017) : SP/PAGIRE-IWMI-CIRAD : Plan de Gestion du CLE du sous-bassin de la Bougouriba 7. Document du projet non publié, 35 p. WALASCZEK, A. (2012) : Pratiques de la Gestion Intégrée des Ressources en Eau : centralité et repré-sentativité des acteurs au sein du Comité Local de l'Eau dans le Sud-Ouest du Burkina Faso. Rapport de stage, 85 p. GARANE, A. (2007) : Schéma analytique de la législa-tion nationale des ressources en eau du Burkina Faso, Série des Études juridiques de la FAO en ligne, n°67, juillet 2007, 16 p. http://www.fao.org/legal/prs-ol/paper-e.htm Ministère de l'Eau, des Aménagements Hydrauliques et de l'Assainissement (2004) : Les CLE, maillons de base du cadre institutionnel de la GIRE, document-guide de conception, création et fonctionnement, 36 p. SOMDA L. (2017) : SP/PAGIRE-IWMI-CIRAD : Plan de Gestion du CLE du sous-bassin de la Bougouriba 7. Document du projet non publié, 35 p. WALASCZEK, A. (2012) : Pratiques de la Gestion Intégrée des Ressources en Eau : centralité et repré-sentativité des acteurs au sein du Comité Local de l'Eau dans le Sud-Ouest du Burkina Faso. Rapport de stage, 85 p.  "}],"sieverID":"1a63338a-e19f-4ce0-81d0-f582d4fd5fa9","abstract":"Un travail de recherche mené en 2017 avec l'accompagnement de l'International Water Management Institute par Letisia Somda, étudiante du Master Agrinovia à l'Université Joseph Ki-Zerbo à Ouagadougou, s'est intéressé au fonctionnement d'une institution locale de gestion de l'eau, le Comité Local de l'Eau (CLE). Les CLE sont conçus comme les maillons de base du cadre institutionnel de la Gestion Intégrée des Ressources en Eau au Burkina Faso. Le CLE Bougouriba 7 ou CLE BGB7, créé en 2010, a été relancé en 2015 mais connaissait toujours d'importantes difficultés de fonctionnement en 2017. L'étude a permis de faire le diagnostic de la gestion de l'eau dans cet espace. Elle a identifié les obstacles à la bonne gestion et proposé des solutions pour une meilleure gouvernance de l'eau. RÉSULTATS DE L'ÉTUDE : « Gouvernance de l'eau dans l'espace du Comité Local de l'Eau de la Bougouriba 7 (CLE BGB7) » photo : Manon Koningstein/IWMI Les CLE, institutions locales pertinentes mais peu fonctionnelles de gestion de l'eau NOTE TECHNIQUE NOTE TECHNIQUE I Les CLE, institutions locales pertinentes mais peu fonctionnelles de gestion de l'eau"}