Upload 1006 files to data/part_1

data/part_1/000b354c62732f520be29bcfddd5caa5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"000b354c62732f520be29bcfddd5caa5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/68141578-0eec-47f7-99d4-f6d961b40d94/retrieve"},"pageCount":26,"title":"Ex Ante Analysis of New Forage Alternatives for Farms with Dual-Purpose Cattle in Peru, Costa Rica, and Nicaragua","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":59,"text":"The incorporation of new areas has been the main source of animal production growth in the extensive systems of Latin America. However, marginal lands with higher productivity have already been exhausted, and only remote areas with low fertility soils in environmentally fragile ecosystems remain unused, resulting in greater intensification of those areas currently under production (FAO 1996; Table 1)."},{"index":2,"size":141,"text":"Table 1 shows that, of the total increases in milk and beef production, productivity per cow during the 1990s was responsible for about 82% of this increase and biological herd growth was responsible for only 18% . In contrast, during the previous three decades, herd growth was responsible for about 70% of total increases in production and only about 30% was accounted for increments in productivity per cow. Therefore, these changes suggest that the increase in milk and beef production during the 90s are mainly a result of on-farm improvements such as establishment of improved forages, increased levels of supplements, and genetic improvement, and much less the result of incorporating new land and cattle into the livestock activity. This argument is supported by the fact that pasture area during the 90s have increased at a rate of only 0.2% per year."},{"index":3,"size":74,"text":"The role of forage supplements, such as legumes, produced on the farm to strategically balance dietary nutrients, has been widely documented (Pizarro and Coradin 1996). Evidence from several ecosystems have shown the beneficial effects of introducing improved grasses and legumes into farms, including increased milk and meat production; reduced erosion; increased soil fertility, water retention, and biological activity; similar increases in crop productivity, and reduced fertilizer demand (Argel and Ramírez 1996;Miles et al. 1996)."}]},{"head":"Objectives","index":2,"paragraphs":[{"index":1,"size":59,"text":"This study aimed to perform an ex ante economic evaluation of new forage alternatives available to farmers in Latin American tropical lowlands. Case studies, involving farmers participating in the Tropileche Consortia, were conducted in the forest margins of the humid tropics of Pucallpa (Peru) and in the hillsides of the dry tropics of Esparza (Costa Rica) and Esquipulas (Nicaragua)."}]},{"head":"Methodology","index":3,"paragraphs":[{"index":1,"size":43,"text":"Every farmer participating in the Tropileche Consortia at the reference sites was interviewed to obtain data on production systems, use of resources, prices of inputs and products, and technologies used. Secondary information was also gathered on the region where the farms were located."},{"index":2,"size":23,"text":"A linear programming agricultural model was used for analysis. This model, developed by CIAT to fit on one electronic sheet, maximized on-farm income."}]},{"head":"Current Situation","index":4,"paragraphs":[]},{"head":"Current land use and productivity","index":5,"paragraphs":[{"index":1,"size":22,"text":"Table 2 shows the averages of cattle inventory, milk production, and land use on dual-purpose farms in Peru, Costa Rica, and Nicaragua."},{"index":2,"size":102,"text":"The largest average herd size is found in Costa Rica (47 cows and 72 AU), followed closely by Peru (31 cows and 50 AU) and Nicaragua (29 cows and 45 AU). Daily milk production per cow is highest in Costa Rica (5.0 kg), followed by Nicaragua (3.7 kg), and lowest in Peru (3.0 kg). The low milk production in Peru may be attributed to milk market constraints (which is discussed later in more detail), rather than to differences in animal genotype, also expressed by the low percentage of milking cows found in Peru (42%), compared with Costa Rica (60%) and Nicaragua (58%)."},{"index":3,"size":89,"text":"Most of a farm's area is sown to pastures, ranging from 75% for Peru to 94% for Nicaragua. The largest proportion of forest is found in Peru (23%), while the smallest is in Nicaragua (4%). The average area planted to crops in Peru is 1.5 ha and in Nicaragua 0.7 ha. Crops are grown for subsistence and include rice, beans, and maize. In Costa Rica, the area under crops is larger (4.6 ha) and crops more diversified (rice, maize, beans, sugarcane, cashew, and fruits such as mango and melon)."},{"index":4,"size":69,"text":"Most of the area sown to pastures is covered with \"naturalized\" species of low productivity, for example, jaragua grass (Hyparrhenia rufa) in Costa Rica and Nicaragua. Only a small percentage is sown to improved pastures (11% in Costa Rica, 15% in Peru, and 24% in Nicaragua); these are mostly degraded to some extent and receive no nitrogen fertilization. Stocking rates are thus similar in all countries, averaging 0.9 AU/ha."}]},{"head":"Prices of resources and capital investment","index":6,"paragraphs":[{"index":1,"size":81,"text":"Table 3 indicates the prices of resources and capital investment in dual-purpose farms by country. Farmgate prices of milk differ markedly from country to country, ranging from US$0.22/kg in Esquipulas, Nicaragua, to US$0.32/kg in Pucallpa, Peru, with Costa Rica in between at $0.28/kg. However, the price received for milk in both Peru and Nicaragua refers to milk \"straight out of the cow,\" whereas the milk in Costa Rica has been cooled to 5 ° C and is therefore of higher quality."},{"index":2,"size":47,"text":"The price of beef (culled cow) is similar in Peru and Costa Rica ($0.60/kg liveweight), but less in Nicaragua ($0.50/kg). However, animal prices are higher in Costa Rica, followed by Peru. In Nicaragua, prices are much lower, not only for milk and beef, but also for animals."},{"index":3,"size":91,"text":"high level of public infrastructure, proximity to markets, and long social and economic stability increase land values at Esparza, relative to Pucallpa or Esquipulas (Nicaragua). The commercial value of a farm in Costa Rica therefore averages $280,000, compared with $53,000 in Peru and $45,000 in Nicaragua. In all three countries, land and cattle constitute the main investments. Land value accounts for 77% of the capital invested in Costa Rica, 40% in Nicaragua, and 28% in Peru; and cattle accounts for 15% in Costa Rica, 41% in Nicaragua, and 56% in Peru."}]},{"head":"Production costs and income","index":7,"paragraphs":[{"index":1,"size":91,"text":"Table 4 gives an estimate of direct production costs during 1997, gross income, net cash flow, family labor wages, current income and return to capital investment. Labor costs comprise the most important production cost in Peru (43%) and Costa Rica (63%), and the second most important in Nicaragua (32%). This item includes family labor, valued at the minimum wage. The expenditure in feed supplements, for example, concentrates and mineral salts, was the fourth most important item in Peru and the second most in Costa Rica, and the most important in Nicaragua."},{"index":2,"size":50,"text":"Total milk production costs differ significantly among the three countries, ranging from $0.20/kg in Esquipulas, Nicaragua, to $0.23/kg in Esparza, Costa Rica, to $0.29/kg in Pucallpa, Peru. Production costs in Nicaragua are low mainly because labor is 5 times cheaper than in Costa Rica and 1.05 times than in Peru."},{"index":3,"size":66,"text":"Because of the low milk production per cow (3.0 kg/cow per day) and the small size of the milking herd (i.e., 10.6 cows), production costs in Pucallpa, Peru (Table 2), are high, compared with counterparts in Costa Rica and Nicaragua. These costs are also above the international value of milk, which is $2,000/metric ton, equivalent to 130 g powdered milk/L or $0.26/kg liquid milk (Table 4)."},{"index":4,"size":34,"text":"Most gross sales come from milk (60% in Peru, 76% in Costa Rica, and 74% in Nicaragua). Remaining sales are represented by the income generated by the sale of weaned calves and culled cows."},{"index":5,"size":59,"text":"Monthly family income is about $270 in Pucallpa, Peru; $586 in Esparza, Costa Rica; and $147 in Nicaragua. This income is equivalent to a day's wage of $8.90 in Peru, $19.27 in Costa Rica, and $4.83 in Nicaragua. However, these wages are approximately twice the national minimum wage in Peru and Costa Rica and almost triple that of Nicaragua."},{"index":6,"size":73,"text":"The real annual return on capital investment for 1997 was very low in Costa Rica (1.37%), followed by Nicaragua (2.53%), and highest in Peru (2.87%). The reason why Costa Rica presents the lowest income return, despite having higher family income and labor wages, is because the land value of the average farm in Costa Rica is high ($280,000/farm). In contrast, unit values of both land and animals are lower in Peru or Nicaragua."}]},{"head":"Ex Ante Evaluation of Forage Alternatives","index":8,"paragraphs":[{"index":1,"size":48,"text":"This study aimed to conduct an ex ante economic evaluation of new promising forage alternatives adapted to soils of low to intermediate fertility. These alternatives included grasses of the Brachiaria genus (i.e., B. brizantha, B. decumbens, B. dictyoneura), and the legumes Stylosanthes guianensis, Cratylia argentea, and Arachis pintoi."},{"index":2,"size":50,"text":"The legume S. guianensis is highly digestible and palatable, and commonly used by farmers as a strategic supplement for pre-weaning calves under direct grazing. Because the simulation model used in this study does not discriminate by animal type, a partial budget methodology was used to evaluate 'Stylo' for pre-weaning calves."},{"index":3,"size":75,"text":"The legume C. argentea is an ideal shrub for protein banks and can be used, combined with sugarcane, as protein supplement during the dry season for all animal types, especially milking cows, under the cut-and-carry system. The legume A. pintoi is evaluated in association with Brachiaria grasses under direct grazing. Table 5 shows the nutritional parameters and biomass production at different reference sites for all forage alternatives tested in this study with the simulation model."},{"index":4,"size":40,"text":"Animal management parameters were based on farm averages at each reference site evaluated so that they represented current management conditions (Tables 2 and 4). Similarly, the model incorporated the prices of inputs and products typical of each country (Table 3)."},{"index":5,"size":63,"text":"The case study consisted of the average farm participating in the Tropileche Consortia at each site. Therefore, for Peru, this was a farm with 57 ha; in Costa Rica, 78 ha; and in Nicaragua, 50 ha. Similarly, the herd size was the average of farms at each site, being 31 cows in Peru, 47 in Costa Rica, and 29 in Nicaragua (Table 2)."},{"index":6,"size":152,"text":"A constant herd size (the same number of milking cows) was assumed for all the alternatives evaluated. Production costs per kilogram milk were estimated as the maximum expression of competitiveness, using three cow productivity parameters: the current average production per lactation (800 kg in Peru, 1,000 kg in Nicaragua, and 1,350 kg in Costa Rica); and two postulated parameters: 1,500 kg/lactation and 2,000 kg/lactation. Productivity parameters may be analyzed according to: (1) the genetic potential of the animals, that is, whether the milking herd can respond to improved diets, and/or (2) differences in pasture management. That is, a given pasture of jaragua grass may induce higher cow productivity, if the cow has access to adequate shade and fresh water at all times, if weeds are controlled, and if the paddocks are rotated adequately for grazing and resting. Herd fertility (i.e., calving rate) was assumed to remain constant, even after implementing forage options."},{"index":7,"size":13,"text":"For each reference site, the prevailing conditions and four alternative scenarios were evaluated:"},{"index":8,"size":88,"text":"Prevailing conditions consist of a farm totally covered with naturalized or degraded pastures (e.g., jaragua grass in Esparza, Costa Rica, and Esquipulas, Nicaragua, and degraded native pastures in Pucallpa, Peru), and supplements given during the dry season. In Pucallpa, Peru, supplements consisted of molasses, maize, or bran from breweries, all of which are available in the region. In Costa Rica, farmers used molasses, a commercial concentrate, and pollinaza (a type of manure from chickens being fed with concentrates for fattening). In Nicaragua, molasses and commercial concentrate were evaluated."},{"index":9,"size":54,"text":"Alternative 1. The commercial supplements are replaced by C. argentea + sugarcane for the dry season. During the rainy season, the herd grazes paddocks of naturalized grasses. In Peru, this alternative was evaluated with only Cratylia (i.e., no sugarcane), because the lack of a marked dry season does not justify the investment of sugarcane."},{"index":10,"size":22,"text":"Alternative 2. The naturalized grass is replaced by Brachiaria spp. and C. argentea and sugarcane are also established for dry season feeding."},{"index":11,"size":31,"text":"Alternative 3. Brachiaria spp. are established in association with A. pintoi, and C. argentea is also planted with sugarcane. That is, all the forage alternatives are established on the same farm."},{"index":12,"size":42,"text":"Alternative 4. Using the partial budget methodology, the establishment of S. guianensis for feeding pre-weaning calves was evaluated, using data that were already generated by farms of the Tropileche Consortia in Nicaragua and Peru and by extrapolating this information to Costa Rica."},{"index":13,"size":80,"text":"For all the different forage options, the key factors to analyze were (1) milk production costs resulting from implementing each forage alternative; (2) the investment required to establish each option, assuming the same number of milking cows and herd fertility; (3) the feasibility of obtaining credit with a local bank to invest in a forage alternative; and (4) the percentage of pasture area on the farm freed for other uses as a result of establishing one of the forage alternatives."}]},{"head":"Results and Discussion","index":9,"paragraphs":[{"index":1,"size":87,"text":"Costa Rica Current situation. Figure 1 shows the production cost per kilogram of milk according to forage option. Costs per kg of milk are higher when using the pasture commonly grown in the area (i.e., jaragua grass), because farmers must provide supplements for their animals during the 5-month dry season. At 1,350 kg per lactation, milk production cost is US$0.31/kg and the price received is $0.28/kg. That is, the farmer reaches a break-even point when selling weaned calves; the income obtained is similar to the minimum wage."},{"index":2,"size":74,"text":"Production costs decrease as cow productivity increases. Thus, changing from a cow that produces 1,350 kg in a 270-day lactation (i.e., 5.0 kg/cow per day) to one that produces 1,500 kg (or 5.55 kg/day) reduces costs from $0.31/kg to $0.29/kg. When a cow produces 2,000 kg, costs are reduced to $0.23/kg, using the same jaragua grass and supplements of molasses mixed with chicken manure to supply those nutrients deficient in the jaragua grass pasture."},{"index":3,"size":60,"text":"Jaragua grass + Cratylia argentea + sugarcane. With this forage option, the need for purchasing concentrates, molasses, or chicken manure for the dry season can be eliminated completely. Based on the nutrient content indicated in Table 5, this forage option is capable of maintaining production during the dry season, even in cows producing 2,000 kg per lactation (or 7.4 kg/day)."},{"index":4,"size":151,"text":"At 1,350 kg per lactation, production costs per kg milk are reduced by 10%, compared with the current situation (jaragua + concentrate or chicken manure) and by 7% when production levels are at 1,500 kg per lactation. However, at 2,000 kg per lactation, production costs do not differ because a restriction was imposed on the model regarding the use of chicken manure. In Costa Rica, although chicken manure can be purchased at local farms, it must be purchased throughout the year. The model therefore chose the purchase of commercial concentrate during the dry season in cows producing 1,350 kg and 1,500 kg per lactation, but jaragua grass cannot support a production of 2,000 kg per lactation without there being additional protein and energy supplements throughout the year. In this case, the most inexpensive source was chicken manure, which makes the farm highly competitive, because of the manure's availability throughout the year."},{"index":5,"size":99,"text":"Currently, chicken manure is cheap, costing $0.08/kg; it has a high crude protein content of 17% and 60% digestibility. This combination of factors makes chicken manure a highly viable option. However, its price may rise as its popularity increases, which would make the Cratylia + sugarcane option even more attractive. Chicken manure from layers has a high calcium content (2.25%, DM basis), and, to prevent poisoning from excess calcium, no more than 4 kg DM of chicken manure/cow are given per day. This is equivalent to a calcium level of 1% of the animal's daily feed intake (NRC 1988)."},{"index":6,"size":33,"text":"The investment required to implement this option on a farm with an average herd of 47 cows in Esparza is about $6,000 (8.9 ha of Cratylia, 1.8 ha of sugarcane, and a chopper)."},{"index":7,"size":113,"text":"Figure 2 shows the real interest rate with which this investment can be paid, depending on cow productivity and assuming that the farmer devotes 50% of the marginal income received as product of this forage alternative. The real interest rate in Costa Rica is currently 13% (24% nominal interest; 11% annual inflation) and the maximum credit available is on a 5-year term with 1 year of grace. Under these conditions, the credit cannot be paid unless cows produce 2,000 kg per lactation. With a productivity of 1,500 kg per lactation, this credit can be paid if real interest is lower (between 5% and 10%) and the terms of payment longer (about 10 years)."},{"index":8,"size":53,"text":"This situation deserves attention from policy makers. If politicians put pressure on farmers to compete in open market economies, then farmers should have the option of lower interest rates that reflect the opportunity cost of money in the international market, currently at real interest rates between 6% and 9% over a 15-yr period."},{"index":9,"size":22,"text":"The implementation of this forage option does not release areas for other uses. It only replaces the use of externally purchased supplements."},{"index":10,"size":107,"text":"Brachiaria spp. + Cratylia argentea + sugarcane. Returning to Figure 1, the option to establish Brachiaria instead of jaragua grass and additionally establish Cratylia with sugarcane for dry-season feeding reduces milk production costs even more (from $0.27/kg to $0.18/kg, depending on the productivity of the milking cow). This option reduces production costs proportionally between 13% and 28%, compared with prevailing conditions on most of farms of the central Pacific region. Costs are reduced, not only because no supplements are purchased, but also because the area allocated to maintaining the same herd of 47 cows is lower, thus reducing the need for labor to maintain paddocks and fences."},{"index":11,"size":83,"text":"Figure 3 shows the percentage of pasture area released as a result of intensification caused by the establishment of these options. With this forage alternative, 27.5% of the area currently allocated to livestock could be released and still maintain the same herd size of 47 cows, that is, from 83 to 59.1 ha. The jaragua grass was replaced by 53.5 ha of Brachiaria, 4.6 ha of Cratylia, and 1.0 ha of sugarcane, thus releasing 23.9 ha that could be put to other uses."},{"index":12,"size":100,"text":"The investment required to establish these forage options was about $18,500. However, if farmers are to invest in these options, milk productivity per cow must increase under current real interest rates in order to pay back the credit (Figure 4). With current productivity levels, especially that of 1,500 kg per lactation, there is no way that credit can be paid. However, with a productivity level of 2,000 kg per lactation, a credit at the current 13% interest rate in Costa Rica may be paid, provided that the term be expanded from the current 5-yr period to one of 10 years."},{"index":13,"size":82,"text":"Brachiaria spp. + Arachis + Cratylia + sugarcane. All improved alternatives are established on the same farm. Milk is therefore produced at a lower cost compared with the other alternatives (dropping from $0.25/kg under prevailing conditions, at 1350 kg per lactation, to $0.17/kg, with a productivity of 2,000 kg per lactation). This option is 20% to 30% less expensive than jaragua grass + supplements. Furthermore, a larger area can be released away from livestock to other uses (36.5%, equivalent to 31.2 ha)."},{"index":14,"size":145,"text":"This investment involves the establishment of 47 ha to Brachiaria spp. in association with A. pintoi, 3.7 ha to C. argentea, and 1.0 ha to sugarcane, and requires $21,000. However, as with the previous alternative, a farmer who wants to establish these options cannot repay credit, except where productivity per cow is 2,000 kg per lactation and terms are about 10 years (Figure 5). With the current credit conditions of a real interest rate at 13% and payable in 5 years, these forage alternatives will not be adopted in Costa Rica, unless the capital to make these investments comes from the farmers' own income. The C. argentea + sugarcane alternative ($6,000/farm) would be the most feasible, but the other alternatives with Brachiaria spp. requiring investments of $18,500 to $21,000, would be almost impossible since these sums represent the farm net income of over 3 years."},{"index":15,"size":45,"text":"Stylosanthes species. The partial budget methodology was used for this alternative because the simulation model did not allow alternatives to be evaluated by animal category. The Tropileche Consortia is validating this forage alternative as a strategy for feeding pre-weaning calves, especially during the dry season."},{"index":16,"size":42,"text":"Based on preliminary data from Nicaragua (Soza and Fariñas 1997) and extrapolating to Costa Rica, Table 6 shows marginal profitability in using Stylosanthes to feed pre-weaning calves, assuming that the average farm with 47 cows produces 35 calves per year (Table 2)."},{"index":17,"size":107,"text":"Under management with Stylosanthes sp., 6.5 ha are required to feed these calves during the dry season period. The average weight gain per calf is 300 g/day (under traditional management, calves lose weight). The investment required is about $1,075/farm, for a marginal gain, at the end of the dry season, of close to $2,000 (i.e., $57/calf more than under traditional management). This alternative has more probability of being adopted because the initial investment is less and can be quickly recovered through calf weight gain (calves are sold at 8 to 10 months of age). The farmers can invest the resulting income without having to resort to credit."}]},{"head":"Nicaragua","index":10,"paragraphs":[{"index":1,"size":72,"text":"Prevailing situation. The situation in Esquipulas, Nicaragua, is similar to that of Costa Rica in that the forage alternatives evaluated significantly reduced production costs. Figure 6 shows milk production costs of different forage options, according to cow productivity. Under prevailing conditions, milk production costs are US$0.26/kg, while the price received is $0.22/kg. In other words, on selling weaned male calves, the farmer receives, overall, a break-even income, similar to the minimum wage."},{"index":2,"size":93,"text":"However, this situation could improve if cow productivity was higher. The nutritional quality of jaragua grass, as indicated in Table 5, is capable of maintaining cows producing up to 1,500 kg per lactation without additional supplements, during the rainy season, and cows producing 2,000 kg per lactation, given both energy and protein supplements, throughout the year. Even with jaragua grass, milk production costs can be reduced to as low as $0.20/kg, depending on pasture management (e.g., degree of cover, weed control, paddock rotation, shade, availability of water to animals, and appropiate resting periods)."},{"index":3,"size":21,"text":"Cratylia argentea + sugarcane. As in Costa Rica, this forage option completely eliminates the need for supplements during the dry season."},{"index":4,"size":67,"text":"Production costs are reduced by 31% (from $0.26/kg to $0.18/kg) with the current productivity per cow in the area, compared with those farms in Esquipulas that depend on jaragua grass and must use concentrate supplements during the dry period. Similarly, production costs can be reduced to as low as $0.14/kg with a productivity of 1,500 kg per lactation and to $0.12/kg with a productivity of 2,000 kg."},{"index":5,"size":56,"text":"In Esquipulas, the establishment of this forage option on an average farm with 29 cows would require an investment of about $4,600. This investment would cover the establishment of 5 ha of C. argentea, 2.4 ha of sugarcane, and the purchase of a gasoline-or diesel-powered chopper (rural electrification is scarce in this part of the country)."},{"index":6,"size":123,"text":"Figure 7 shows the real interest rates at which this investment could be paid, depending on cow productivity and assuming that the farmer allocates 50% of the marginal income resulting from this forage option to pay back the credit received. Nicaragua's current financial system offers an 18% annual real interest rate for agricultural credit, with a maximum term of 5 years. This forage option is not financially viable under these conditions, with the current levels of milk production. However, when cow productivity is 1,500 kg per lactation, paying credit under prevailing conditions is feasible, because real interest as high as 22% can be paid over a 5-year term. When the productivity level is 2,000 kg per lactation, the situation is still more viable."},{"index":7,"size":61,"text":"The Ministry of Agriculture/World Food Program (MAG-WFP) dairy development project grants credits to small-scale milk producers at a 10% real interest rate, payable over 5 years, although the maximum amount granted is $3,000/farm. This provides an excellent opportunity to foster and promote this forage option because it significantly improves the competitiveness and income of small-scale milk producers by reducing production costs."},{"index":8,"size":76,"text":"Brachiaria spp. + Cratylia argentea + sugarcane. This forage alternative reduces milk production costs at levels similar to the C. argentea + sugarcane option with current milk production levels of 1,000 kg, and even 1,500 kg, per lactation. As a result, at these levels of milk production, no incentive exists for choosing this forage option because capital investment is much higher than that required for the option without Brachiaria spp. (i.e., only C. argentea + sugarcane)."},{"index":9,"size":72,"text":"The capital investment required for this option is about $10,900 (39.1 ha to Brachiaria spp., 2.0 ha to C. argentea, and 1.0 ha to sugarcane) versus $4,600 for the C. argentea + sugarcane option. With production levels at 2,000 kg per lactation, production costs are reduced, compared with the C. argentea + sugarcane option ($0.14/kg versus $0.15/kg, respectively). However, this reduction is very small and does not compensate for the investment made."},{"index":10,"size":71,"text":"Nevertheless, this forage option frees 22.1% of the area currently under pastures (Figure 8), amounting to a net area of 7.9 ha that the farmer can devote to other uses (i.e., fruit, reforestation), which is not possible with the C. argentea + sugarcane option. Despite being expensive, the Brachiaria spp. + C. argentea + sugarcane option is therefore considered the most viable option for farms located in hillsides with steep slopes."},{"index":11,"size":113,"text":"Figure 9 shows the interest rate that a farmer can pay for credit to invest in this forage option. Because the price of investment is so high, paying the credit at current levels of production (i.e., 1,000 kg per lactation) would be impossible. However, it could be paid if the investment increases cow productivity by 50% (from 1,000 kg to 1,500 kg per lactation) and if terms for payment are extended to 10 years, at a real interest rate of 10%. With production levels at 2,000 kg per lactation, this forage option is financially viable because it would be possible to pay real interests between 10% and 20%, depending on the terms established."}]},{"head":"Brachiaria spp. + Arachis pintoi + Cratylia argentea + sugarcane.","index":11,"paragraphs":[{"index":1,"size":72,"text":"As in Costa Rica, this forage option involves the establishment of all alternatives. Milk is produced at a lower cost than that of all the other forage options considered in this study, decreasing from $0.17/kg with the current production level to $0.10/kg at 2,000 kg. This alternative therefore reduces production costs between 35% and 44%, compared with the prevailing situation in Esquipulas (i.e., jaragua grass supplemented with concentrates during the dry season)."},{"index":2,"size":63,"text":"To establish this alternative, each farm has to invest about $12,300 (29.8 ha to Brachiaria spp. in association with A. pintoi, 2.5 ha to C. argentea, 1.1 ha to sugarcane, and a chopper). This forage option frees 32.8% of the area currently under pastures and still maintains the same herd size (Figure 8). That is, 16.4 ha can be devoted to other uses."},{"index":3,"size":104,"text":"Figure 10 shows the real interest rates at which credit can be paid to establish this forage alternative. With current cow productivity at 1,000 kg per lactation, paying back a credit would not be feasible because of the high investment of capital, even with a 10-year term. However, this alternative could be financially attractive if production per cow is increased by 50% to 1,500 kg per lactation and with financing over 10 years and a real interest rate of 10%. Thus, under the current commercial banking conditions (a 5-year term and 18% real interest) it is not possible to adopt this technology thru credit."},{"index":4,"size":120,"text":"Stylosanthes species. Preliminary data on the use of Stylosanthes sp. for feeding pre-weaning calves were obtained from a farm in Esquipulas (Soza and Fariñas 1997). Using the partial budget methodology, Table 7 shows the marginal profitability of the use of this forage option. Under traditional management, pre-weaning calves remain grazing with the dam during the morning and are then separated in the afternoon under a roofed corral until the following day. The calves consume the equivalent to one-fourth of the udder plus the residual milk from milking. The alternative assessed consisted in introducing the calves to a paddock of Stylosanthes sp. during the afternoon and then spending the night in confinement, as under traditional management, until the next morning milking."},{"index":5,"size":104,"text":"Under traditional management, calves usually lose weight, especially toward the end of the dry season when the availability of both forage and milk is reduced. According to preliminary data obtained by Soza and Fariñas, the investment required to maintain 24 calves during the three most critical months of the dry season was $675, consisting in the establishment of 4.5 ha to Stylosanthes (1.5 ha per month). The daily weight gain was 300 g, in contrast to traditional management, where weight loss was 222 g/day. A marginal income of $47/calf ($1,128 per lot) was thus generated, equivalent to 42.7% more income than for traditional management."},{"index":6,"size":61,"text":"These data suggest that this alternative is extremely viable because the marginal income compensates the initial investment ($1,128 versus $675). This forage option can also be established without credit, especially in situations where the opportunity cost for family labor is low, as in the case of Nicaragua, since the open unemployment rate in the rural sector is estimated at about 52%."}]},{"head":"Peru","index":12,"paragraphs":[{"index":1,"size":72,"text":"The case of Pucallpa, Peru, differs from those of Costa Rica and Nicaragua. One characteristic is that the annual precipitation is higher (2,000 mm versus 1,200 mm in Costa Rica and Nicaragua) and more evenly distributed. The dry season in Pucallpa lasts only 3 months and not 6 as in Esparza and Esquipulas. As a result, no signifficant water deficit occurs in Pucallpa, enabling grass to grow throughout most of the year."},{"index":2,"size":66,"text":"Another important characteristic of Pucallpa is that milk production per cow is very low (3 kg/cow per day, Table 2), especially when considering that the dry season is practically nonexistent. This characteristic may be due to several factors: (1) low genetic potential of cows; (2) limited nutrient availability in the grass, resulting from high pasture degradation in low fertility soils; and/or (3) a constrained milk market."},{"index":3,"size":141,"text":"Daily fresh milk production in the area of Pucallpa barely reaches 2,500 L, and cattle numbers have dropped from 82,000 head of cattle in 1986 to the current 26,000 head as a result of activities of the Sendero Luminoso (\"Shining Path\") terrorist group and cattle rustling. The city of Pucallpa, with a population of 300,000 inhabitants, does not have a milk pasteurizer plant. As a result, milk consumption in Pucallpa is mostly in the form of evaporated milk imported from other Peruvian cities. The raw milk market is thus very small. Four of the nine farmers who collaborate with the Tropileche Consortia thought that if they increased milk production on their farms they would have problems marketing the extra milk. The other five farmers sell their milk to the \"School Milk Program\", a state project that provides milk for school children."},{"index":4,"size":146,"text":"Another factor that restricts the small market for raw milk is the substitution of protein sources in Pucallpa. One kilogram of dry matter (DM) of crude protein from \"chico\" fish of the Ucayali River is priced at US$2.90 throughout the year, while that of milk is $8.80. Protein from milk is therefore 303% more expensive than protein from fish. Cassava and rice are the main sources of energy, both being significantly cheaper than milk in DM equivalents. As a result, the raw milk market in Pucallpa is limited to the upper class population and its possibilities of growth are severely limited, unless a milk pasteurizer plant is established in Pucallpa to substitute the evaporated milk imported from Lima. The demand for locally produced milk will then increase, but at a price lower than the current price to compete with milk produced in other regions of Peru."},{"index":5,"size":91,"text":"Prevailing conditions versus the alternatives evaluated. Figure 11 shows milk production costs for the different forage alternatives evaluated in the study. Unlike other sites, the most profitable alternative (i.e., with the lowest costs) under prevailing conditions in Peru is the one currently used by farmers. The most competitive alternative is to maintain the herd on native pastures and provide, for the 3-month dry season, brewers yeast from the local beer brewery, a viable option because it is abundant, very cheap to transport, and nutritious ($0.15/kg DM, 22% CP, and 65% IVDMD)."},{"index":6,"size":44,"text":"With this alternative, milk production costs are $0.33/kg, and the price received by farmers is $0.32/kg. The income received for male calves allows the farmer to receive an income that is slightly more than the minimum wage, while milk income pays for variable costs."},{"index":7,"size":49,"text":"This alternative would also be the most attractive where cow productivity is 1,500 kg per lactation or even 2,000 kg. Neither did the forage alternatives Brachiaria + Arachis or Brachiaria + Cratylia succeed in reducing milk production costs to levels below those of native pastures supplemented with brewers yeast."},{"index":8,"size":95,"text":"On the assumption that brewers yeast may cease to be a viable option for supplementation, maize was evaluated as an alternative. Its price is currently $0.23/kg. For the alternative, Brachiaria + Arachis and/or Cratylia, to form part of the solution, and with the current milk production levels at 800 kg per lactation, maize prices must rise to $0.38/kg (a 65% increase) so that milk production costs equal those of the current alternative. With milk yields at 1,500 kg per lactation, maize prices must rise by 9% to equal the production costs of both alternatives evaluated."},{"index":9,"size":129,"text":"The main reason why none of the improved forage alternatives can compete with native pastures + brewers yeast is because of the high capital investment in relation to the percentage of milking cows in the herd, which induces a high pasture depreciation per cow. Pucallpa has 41% of the herd in milk while this figure is close to 60% in Costa Rica and Nicaragua (Table 2). To offset this effect, the percentage of milking cows in the Pucalpa herd must be increased throughout the year to a minimum of 53%, or the stocking rate must be increased from the current 0.9 AU/ha to 1.3 AU/ha by introducing more animals. Under current conditions, degraded native pastures cannot support these high stocking rates and the forage alternatives tested could become viable."},{"index":10,"size":131,"text":"From the financial viewpoint, Figures 12 and 13 contain the real interest rates that a farmer from Pucallpa would pay if he or she invested in any of these forage alternatives. Peru has the highest real interest rate of the three countries, with a real interest of 34% (44% nominal; 10% annual inflation). Even if the investment in these forage alternatives was economically superior, the real interest rate in Peru is so high that farmers would not have the option of intensifying production. They would not be able to pay the 34% real interest in any scenario (not even if cow productivity were 2,000 kg per lactation or terms of payment were over 10 years). In the best of cases, the highest real interest rate which could be paid was 15%."},{"index":11,"size":66,"text":"However, the advantage of establishing these forage alternatives in Pucallpa is that both options release significant areas of pasture for other uses, such as reforestation and/or conservation (Figure 14). In the case of Brachiaria spp. + C. argentea, the area released accounts for 35.4% (i.e., 20.2 ha) and, in the case of Brachiaria spp. + A. pintoi + C. argentea, it is 48.1% (i.e., 27.4 ha)."},{"index":12,"size":67,"text":"Stylosanthes species. The case of the Stylosanthes alternative is different because preliminary data obtained at Pucallpa (Vela 1997) show that this option is highly profitable for pre-weaning calves. In Pucallpa, the meat-to-milk price ratio is much lower (i.e., 3.1:1), thus much more favorable to milking cows, whereas, in Nicaragua or Costa Rica, this ratio is high (4:1), meaning that, in Central America, fattening calves is more profitable."},{"index":13,"size":107,"text":"Table 8 indicates that the investment required to feed eight pre-weaning calves is $680 (i.e., $85/calf) and the marginal income received was $720 from the additional milk sold. Calf weight gain was similar, whether with Stylosanthes or with the traditional system, but milk production (in the bucket) increased by 1 liter per cow (22%) per day. This technology may be readily accepted by small-scale farmers in the short term because it increases their incomes from milk sales without affecting calf development and using relatively small areas of Stylosanthes-based pastures. Consequently, this forage alternative is perhaps the only one in Pucallpa to have good possibilities of being adopted.        "}]}],"figures":[{"text":" matter; CP = crude protein; IVDMD = in vitro dry matter digestibility. . Biomass production in both the rainy and dry seasons in Pucallpa, Peru, was estimated to be 20% greater than in Costa Rica and Nicaragua for all forage alternatives because of higher rainfall.b.Equivalent to 20% of the biomass production during the rainy season. c.Equivalent to 25% of the biomass production during the rainy season for grasses and 100% for Cratylia and sugarcane. d.peru holmann file:///D|/Anderson/documentos/articulos/ex ante jlrrd/Ex-ante-JLRRD.html (13 of 26) [15-03-2000 9:19:34 AM] "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 2 . Averages of cattle inventory, milk production, and land use on dual-purpose cattle farms in Peru, Costa Rica, and Nicaragua (n = number of farms). Milk production 4.6 3.3 2.5 3.2 Milk production4.63.32.53.2 Beef production 3.7 3.9 2.5 2.9 Beef production3.73.92.52.9 Cattle inventory 3.2 3.7 1.6 0.6 Cattle inventory3.23.71.60.6 Area sown to pastures 1.4 0.6 0.6 0.2 Area sown to pastures1.40.60.60.2 SOURCE: FAO (1996).     SOURCE: FAO (1996). Variable  Peru Costa Rica Nicaragua VariablePeruCosta RicaNicaragua   (n = 9) (n = 7) (n = 4) (n = 9)(n = 7)(n = 4) Cattle inventory (no.)     Cattle inventory (no.) Milking cows  10.6 28.0 16.9 Milking cows10.628.016.9 Dry cows  20.1 19.3 12.0 Dry cows20.119.312.0 Heifers  21.9 16.1 14.5 Heifers21.916.114.5 Calves  15.7 35.1 15.3 Calves15.735.115.3 Bulls  1.3 2.0 1.3 Bulls1.32.01.3 Total animal units (AU) a  49.8 71.7 45.3 Total animal units (AU) a49.871.745.3 Daily milk production (kg)     Daily milk production (kg) Total  32.1 139.9 62.5 Total32.1139.962.5 Per cow  3.0 5.0 3.7 Per cow3.05.03.7 Milking cows (%)  41.5 60.1 58.5 Milking cows (%)41.560.158.5 Land use (ha)     Land use (ha) Native pastures  48.3 69.1 37.5 Native pastures48.369.137.5 Improved pastures  8.4 8.7 12.2 Improved pastures8.48.712.2 Agriculture  1.5 4.6 0.7 Agriculture1.54.60.7 Forest/fallow  17.7 9.1 2.3 Forest/fallow17.79.12.3 Total  75.9 91.6 52.7 Total75.991.652.7 Area under improved pasture (%)  14.8 11.2 24.5 Area under improved pasture (%)14.811.224.5 Stocking rate (AU/ha)  0.88 0.92 0.91 Stocking rate (AU/ha)0.880.920.91  "},{"text":"Table 3 . Prices (in US dollars) of resources and capital invested in dual-purpose farms in Peru, Costa Rica, and Nicaragua (n = number of farms).Includes social benefits, estimated at 24% for Peru, 43% for Costa Rica, and 17% for Nicaragua. .The capital invested was estimated at 50% of establishment cost, multiplied by the area in improved pastures on each farm. b.An average of 5,280 m was estimated for farms at Pucallpa, 7,580 m for Costa Rica, and 5,108 m for Nicaragua, at an average investment of $0.90/m with 4 wires separated by posts placed every 3 m. Variable Variable  "},{"text":"Table 4 . Direct production costs, gross income, net cash flow, and wages for family labor on dual-purpose farms in Peru, Costa Rica, and Nicaragua (in US dollars) (n = number of farms). Assessed as minimum wage and including social benefits.b. Based on direct production costs, multiplied by the percentage of total income from the sale of milk + culled cows, and estimated at 76.7% for Peru, 84.3% for Costa Rica, and 85.5% for Nicaragua. c. Gross income minus direct costs. d. Gross income minus direct costs and not including the opportunity cost for family labor. e. Net flow/farm per year, divided by the capital invested. Variable Variable  "},{"text":"Table 5 . Forage parameters used to run the model for dual-purpose cattle farms at different reference sites in Costa Rica, Nicaragua, and Peru. Parameters a Jaragua Brachiaria Arachis Cratylia Sugarcane Parameters aJaraguaBrachiariaArachisCratyliaSugarcane Duration of crop (years) 20 10 10 20 10 Duration of crop (years)2010102010 Rainy season      Rainy season Edible biomass production 2,500 3,500 1,000 2,000 10,500 Edible biomass production2,5003,5001,0002,00010,500 (kg DM/ha) b      (kg DM/ha) b CP (%) 8 9 20 15 3.5 CP (%)8920153.5 CP digestibility (%) 50 60    CP digestibility (%)5060  "},{"text":"Table 6 . Marginal profitability from using Stylosanthes guianensis to feed pre-weaning calves in Costa Rica. (Adapted from data bySoza and Fariñas, 1997.) . Variable Variable  "},{"text":"Table 7 . Marginal profitability from using Stylosanthes guianensis to feed pre-weaning calves in Nicaragua. (Based on data fromSoza and Fariñas, 1997.)  Variable Variable  "},{"text":"Table 8 . Marginal profitability from using Stylosanthes guianensis to feed calves in Pucallpa, Peru. (Based on data byVela, 1997.)  Variable Variable  "}],"sieverID":"52f84eb0-81c7-4a63-b7df-47d2eb6935b9","abstract":"The objective was to perform an ex-ante economic evaluation of new, legume-based forage alternatives available to farmers in Latin American tropical lowlands. These alternatives included grasses of the Brachiaria genus and the legumes Stylosanthes guianensis, Cratylia argentea, and Arachis pintoi. Case studies, involving farmers participating in the CIAT-led Tropileche Consortia convened by ILRI, were conducted in the forest margins of Pucallpa (Peru) and in the hillsides of the dry tropics of Esparza (Costa Rica) and Esquipulas (Nicaragua). A linear programming farm model developed by CIAT to maximize income was used for this analysis. Animal management parameters were based on farm averages at each reference site evaluated so that they represented current management conditions. Similarly, the model incorporated the prices of inputs and products typical of each country. A constant herd size was assumed for all alternatives evaluated. Production costs per kilogram of milk were estimated as the maximum expression of competitiveness, using three cow productivity parameters: the current average production per lactation (800 kg in Peru, 1,000 kg in Nicaragua, and 1,350 kg in Costa Rica); and two postulated parameters: 1,500 kg/lactation and 2,000 kg/lactation. For all forage options, key factors analyzed were (1) milk production costs resulting from implementing each forage alternative; (2) the investment required to establish each option, assuming the same number of milking cows and herd fertility; (3) the feasibility of obtaining credit with a local bank to invest in a forage alternative; and (4) the percentage of pasture area on the farm freed for other uses as a result of establishing one of the forage alternatives.Results indicated that the forage alternatives evaluated significantly improved the competitiveness of dual purpose farms in the hillsides of Nicaragua and Costa Rica, reducing the cost of producing milk between 13% and 37% with increased stocking rates, releasing up to 36% of area allocated to pastures. However, under current commercial banking conditions (real interest rates of 13% in Costa Rica and 18% in Nicaragua with payback periods of 5 years), the implementation of the options evaluated were not financially viable except for the establishment of Cratyla with sugarcane for dry-season feeding and Stylosanthes for pre-weaned calves. For all options to be implemented with commercial credit, a longer payback period was needed (8-10 years) and lower real interest rates (5-10%). The case of the forest margins of Pucallpa, was different, as none of the forage options evaluated, except Stylosanthes for pre-weaned calves, improved the competitiveness of farms under current management and production conditions due to low milk yields per cow and low proportion of herd in milk, which increased depreciation cost/cow to levels which were not viable. In addition, Pucallpa has an excess supply of forage biomass from a reduced herd inventory during the 80s and a limited fresh milk market which makes adoption of improved forages low attractive by farmers.peru holmann"}

data/part_1/0061ddf5f9975a7433b66302bd358944.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0061ddf5f9975a7433b66302bd358944","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H045043.pdf"},"pageCount":4,"title":"Eye Asia on Eye Asia on Food Water and Security Moving Towards Environmentally Sustainable Water Allocation in South Asia","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":312,"text":"In South-Asia, procedures for effective water allocation are not well-defined, and even if allocation is mentioned in water policies (e.g., India), it only lists \"allocation priorities\" or water sharing arrangements. Water allocation is understood by the clear and stable apportionment of a specified quantity of water, to a user or sector, with a specified security of supply that accounts for natural variation in water resource availability, and contains provisions for changing the allocation in times of low water availability. In South Asia, water use for agricultural growth as well as urban and industrial use have taken center stage and in some cases are exceeding the availability of renewable water. Agro-ecosystem dynamics and excessive infrastructural development have resulted in haphazard, over commitment of water. This particular approach to water resources management and development has led to significant degradation of various ecosystems (Pearce, Atkinson and Mourato, 2006;Falkenmark, Finlayson, Chiuta and Gordon, 2007). Sustainable allocation is important not only when most of the utilizable water has been depleted as in the case of basins such as the Krishna or Ganges in India but also in countries where water resources development is just beginning (e.g., Nepal). Furthermore, to address the challenge of producing even more food under uncertain climate conditions, clearly defined water allocation strategies will be needed. This paper highlights the need in South Asia for basin-wide water allocation plans that include environmental requirements. This paper also describes the application of a basin planning model (i.e., Water Evaluation and Planning model or WEAP) to assess present and alternative water management options which incorporate environmental flows in the Upper Ganges River in India (total area: 87000 km 2 ). The paper summarizes the environmental flow assessment methodology which was conducted through a multidisciplinary, multi-stakeholder approach (Building Blocks Methodology or BBM). This is the first time that a comprehensive environmental flows assessment has been done in India."}]},{"head":"Key Issues and Challenges","index":2,"paragraphs":[{"index":1,"size":143,"text":"Allocation of river water to cities, industries and agriculture has been a common practice in river basin planning and management and it is now widely accepted that water also needs to be allocated for aquatic environment-alongside the demands of other users. However, in South Asia, economically and socially or politically powerful users have comparatively well-developed methods for quantifying and justifying their water needs, and the ecosystems continue to be the silent and weak water user which have not yet received the required attention in water policies (Venot et. al., 2008). Minimum flows which consist of 10% of low flows continue to be the standard practice for environmental water allocation. Minimum flows however, do not fulfill the environmental requirements of rivers and can sometimes even harm riverine ecology during the dry season where the natural flows might be less than 10% of low flows."}]},{"head":"Environmental Flows Assessment","index":3,"paragraphs":[{"index":1,"size":261,"text":"The term \"environmental flows\" (EFs) is now commonly used to refer to a flow regime designed to maintain a river in some agreed ecological condition. EFs are not just about establishing a 'minimum' flow level for rivers. All of the elements of a natural flow regime, including floods and droughts, are important for protecting the characteristics and diversity of natural communities in a river. All components of the natural hydrological regime have a certain ecological significance. For example, high flows with return periods of 5 to 2 years ensure channel maintenance and riparian wetland flooding. Moderate flows occurring 30-60% of the time may be critical for cycling of organic matter from river banks and for fish migration. Low flows in the 70-95% exceedence range are important for fish spawning, algae control and use of the river by local people. In regulated basins, the magnitude, frequency and duration of some or all flow components is modified and the suite of acceptable flow limits for such modifications can ensure a flow regime capable of sustaining some target set of aquatic habitats and ecosystem processes. EFs can therefore be seen as a compromise between river basin development on the one hand and maintenance of river ecology on the other (Tharme, 2003, Smakhtin and Anputhas, 2006, Smakhtin and Eriyagama, 2008). Furthermore, in South Asia, rivers are widely revered and are an integral part of the culture and society. Therefore, the spiritual and direct social uses of the river are considered very important by the stakeholders and need to be integrated into the EFs assessment process."}]},{"head":"The Living Ganga Program","index":4,"paragraphs":[{"index":1,"size":139,"text":"Under the living Ganga program, which was coordinated by WWF-India, EF assessments were carried out under the current as well as future projected climate systems (WWF, 2012, Bharati, 2011). For this study, the Building Block Methodology (BBM) was selected for the assessment of EFs. This methodology allows the user to integrate local requirements, for instance, in case of River Ganga, the spiritual and cultural aspects are of immense importance and thus require due consideration. In addition to the spiritual and cultural aspects, the following sub-components were identified: Fluvial Geomorphology, Biodiversity, Livelihoods and Water Quality. The quantified EF requirements were then incorporated into a basin planning model (WEAP) to look at alternative management practices which assessed basin water re-allocation and the effect of adding EF requirements on water demands in the UGB under both the past and future climate conditions."},{"index":2,"size":72,"text":"The results obtained from this study show that the problem of unmet demands, i.e., not enough water for planned use, occurs only during the winter months of December and January under the past climate and during December, January and February under climate change projected data. Adding EF demand will also increase the unmet demands within the same winter months. During the other months, i.e., March-November, the unmet demands were under 5 MCM."},{"index":3,"size":77,"text":"As agriculture is the largest water user, scenarios with changes in agricultural practices were tested. Results showed that reducing crop type to less water intense crops was more effective in reducing unmet demands than decreasing the cropped area. Furthermore, decreasing water use by only 10% through better irrigation systems, reduced the unmet demands by 22% during the water scarce months. Therefore, investing in water saving technologies as well as increasing irrigation productivity could be good adaptation strategies."}]},{"head":"Conclusion","index":5,"paragraphs":[{"index":1,"size":88,"text":"With the increasing population in South Asia as well uncertain future climate conditions, the issue of balancing the needs of the freshwater ecosystems and other water users, becomes critical. As many countries are still in the process of developing infrastructure projects, it is important to also consider EF requirements in the planning stages. For basins, where all the utilizable water has already been allocated, assessment for re-allocation, which includes the environmental demand, is necessary. Effective water allocation frameworks will allow transparent and sustainable use of available water resources."}]}],"figures":[],"sieverID":"906c5a30-6825-4167-abf8-fd7ae9ba2a1d","abstract":""}

data/part_1/006d70b0ed6157ef024e1407672b0860.json

@@ -0,0 +1 @@
+{"metadata":{"id":"006d70b0ed6157ef024e1407672b0860","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f8893902-9de2-4170-88ca-10b4b5070c8d/retrieve"},"pageCount":1,"title":"Study #3103 Contributing Projects: • P263 -RPL EA: Regional and national engagement, synthesis and strategic research • P12 -ILRI Mitigation in livestock systems and LED pathways","keywords":[],"chapters":[],"figures":[],"sieverID":"e81dd872-e839-4fc5-82dc-da65c8a475cb","abstract":""}

data/part_1/010d77b7c7bbd0572188521f06e61f83.json

@@ -0,0 +1 @@
+{"metadata":{"id":"010d77b7c7bbd0572188521f06e61f83","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/deff6461-ae5d-40a7-8e9f-f3fb932b69ab/retrieve"},"pageCount":6,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":25,"text":"La incorporación de árboles en pastizales tiene un potencial significativo de mitigación. Sin embargo, actualmente dicho potencial se encuentra inhibido por obstáculos logísticos y normativos."},{"index":2,"size":27,"text":"En ALC, en particular, los SSP permanecen en gran medida sin definir. Esto ha restringido la generación de datos coherentes, contrastados, transparentes y precisos sobre las actividades."},{"index":3,"size":43,"text":"Por consiguiente, el potencial de retención y la espacialización de los SSP no se refleja bien en los inventarios nacionales de GEI y contribuciones nacionales en los sectores de ASOLU a las metas de las NDC se encuentran subestimadas u omitidas por completo."},{"index":4,"size":42,"text":"Los datos concernientes a actividades sobre el terreno mejorarían la exhaustividad, precisión y comparabilidad de los sistemas de reporte, por lo que se permite una documentación más precisa del avance nacional hacia el cumplimiento de los compromisos con el Acuerdo de París."},{"index":5,"size":44,"text":"Existen herramientas para la generación de información de excelente calidad y a bajo costo, como Collect Earth Online, que se encuentran fácilmente disponibles. Países como Colombia, Panamá y Perú han aprovechado ya esta oportunidad para la generación de datos sobre sus actividades en SSP."},{"index":6,"size":46,"text":"Es posible efectuar una alineación regional para abordar la producción de datos sobre actividades en SSP y se ha propuesto que los 3 países formen un comité de trabajo conjunto que desarrolle directrices técnicas para definir SSP y diseñar y acreditar encuestas efectuadas con Collect Earth."}]},{"head":"MENSAJES CLAVE","index":2,"paragraphs":[{"index":1,"size":83,"text":"\"El Nivel 1 requiere datos de actividades específicas por país, pero utiliza los factores de emisión por defecto del IPCC. El Nivel 2 utiliza métodos similares a los del Nivel 1, pero requiere el uso de algunos factores de emisión específicos para la región o el país. El Nivel 3 requiere datos de actividades de alta resolución combinados con datos muy desagregados de reservas de carbono recopiladas a nivel nacional o local y repetidos a lo largo del tiempo\". (Rosenstock et al., 2016)."},{"index":2,"size":11,"text":"siendo poco comprendidos en términos de emisiones y secuestro de carbono."},{"index":3,"size":128,"text":"Los países de ALC reconocen la oportunidad presentada por el potencial de mitigación de los SSP y han incluido acciones significativas de mitigación en sus NDC y Acciones Nacionales Apropiadas de Mitigación (NAMA, en inglés). No obstante, hay limitados logros en la mejora de los datos. Intervenir en estos temas es urgente para toda la región, siendo el sector ganadero clave en las emisiones AFOLU de la región. Mejorar el MRV y la precisión de las estimaciones de GEI de los SSP puede ayudar a dar visibilidad a las contribuciones ya existentes frente los objetivos climáticos nacionales, mostrar oportunidades para el desarrollo e implementación de estrategias y políticas sostenibles adaptadas al clima en toda la región y, por último, permitir un mayor alcance de metas de las NDC."},{"index":4,"size":59,"text":"En el año 2019, los Programas de Investigación del CGIAR en Cambio Climático, Agricultura y Seguridad Alimentaria (CCAFS) y en Ganadería (Livestock) reconocieron la necesidad de fortalecer el reporte sobre el componente basado en las tierras (landbased) de prácticas ganaderas a nivel regional, con el propósito de consolidar las estrategias y políticas regionales existentes, así como de diseñar nuevas."},{"index":5,"size":143,"text":"Un grupo técnico de trabajo conformado por expertos de 18 países evaluó la visibilidad y el reporte de los sistemas silvopastoriles (SSP) en los sistemas de MRV (Monitoreo, Reporte y Verificación) en toda la región. Se revisaron definiciones, metodologías e inventarios de GEI del sistema de reporte de los 18 países (Suber et al., 2019), evidenciando que muchos de estos usan prácticas deficientes de reporte basadas en valores de tipo Tier 1 (ver cajón de texto lateral). Los SSP se reportaron como tierra de pastoreo bajo \"pastizal\" o \"tierra cultivada\", sin cuantificar los 3 componentes debido a desafíos definicionales, metodológicos y técnicos, señalando así los límites del planteamiento y la necesidad de mejorar los conjuntos de datos. Para abordar estos temas, el grupo de trabajo elaboró una hoja de ruta de corto a mediano plazo para responder a tres preguntas estructurales y paralelas:"},{"index":6,"size":36,"text":"(1) La necesidad de establecer una definición oficial Que fuera un software de código abierto para permitir continuidad en el manejo de la herramienta y para obtener datos estandarizados a largo plazo. Requerimientos de capacidad técnica."},{"index":7,"size":32,"text":"Estandarización de datos para asegurar: y Que cada país maneje su propia información mediante el disocio de la generación de resultados a partir del acceso a información restringida por derechos de autor."},{"index":8,"size":11,"text":"y Flexibilidad de la herramienta para leer datos en software gratuito."}]},{"head":"EcoSer: para análisis espaciales y evaluaciones de servicios ecosistémicos","index":3,"paragraphs":[]},{"head":"Collect Earth:","index":4,"paragraphs":[{"index":1,"size":6,"text":"para evaluaciones de cobertura del suelo"}]},{"head":"AGB LIDAR:","index":5,"paragraphs":[{"index":1,"size":43,"text":"también para evaluaciones de cobertura del suelo y operativa de SSP; (2) la necesidad de mejorar la información especial con datos de actividades de Nivel 2 o 3 y (3) la necesidad de desarrollar factores de emisión nacionales de Nivel 2 o 3."},{"index":2,"size":94,"text":"Aún no se han desarrollado trayectorias de cambio de uso del suelo con SSP y su creación dependerá del establecimiento de definiciones operativas de SSP, la disponibilidad de herramientas de manejo de datos y la disponibilidad de datos de buena calidad y bajo costo. Comenzamos abordando estas 3 piezas fundamentales seleccionando y evaluando 3 herramientas que permiten generar conjuntos de datos espacialmente explícitos: Para Colombia, Panamá y Perú, los expertos nacionales en SSP y MRV evaluaron mediante análisis FODA la conveniencia de cada herramienta para cada país por separado, considerando las siguientes prioridades básicas:"},{"index":3,"size":23,"text":"Foto: CIFOR/Kate Evans A pesar de la excelente calidad de información que puede generar AGB LIDAR, varios problemas impiden su aplicación en SSP:"},{"index":4,"size":21,"text":"ECOSER aún se encuentra actualizando sus metodologías y la discontinuidad de la herramienta no alienta a adoptarla con fines de MRV."}]},{"head":"Collect Earth tuvo el mejor desempeño con los análisis","index":6,"paragraphs":[{"index":1,"size":36,"text":"FODA, aunque es posible que dependa fuertemente de trabajo en el campo para obtener información de buena El alto costo asociado con el uso de imágenes de RADAR restringe la generación de datos con cobertura nacional."},{"index":2,"size":23,"text":"La saturación de la señal de datos de sensor óptico con vegetación densa restringe la identificación de biomasa (Jinling Song et al., 2017)."},{"index":3,"size":21,"text":"Solo árboles dominantes o aislados se pueden identificar correctamente, lo cual reduce su aplicabilidad a sistemas de MRV (García Alonso, 2012)."},{"index":4,"size":13,"text":"Se requiere de amplia capacitación para operar el modelo y procesar los resultados."},{"index":5,"size":11,"text":"Es simple, flexible y no requiere conocimiento previo de sensores remotos."},{"index":6,"size":30,"text":"Ya existe conocimiento técnico; la herramienta actualmente está en uso a nivel local en Colombia y para la generación de información espacial para el Método 3 en Panamá y Perú."},{"index":7,"size":35,"text":"Utiliza imágenes de alta resolución ya disponibles de manera gratuita, así como un catálogo completo de alta resolución (Landsat, Sentinel 2 y MODIS), lo cual permite hacer mejoras, incluso cuando los fondos asignados sean limitados."},{"index":8,"size":109,"text":"Gracias a la estandarización de la máscara de entrada de datos, la información puede ser generada por diferentes usuarios mediante procedimientos comunes. A nivel regional, existe una red de usuarios del sector público de países con biomas similares que hablan un mismo idioma, que permite compartir lecciones aprendidas y ayudarse a solucionar problemas técnicos. calidad. Su testeo para la identificación de SPS en cada país ha demostrado que: Foto: CCAFS/JL Urrea Los países deben priorizar la creación de grupos interministeriales de trabajo. Dichos equipos deben liderar la iniciativa de manera holística para mejorar todas las estadísticas nacionales e informar los factores de emisión en la medida de lo posible."},{"index":9,"size":41,"text":"Todas las medidas de mitigación concernientes a SSP deben estar alineadas con el inventario nacional de GEI. Esto requiere la identificación de cada categoría del IPCC en el sector AFOLU, donde se incluyen los SSP, y que se reporten como tal."},{"index":10,"size":35,"text":"La identificación y participación de todos los actores nacionales/ regionales en la formalización de los datos de actividades de los SSP será crucial para contar con información para la formulación de políticas nacionales y regionales."},{"index":11,"size":43,"text":"Incorporar una cuantificación precisa del potencial de secuestro de carbono en los inventarios nacionales de GEI permitiría a los tomadores de decisiones la definición de acciones de carácter financiero, político y programático, informadas y adaptadas a la realidad local (Aynekulu et al., 2019)."},{"index":12,"size":119,"text":"Para progresar de Tier 1 a Tier 2 y 3, se requiere aumentar recursos y capacidades, lo que se traduce en un aumento de presupuesto. Las tecnologías existentes, tales como Collect Earth, permiten generar datos de excelente calidad a bajo costo para un monitoreo asequible de los sistemas de uso de la tierra. Aún así, la calidad de los datos depende del conocimiento del usuario sobre el sitio evaluado y de la presencia de características fácilmente identificables, aparte de la altura de las plantas (Rosenstock et al., 2018). Es por esto que los países han identificado la necesidad de involucrar a expertos locales en los procesos de identificación como primer paso de verificación, luego completado por actividades en campo."},{"index":13,"size":142,"text":"La colaboración a escala regional podría reforzar y alinear países individuales en la definición de SSP. El comité de trabajo conjunto propuesto a nivel regional constituye el primer esfuerzo impulsado por los países para fomentar una comprensión operativa, común y sólida de los SSP. Además que permitirá diseñar una estrategia regional para abordar los vínculos de las emisiones de la ganadería con el cambio climático desde múltiples ángulos. También proporcionará un espacio institucionalizado, en donde actores sectoriales de distinta naturaleza puedan ofrecer recursos y capacidades únicas, con lo que se reduciría la carga al sector público y se impulsaría el reporte a nivel nacional. El éxito de esta iniciativa dependerá del desarrollo de protocolos estandarizados para la identificación de SSP en el ámbito nacional o quizá regional, aplicable por cualquier tipo de actor en la interpretación en imágenes espaciales relacionadas con SSP."},{"index":14,"size":29,"text":"La información generada podría alimentar directamente las NAMA sectoriales y estrategias de bajas emisiones en la identificación de áreas de intervención y en la promoción de medidas de mitigación."}]},{"head":"Conclusiones","index":7,"paragraphs":[]},{"head":"Recomendaciones e implicaciones","index":8,"paragraphs":[{"index":1,"size":46,"text":"Establecimiento de un comité experto asesor para promover el fortalecimiento entre países para el MRV de SSP (Parte responsable: institución nacional a cargo de compilar y presentar informes ante la CMNUCC). Desarrollo de directrices técnicas sobre la definición de SSP (Parte responsable: expertos nacionales e internacionales)."},{"index":2,"size":37,"text":"Diseño, concientización e implementación de las encuestas Collect Earth con el fin de establecer conjuntos de datos de actividades de los países (Parte responsable: todos los actores involucrados en el manejo de datos terrestres del sector ganadero)."}]},{"head":"2 3","index":9,"paragraphs":[{"index":1,"size":34,"text":"Los países señalaron la necesidad de respaldar con personal local para apoyar a los equipos nacionales y regionales para confirmar y, de ser el caso, rectificar la clasificación de datos de parcelas poco claras."},{"index":2,"size":61,"text":"Al reconocer la oportunidad de alineación regional, se propuso un comité de trabajo conjunto para (1) el diseño y homologación de encuestas de Collect Earth, (2) el fortalecimiento de las habilidades técnicas nacionales, (3) apoyo en el establecimiento e interpretación de la definición de SSP, apoyándose en consideraciones sobre los ecosistemas y las características físicas. Se identificaron 3 fases de actividades:"}]}],"figures":[{"text":"  "},{"text":"  "}],"sieverID":"9b61b5f8-8b87-4862-9155-c6401e1c74d2","abstract":""}

data/part_1/0131c9a4af12a57ad75aec4b09651837.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0131c9a4af12a57ad75aec4b09651837","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e53dd63f-f9ff-47bb-9d74-a610055ba612/retrieve"},"pageCount":2,"title":"Achieving climate smart coffee in Bushenyi, Uganda","keywords":[],"chapters":[{"head":"Climate Smart Coffee has a future in Bushenyi","index":1,"paragraphs":[{"index":1,"size":171,"text":"Within the global context, coffee production in Uganda was projected to be less affected than elsewhere, and within Uganda, the South West, including Bushenyi, may be less affected than other regions. Thus, the region is likely to not only remain suitable for both Arabica and Robusta production, but be a relative winner of global climate change. Nevertheless, future climate conditions will be unlike the historic climate conditions. Using observed trend data, and climate model projections, we confirmed that the seasonal distribution of rainfall will continue to become more extreme due to an increase of rainfall in the rainy season. Increasing temperatures are likely to increase water demand by the crop, but annual precipitation increases appear to outpace the increase in water demand. Coffee farmer's perceptions describe more detailed changes, which could not be confirmed using data analysis. For example, the perception of a late onset of the rainy season seems to be caused by recent events in years, but no long-term trend could be shown. Permanent link of this brief: https://hdl.handle.net/10568/106172"}]},{"head":"Community based adaptation to climate change","index":2,"paragraphs":[{"index":1,"size":200,"text":"We identified priorities for adaptation using a participatory workshop approach. In multiple replications, we discussed the current cropping calendar with local farmers and extensionists, and identified potential to increase the resilience of farms through known cropping practices. With the 5Q approach -a simple concept to collect data-using interactive-voice response calls for building evidence knowledge, attitudes and skill, we collected feedback from 200 coffee producers about CSA practices adoption. Results showed about shade trees, for example, that 82.4% of farmers had heard about the practice and 83.3% of the ones that heard about it implemented them on their farm in the last year. Among the benefits of the practice, 63% of the farmers thought it especially good for better soil water retention. Farmers in the region already know these practices, so interventions towards better adaptation can leverage existing experiences, and seem to have a good understanding of the purpose and general benefits of GAPs. Most frequently mentioned constraints for their application were lack of labor, funds or knowledge. We also found that households optimize their practice portfolio depending on farm size and demographics. View the results of farmers' feedback about practices using the 5Q approach for Terracing, Mulching and Shade Tree."}]},{"head":"Recommendations for interventions","index":3,"paragraphs":[{"index":1,"size":61,"text":"■ Technical workshops/trainings on how and when to train/bend coffee bushes. ■ Future service deliveries, e.g. workshops, trainings or provision of materials should focus on practices like shade tree planting and management, trenching, mulching and cover crops, which are most suited to mitigate potentially negative impacts, because there are gaps in theoretical and technical knowledge. Some examples on services deliveries are:"},{"index":2,"size":30,"text":"-Training on benefits of shade trees for general and extreme climatic conditions and technical guidance on the choice of shade tree species and shade tree management for optimizing canopy cover."},{"index":3,"size":63,"text":"-For soil erosion control: Information on when to best establish and manage trenches and workshops for knowledge transfer on benefits of cover crops ■ Changing seasons require data based guidance for planting decisions. Seasonal forecast models need to have the skill to guide the timing of practices with a lead time of about four weeks, and need to be delivered using accessible means."},{"index":4,"size":17,"text":"Observed increase of precipitation during the main rain season in Bushenyi: about 100mm/year on average since 1980."},{"index":5,"size":32,"text":"For more information on the study contact: Dr. Christian Bunn ([email protected]) https://climatesmartcoffee.csa.guide/ Climate model projections for Bushenyi. Dots show the range of rainfall projections, lines the mean future temperature Representative cropping calendar."}]}],"figures":[],"sieverID":"3a0188f5-2afe-43f8-9960-6508ea1b5d3c","abstract":"We make recommendations for future service deliveries to help farmers make the most of the opportunities from climate change.■ Global climate models project relatively favorable conditions for coffee production in the future in Bushenyi, compared to other global coffee regions with worse impacts.■ Future projections and observed trends show higher precipitation and increasing temperature, despite farmers reporting higher rainfall uncertainty, a perception that appears to be influenced by recent variability.■ Climate-smart GAPs, specifically shade tree planning and management, trenching, mulching and cover crops play a crucial role in mitigating negative impacts from climate change.■ Current, insufficient implementation of adapted farming practices is a reflection of significant barriers.■ Workshops, trainings or provision of materials should therefore focus on these practices.Coffee is a key cash crop for thousands of households in Bushenyi, Uganda. Because there is mounting evidence that climate change will affect global coffee production negatively, coffee sector actors are increasingly ready to engage in adaptation efforts. This document provides an evidence based prioritization of interventions to support coffee farmers in Bushenyi to adapt to climate change."}

data/part_1/01472f9b6eb77c0f234c97b13cc0bd78.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01472f9b6eb77c0f234c97b13cc0bd78","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5172093c-7ee6-4166-b559-860bc4d48f1a/retrieve"},"pageCount":63,"title":"36 OrgamzatlOna! Structure for ProJect Management as Outhned m Proposa!s 37 Budget FormulatlOn foc Proposa!s 38 Wntmg StyJe for Proposa!s liI 4 O How to Prepare Cootracts, Progress and EvaluatlOD Reports for Donors 4 1 ObJectlves 4 2 Background 4 3 Contractmg 4 4 Progre ss Reportmg and ProJec! MOnltormg 45 EvaluatIon 4 6 End-of-ProJect Reportmg s O CIA T Internal Pohcles 5 1 ObJecllves 5 2 Background 5 2 I Intemal ProJect Profile 522 Technlcal and Management Revlew and Pnontlzmg ofProJee! Ideas 53 Roles and ResponslblhlIes 5 3 I Roles and ResponSlbIlltles of the ProJect Development and ProJeet Support Ofuces In ProJect Deslgn and AdmmlstratlOn 54 Overvlew ofthe ProJee! IdentlficatlOn, Pnontlzmg and Implementabon Process 55 Approval Responslblhtles for ProJect Ideas, ProfiJes and Proposals 56 Responslblhtles for Proposal Preparatlon 57 CIA T GUldehnes for Costmg ProJee! Budgets 571 Indlree! Costs 572 Personnel Costs 573 Hotel AccommodatlOn for Conferences 574 Slmultaneens TranslatlOn Costs for Conferences 575 Datly Rental Rate for Conferences Rooms 576 Vehlcles Lease 577 ProvlslOn for PubhcatlOnslDocumentatlon 578 Photocoples 579 Mlaml Offiee Purchases 5 7 10 TelecommunlcatlOnslFax Charges 5 7 1I Alrfares (1995) 57 12 Inflatlon 58 Techmcal And Management Revlew of Draft Proposals 59 CIA T OrgamzatlOn 510 Relallonshlp between Core and Complementary Funde<! Projects","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":14,"text":"• 1'0 mcrease the relevance, Impact, effectlVeness and efficlency of CIA T's research andtrammg"},{"index":2,"size":30,"text":"• To provlde mcreased accountablhty and VlSlblhty for donar funds by developmg lmpact onented proJccts that mtegrate developmental relevance to donor pnonttes wlth CIAT's strateglc research mterests and NARS' pnonlles"},{"index":3,"size":52,"text":"• To provlde a mechanlsm that enables a resource moblhzatton strategy to be rntegrated wlth ¡he research strategy of CIA 1'5 Strateglc Plan 1 2 Background 1 2 1 Core Vernus Complementary Fundmg CIA T recelves donor fundmg m three dlfferent ways, each of WhlCh IS or potenttally can be proJcct based"},{"index":4,"size":10,"text":"• Unrestrlcted core (untlcd donar contrlbutlons to Implementthe approved mldtermplan)"},{"index":5,"size":15,"text":"• Restrlcted eore (donar contrtbutlons to Implement a speclfic par! of tIle approved mld-term plan)"},{"index":6,"size":19,"text":"• Complementary (donor contrlbuttons for speclfic proJects tIlat are related to, but usually not mcluded m the mld-term plan)"},{"index":7,"size":5,"text":"1 2 2 Donor Trends"},{"index":8,"size":34,"text":"• TradltlOnal CGIAR donors are facmg constant or decreasmg ODA budgets al horne and pressure to slllft resourees to mltlate oew programs (e g ,for Eastern Europe and the republtcs ofthe former Soviet Untan)"},{"index":9,"size":23,"text":"• The number of IARCs has IOcreased from 13 to 16 resultmg m mcreased competttton amoog the centers for donar CG core fundmg"},{"index":10,"size":32,"text":"• There 15 mcreaslOg eompetltlon among eenters for speclal proJectfundmg (usually lhe donor's geographlc desks or envlronmental programs) WIlh lhe tradlttonal donors beca use mas! centers have no! dlverslfied Ihelr donar base"},{"index":11,"size":14,"text":"• Mosl centers have nOI aCllvely approached non-tradltlonal donors sueh as the prlvate sector"},{"index":12,"size":126,"text":"13 ProJects Tbe Hub oC ActlVIty Donors are mcreasmgly mterested m fundmg well-deslgned proJec!s thal generale tangible OUlputs wllh mensurable Impac! m finlte pertods oftlme In turn, by structunng lIs research along proJect 1mes, CIA T can mamtam a hlghly fleXible and dynamlc research program Iha! can respond lo lhe expecta!10nS and pnon!les expressed by the COlAR, CIA T'5 natlOnal and regIOnal chent\" and donors and potenllal mvestors m CIA T By orgamzmg research along proJec! Imes, CrA T mtroduced a total budget approach to fundmg lhese proJects Budgets for core and complementary proJects are mtegrated, !bus enabhng staff and managemenl lO better ascertalO the real cost of any actlvlty, report expendltures foraudltmg, aVOld meffiClenCles 10 resource ullhzatton and Identlfyconstramts on outputs, and assess proJect performance"},{"index":13,"size":7,"text":"The movetowards proJectlzatlOn Wl n result m"},{"index":14,"size":5,"text":"• decentrahzallOn of operatlonal declSlonsandaccountablhty"},{"index":15,"size":49,"text":"• entrepreneurshlp for fundmg proJects • Most bilateral and multllateral donors utlhze a proJect deslgn approach based on sorne verSlOn of a logleal framework analysls and a work breakdown structure of proJect actlvltIes Tbe comblOed LF AlWBS framework faclhtates not only proJcct deslgn but also progress reportmg and evaluatlon"},{"index":16,"size":100,"text":"• Tbe loglcal framework analysls approach to proJect deslgn IS a plannlOg process WhlCh spcctfies the program or sector goal, !he speclfic proJcct purpose, the outputs, mputs, the obJectlvely venfiable mdlcators fOf measunng!he attamment orthe goal, purpose, outputs and mputs, the means of venficatlOn of !hese mdlcators, and !he cntlcal assumptlons over WhlCh the proJect team has no control bul may mfluence !he project The logleal framework matrlx 15 a one or two page ovefVlew of lhe proJect whlch summanzes thls deslgn mformatlOn Acttvltles are not hsted m !he LF A smce they are provlded m !he work breakdown structure"},{"index":17,"size":66,"text":"• The work breakdown 5tructure IS a systematlc process of breakmg down a proJect mto hlerarchlcal levels of work, gradually reducmg!he scope and complexlty of the work packages or actlvltles unlll the deslred levells reached It can be summanzed In a one page graphlcal presentallon of!he proJect WhlCh Imks the goal, purpose and outputs defmed m the LF Ato spcclfic proJect actIvltlCS 2 3 ProJect Deslgn "}]},{"head":"I","index":2,"paragraphs":[{"index":1,"size":68,"text":"The purpose refers to the antlClpated effect whlch IS expected as a result of produemg the proJeet outputs It 15 the Immedlate obJectlve whlch descrIbes the mtended Impact of lhe proJec! on the dlrect beneficIarles, but IS beyond the dlrect control of the proJeet team smce I! relIes on how the beneficIarles wlll make use ofthe prOJee! outputs There should only be one ImmedIate proJeet obJectIve or purpose"},{"index":2,"size":33,"text":"The outputs are the speclfic kmds of results that can be expected from the good management oftne proJect mputs and acltvltles The proJeet team should be held accountable for the productlOo oflhe outputs"},{"index":3,"size":17,"text":"The mputs are the resources (funds, personnel and goods) thal are needed for the producuon ofthe outputs"},{"index":4,"size":55,"text":"The mdlcators are parameters, preferably those that can be quantlfied, whlch venfy the achlevement ofthe goal, purpose and outputs The mdlcators should define attamment m terms oftarget group (for whom), type of output (what), quantlty (how mueh), quahty (how good), time (by when) and 10catlOo (where) The mdlcators provlde a basls for mOOltonng and evaluatlOn"},{"index":5,"size":46,"text":"The means oí venfkatlOn should speclfy both the mstrument for measunng the mdIcator and the sources of mformallOn necessary to use the mdIcators (e g , quesllOnnalres and strucrured mlervlews the results of whlch are found m Mmlstry statIstlcal reports, proJect techmcal and financlal progress reports)"},{"index":6,"size":73,"text":"The crItIca! assumpbons are tne evenls or condltlons over whlch the proJect tcam have httle control but whlch must be assumed to eXIst Ifthe mputs are to be apphed, the outputs dehvered, and the obJectlves achleved These extemal faetors determme Ihe nsks of the proJeet They elarIfy and set the hmIts ofresponslbIhty for the proJect management Unsuccessful proJeets may be due to    What IS the mnovatJve contnbutJon of thlS proJect to strateglc research?"},{"index":7,"size":39,"text":"After achlevlng the output of thlS proJect, what else needs to be done to produce an output that can be utlllzed by ulbmate users (farmers)? Who wlll do It? How long wllllt take? What IS the probablhty of success?"},{"index":8,"size":171,"text":"If thls proJect produces an mtermedlate output, such as an Improved method or Informabon, how and how much wllI thls output contrlbute to achlevmg an output for ultJmate users? (e 9 WIU speed up research by X years willlOcrease probablllty of success from 40% to 50%) 30f20 How much wlIl the output of thls proJect contrlbute to Increased productlvlty or sustamablhty? (Be spec\\fic W1lllncrease Ylelds x kgs wlll reduce 5011 eroslon by x amount?) Who are the potentlal userslbeneficlarles (both short and long term) from the output of thls proJect?   In sorne cases, thefe may be a proJect team as50cIated wlth overseemg the proJect The team may COnslst of several CIA T staff members from dlfferent prograrus or sClentlfic resource groups along mlh partlClpants from olher research mstItutes, should lt be a consortlum proJect For most proJccts, CIAT mil be the lead partner and mil marntam Ihe contractmg and reportmg responslblhty mlh Ihe donor CIAT may, however, sub-contract to other consortlum members for tmplementmg speclfic components or actlvltles of Ihe proJect"},{"index":9,"size":51,"text":"The     Sample CIAT ProJect Experlence Sheet  The ProJect Officer mus! first ldentlfy the ratlOnale or underlymg assumptlOns for each maJor budget Item For example, the number offull-tIme staff(semor staff, research a~soc¡ates, asSlstants, techrucJans, bllmgual secretanes, V1SltIng SClenllsts) should be estlmated along Wlth an estlITlated number oftnps armually forthe semor staff mvolved"},{"index":10,"size":150,"text":"The ProJect SUpporl Office \"'111 then provlde the mos! recent standard cost to be used m estlmatIng Ihe budget reqUlrernents for each category of staff assoclated Wlth the proJect (e g, for semor StaffthlS Wlll be anaverage cost tlJat mcludes salary, housmg allowance, officlal vehlcle, schoolmg for dependents, medIca! msurance, retlIernent contrlbutlons, and paId home leave) See Secuon 57 forthe 1995 CIAT budget gUlde for proJect mputs SI1llllarly, the ProJeet Officer should IdentIfy and document the assumpuons (1 e , number of partIclpants and length of stay) for any conferences and trrunmg actlv¡ues to be conducted as par! ofthe proJect The ProJect Support Office Wlll provlde the PrOJect Officer wlth per dlern rates tlJat can be used for conferences held at CIAr (assummg partIClpants are lodged at CIA 1's hotel) and the monthly al!owanees and benefits for tramees and V1SItlng sClentIsts See Seeuon 5 7 for the 1995 CIAT rates"},{"index":11,"size":61,"text":"The ProJeet Support Office Wll! also provlde estlmates that can be used to cover hbrary acQUlSlt10ns and the preparatlon of speclaltzed trammg matenals These v.111 be based on a small pereentage ofthe overall proJeet eosts Sorne donors reqwre a proJect budget by maJor actlvlty not Just by standard obJeet of expendlture In Ihese cases, the ProJect Support Office  • End-of-ProJcct Report"},{"index":12,"size":175,"text":"The fonnat for tbe reportmg will be dlscussed by tbe ProJcct Support Office and the donor and WIII hopefully be speclfied m the contraet Reportmg WlII usually be  The evaluatlon plan and mdlcators for measunng (he success of the proJect should be ldentlfied In the proJcct proposal as should the budget for any plarmed evaluatIOns Most proJects have an end-of-project evaluanon In addmon, sorne large proJects lastmg 4 years or longer may have a mld-term evaluatlOn It IS the responslblhty of the Project Support Office to coordmate any donor proJect evaluatJ.ons ProJee! evaluatlons usually deal Wlth lSSUes of proJect rattonale, efficlency, effecttveness and Impact Examples of evaluatlon quesnons related to each of these maJor Issues are shown m Figure 14 A sampfe formal for the outhne of an evaluatlon report 15 shown m Figure 15 4 6 End-of•ProJect Reportmg Sorne donors reqUlre the 5ubmlSSlOn of an end-of-proJect report It 15 the responslblhty of the ProJect Officer, \\\\11th mput from the proJect staff, to prepare these reports accordmg 10 gmdehnes provlded by the ProJect Support Office"},{"index":13,"size":27,"text":"In the case where the donor does not speclf'y the reportmg format to be used, Figure 16 IS a gUlde for the preparatlon of an end-of-proJect report"},{"index":14,"size":6,"text":"Sample of an Evaluatlon Report Qutlme "}]},{"head":"ACIATGUIDEFOR PROJECTIDENTlFICATION, DESIGN, APPROVAL ANO ADMINISTRA TlON","index":3,"paragraphs":[{"index":1,"size":33,"text":"• To define the procedures for obtammg mternal CIA T approval for a speclal proJect Idea and to ascertam donor mterest m prmclple before work on a detalled proposalls commenced 5 2 Background"},{"index":2,"size":116,"text":"• CIA T has adopted a three phase process for proJect approvals The first step of program staff IS to obtam CIA T management approval for the Idea I(self and the second 15 to obtam donor mterest-m-prmclple for the pre-proposal or concept note The thlrd step IS approval for the detalled proposal Thls process ensures CIA 1's DDG, Research and OG have an overvlew of all maJor proJect Ideas bemg consldered for speclal proJect fundmg and the tentatlve targetmg of donors for these proJect Ideas The process fOfthe Internal reVlew and pnontlZlng of project Ideas 15 IUustrated In FIgure 17 5 3 Roles and Responslblhtles   ProJects normally follow a cycle whlch mc/ude the followmg actlVltles     Id\"-lpIdoVJg-l1\"\" "}]}],"figures":[{"text":"• Figure 2 "},{"text":"( Be speclfic what countnes ecosystems, how many ha ?)What NARS or other partners are supportmg CIAT to produce thlS output?Name who In NARS or other partners has glven exphclt support to proJect? How long wllllt take te produce proJect output?What IS probablhty ofsuccessfully producmg deslred output ofthls proJect wlth expected resources and m time frame speclfied aboye? (\"lo) Has thls proJect Idea been i dlscussed wlth a donor representatlve? Who? When? What was the response? What other donor could thls proJect donor be presented to? Why IS mterest expectedCIAT would be mvolved m proJect? "},{"text":" To develop thls Idea mto a successful proposal, what needs to be done m the next SIX months? Who would do It? By when? (e 9 , draft proposal, VISI! speclfic donor or partner ) Leaders, Umt Heads, or SRG Leaders who sponsor thls proJect as a prlorlty for thelr area Please fill out the attached work breakdown structure for the proJect "},{"text":" Figure 4 "},{"text":"/Figure 6 Sample Abbrevlaled CV5 of CIAT Projee! Offieer and proleel coordtnators al !he collaboratlng partners "},{"text":" Ir iJoy¡g..... 1(H/ P\"\" I Dn<>1\"... Offi "},{"text":" Figure 7 "},{"text":" Figure 9 SAMPLE CIAT CV "},{"text":" Figure 10 "},{"text":" Figure 13Sample Llst of Contents for ProJect Progress Reports "},{"text":" three to fourpage overvlew oftheproJect Idea forpresentatlOn to CIAT management A sample format was lllustrated In FIgure 3 ofSecllon3 S 2 2 Technlcal and Management Revlcw and PnontJzmg oCProJect Ideas "},{"text":" \"i:T«';')his titute tertU ,. ttte \".cen ., IIr.¡«t ¡tienliliuti*n .' 1411 the .jltllr*II.'.( ¡lIIt.' t.r .. ' .... I.tt ,.r extetn.l funlhn, eltCnllllns U •• t •••• ,,.*¡ect ,t.td«l.f I«n f~n $tl',.\" •• 1'1.1 hi\\l'lI!: ,. ,.m thr.t.I!Jh lhe: f1ír.,cct ;l-' '«'.rt'.U_ M.~.!Jtmtnt Gr.u,. lhey COlI' l .e luanllltellllirectl1 t. the: IIG-It:tutch inti I~n t. th« le wh. h.lle'JI u!Jnln!J iutl'l.t!ty' f.t súllHnlttln, Ih~ (.nce,. n.tc t. the •• n.f. "},{"text":" POrtfOllO Management Group pnontlzes tbe proJeet profites subm Itted by Program and SRG leaders • The Program OperatlOns Comrnlttee 15 responslble for approvmg the pnontlzed prOJect Ideas submltted by the PPMG and Iben rnakmg a recornmendatlon to Ibe DIrector General for those proJects exceedmg $200,000 total lo CIA T or more Iban $80,000 per year • The DIrector General has the final responslblhty for the approval ofthe Idea for large proJecls and then forwardmg Ibe profite 10 a prospectlve donar to ascertam mteresl -mprmclple • The ProJect Development Office provldes advICe to the program staff on the development oflbe proJeet profile, coneept note lo the donor, and the final propasal to the donar The PDO uses desktop pubhshmg software for both the coneept note and full proposal The PDO wlth asslstance from Ibe SClcn!ls! also prepares Ibe cover lelter from the DG lo the prospectlve donar 53 1 Roles and RespoDslb¡llhes ofthe ProJect Development and ProJect Support Offiees ID ProJect Deslgn and AdmlDlstratloD CIA Thas two speclahred offices, !he ProJect DevelopmentOffice and the ProJect Support Office, !hat provlde program staff WlthSUpport set:Vlces durmg!he planrung and nnplementauon of proJccts "},{"text":"Figure 20 CIAT Figure 20 CIAT Techmcal and Management Review of Full Proposals "},{"text":" Figure 21 CIAT Organization Chart "},{"text":"¡ha Sample Forages for Smallholders ProJect Loglcal Framework Matrlx OblectlVely Means of Verlflable Verlficatlon Indlcators     Figure 1 Figure 1  Loglcal Framework Matnx for ProJect Deslgn Loglcal Framework Matnx for ProJect Deslgn Narratlve Summary Narratlve ObJechvely verlflable Means of verlficahon Important Cfltlcal AssumptlODs Beyond the Control of Narratlve Summary NarratlveObJechvely verlflableMeans of verlficahon ImportantCfltlcal AssumptlODs Beyond the Control of Summary  mdlcators Assumptlons the ProJect TeaJll SummarymdlcatorsAssumptlonsthe ProJect TeaJll Program goal    Program goal The reason for Ihe proJool Ihe destred end toward WhlCh the Increased ammal Measures uf goal ftChU:vémént Cond.lIons wh.ch w.1I md.care Ihat Government staltstlCS The way !ha! the mdJcators can That Improved forage Goal produclIon &RRA technology wllI be efforts are d.rected (program or Ihe goal has been ach.eved be obJectlvely ventied sector goal) and for wh.ch Ihe (e g Government StahstJcs) To Increase agrlcultural productlvrty and soll Improved forestry and simple cos! effectlve Government statlstlcs agroforestry sys!ems and adopted by , &RRA smallholders Assumphons for AchlCVtng Goal The reason for Ihe proJool Ihe destred end toward WhlCh the Increased ammal Measures uf goal ftChU:vémént Cond.lIons wh.ch w.1I md.care Ihat Government staltstlCS The way !ha! the mdJcators can That Improved forage Goal produclIon &RRA technology wllI be efforts are d.rected (program or Ihe goal has been ach.eved be obJectlvely ventied sector goal) and for wh.ch Ihe (e g Government StahstJcs) To Increase agrlcultural productlvrty and soll Improved forestry and simple cos! effectlve Government statlstlcs agroforestry sys!ems and adopted by , &RRA smallholdersAssumphons for AchlCVtng Goal The way tbat lhe mdlcators can be obJeCllvely verotied Governmenl slallsllcs Tbe obJcctJvely vertfiable condltton Improved crop productlvlty 10 leylfallow Effectlve Informatlon &RRA transfer lo systems smallholders by Less rapld runoff & Reduced eroslon 10 natlonal extenslon RRA seNlces IS achleved uplands RRA complctcd successfully and on The .ntlc.pared bonetil lo be ach.cved I f Ihe proJeel OS sustamabiirty on smallholder farms In Southeast ASia wh.eh .s expected lo .Xlst If the (e g End of-proJecl aud Increased farm t.me aud Ihe oulputs proYlded by dlsposable Income Evalualion Reports) proJect achleves Its purpose The the proJec! are actually uuhzed by s'gns wh.eh wlll md,cale Ihat the the mtended beneficiarles proJect 15 a success Purpose New torages Inspecllon of test sltes Satlsfactory Assumptlons for Ach.evlOg Purpose The way tbat lhe mdlcators can be obJeCllvely verotied Governmenl slallsllcs Tbe obJcctJvely vertfiable condltton Improved crop productlvlty 10 leylfallow Effectlve Informatlon &RRA transfer lo systems smallholders by Less rapld runoff & Reduced eroslon 10 natlonal extenslon RRA seNlces IS achleved uplands RRA complctcd successfully and on The .ntlc.pared bonetil lo be ach.cved I f Ihe proJeel OS sustamabiirty on smallholder farms In Southeast ASia wh.eh .s expected lo .Xlst If the (e g End of-proJecl aud Increased farm t.me aud Ihe oulputs proYlded by dlsposable Income Evalualion Reports) proJect achleves Its purpose The the proJec! are actually uuhzed by s'gns wh.eh wlll md,cale Ihat the the mtended beneficiarles proJect 15 a success Purpose New torages Inspecllon of test sltes SatlsfactoryAssumptlons for Ach.evlOg Purpose Outputs The .poclll0 kmd of results Iha! are expected fram ¡¡oad other upland systems tralned local staff Magnolude of Dulpu!s The parameter and magnllud. nf Ihe results and !he proJccted complellOn dales mputs agroforestry and Commltted and well managemenl of the proJe.1 Introduced to proJect and RRA T o Increase the avadablhty of adapted forages and the Ihem to dlfferent farmlOg systems In particular smallholders and RGs forages by Reports from ProJect The way tnat the mdlcators can be obJectlvely ventied (e g Progress Report.) cooperatlon wlth New awareness 01 capaclty lo dehver areas and adopted by farmers RG's and related Adopllon as assessed byRRA prOJects AssumptlOns for Ach.evmg Dulputs Outputs The .poclll0 kmd of results Iha! are expected fram ¡¡oad other upland systems tralned local staff Magnolude of Dulpu!s The parameter and magnllud. nf Ihe results and !he proJccted complellOn dales mputs agroforestry and Commltted and well managemenl of the proJe.1 Introduced to proJect and RRA T o Increase the avadablhty of adapted forages and the Ihem to dlfferent farmlOg systems In particular smallholders and RGs forages by Reports from ProJect The way tnat the mdlcators can be obJectlvely ventied (e g Progress Report.) cooperatlon wlth New awareness 01 capaclty lo dehver areas and adopted by farmers RG's and related Adopllon as assessed byRRA prOJectsAssumptlOns for Ach.evmg Dulputs Inputs Outputs Types of Resources Inputs OutputsTypes of Resources Forages avallable for Supenor forages Book of Supenor vanetles Forages avallable forSupenor foragesBook ofSupenor vanetles dlfferent ecoreglons Idenllfied  recommendatlons can be sourced In dlfferent ecoreglonsIdenllfiedrecommendatlonscan be sourced In and farmlng systems Forages Integrated New agroforestry and forage-crop systems pubhshed and dlstnbuted forage genebc resource centers and farmlng systems Forages IntegratedNew agroforestry and forage-crop systemspubhshed and dlstnbutedforage genebc resource centers Inlo smallholder adopled by farmers Rapld Rural Appralsal Socloeconomlc nsk Inlo smallholderadopled by farmersRapld Rural AppralsalSocloeconomlc nsk • Program staft' deslgnmg proJccts should first prepare a loglcal rramework analySls farrl1lng systems Local staff tralned In Nos of local slaff factors that prevenl Reports from RG tramed supeNlsors change • Program staft' deslgnmg proJccts should first prepare a loglcal rramework analySls farrl1lng systems Local staff tralned In Nos of local slaff factors that prevenl Reports from RG tramed supeNlsors change as shown m FIgure I forage agronomy and Effecllve technology transfer commumcatlon wlthln Tbe goal refers to the broad program or sector goal to whlch the proJCCI IS expected lo RG asslgns staff Newsletlers and regional meetlngs held CooperatlOn of RG contnbute It represents a development obJectlve Informatlon system on proJecl reglon agencies Slx-monthly and forage R&D Outputs and actlVltles AnnualReports Adequate fundmg as shown m FIgure I forage agronomy and Effecllve technology transfer commumcatlon wlthln Tbe goal refers to the broad program or sector goal to whlch the proJCCI IS expected lo RG asslgns staff Newsletlers and regional meetlngs held CooperatlOn of RG contnbute It represents a development obJectlve Informatlon system on proJecl reglon agencies Slx-monthly and forage R&D Outputs and actlVltles AnnualReports Adequate fundmg Efficlenl proJect achleved on schedule  Efficlenl proJectachleved on schedule management    management     30f7 30f7  "},{"text":"Ie Forages for Smallholders ProJect Work Breakdown Structure Llnklng ProJect Acttvltle5 to ProJect Outputs and Components Program Goal  •-1 To Increase agncultural productlvity and 5011 sustalnablllty : , , , , •-1 To Increase agncultural productlvity and 5011 sustalnablllty :, ,, , on smallholder farrns m Southeast ASia \"\"\"oc! Pu...... To Increase the avallablllty of adapted forages and the ~ J j   on smallholder farrns m Southeast ASia \"\"\"oc! Pu...... To Increase the avallablllty of adapted forages and the ~ J j capaclly lo dellver thern lo dlfferent farmmg syslems In   capaclly lo dellver thern lo dlfferent farmmg syslems In particular, agroforestry and other upland systems   particular, agroforestry and other upland systems Efficlent ProJect Efficlent ProJect Management, Management, MOnltormg and MOnltormg and Evaluatlon Evaluatlon ¡. Revise deslgn based on ¡. Revise deslgn based on donor and NARS donor and NARS suggesllons  suggesllons ¡. F Inahze conlracl wllh ¡. F Inahze conlracl wllh donor   donor ¡. Admlnlsler subconlracls ¡. Admlnlsler subconlracls Wllh olher Inslllullonal Wllh olher Inslllullonal partners   partners ¡. Submll lechnlcal and ¡. Submll lechnlcal and financlal progress financlal progress reports lo donor reports lo donor  "},{"text":"avallable Forages mtegrated 1 Local staft tramed Informabon ~ • Eftlclent proJect • for dlfterent mto smallholder m forage agronomy systems on forage ¡:. management • ecoreglons and J and technology R&D e farmmg systems farmmg systems transfer and momtormg outputs sectlon of Ihe LF A provldes Ihe Imk lo lbe WBS The WBS IS a graphlcal presentatlOn or block dlagrarn whlch groups the proJect acllvltles around lbe speclfíc proJectoutputs   Date Apnl 1995   Date Apnl 1995   A CIAT GUIOE FOR   A CIAT GUIOE FOR I1 --~=-~~~~=~~~~~~~~---41   I1 --~=-~~~~=~~~~~~~~---41 The broad level of actlVltles Idenufied then serves as tbe haslS for mOOltormg the proJect  The broad level of actlVltles Idenufied then serves as tbe haslS for mOOltormg the proJect ImplementatlOn, preparmg both the techmcal and financlal progress reports to the donar,  ImplementatlOn, preparmg both the techmcal and financlal progress reports to the donar, and provldmg tbe framework for mld-term andlor end-of-proJect evaluatlOus   and provldmg tbe framework for mld-term andlor end-of-proJect evaluatlOus 8elecllOn ollorages Dellvery ollorage syslems 8raff development Inlormallon systems ProJecI Management 8elecllOn olloragesDellvery ollorage syslems8raff developmentInlormallon systemsProJecI Management   ,   , po Assassment of local forage systams ' \" fl' Inlroducllon of forages • ~ ~ ~ ..\" ~ Evaluabon m dlfferent agroecosystems L¡. Multlpllcabon of promlsmg specles ~ Annual regional pro¡ect ~ Dn-slte meetlngs management communlcsllon readmg ~ Liaison and 1+ RRA of farmlng systems ~ Engllsh language tralnlng to anable ¡.. Partlclpatory evaluallon mira-regional of foragas by farmers ~ Preparabon of PIO and furlher study cornmumcstlon wlth other seclors and po Intemal monrtonng ~ Farmer tralmng In forage managemenl and pro¡ects wlthm counlnes revlew and annual ~ Tralmng In uttllzallon plan preparatlon partlclpatory R&O methodology ~ Creahon of regional L¡. Oevelopmenl of forage R&O network + ProJecl financlal po Assassment of local forage systams ' \" fl' Inlroducllon of forages • ~ ~ ~ ..\" ~ Evaluabon m dlfferent agroecosystems L¡. Multlpllcabon of promlsmg specles~ Annual regional pro¡ect ~ Dn-slte meetlngs management communlcsllon readmg ~ Liaison and 1+ RRA of farmlng systems ~ Engllsh language tralnlng to anable ¡.. Partlclpatory evaluallon mira-regional of foragas by farmers ~ Preparabon of PIO and furlher study cornmumcstlon wlth other seclors and po Intemal monrtonng ~ Farmer tralmng In forage managemenl and pro¡ects wlthm counlnes revlew and annual ~ Tralmng In uttllzallon plan preparatlon partlclpatory R&O methodology ~ Creahon of regional L¡. Oevelopmenl of forage R&O network + ProJecl financlal  multlpllcatlon and L¡. Tr¡¡lImng m forage  management and multlpllcatlon andL¡. Tr¡¡lImng m foragemanagement and  dlstnbutlon systems tor agronomy  reporllng to AlOAS dlstnbutlon systems toragronomyreporllng to AlOAS  seed/vegetabve matenal    seed/vegetabve matenal Pro¡ Jlxw~Ojfia     Pro¡ Jlxw~Ojfia 1 ~tklftpr lbon     1 ~tklftpr lbon rHOWTO DESIGN PROJECTS  7of7  rHOWTO DESIGN PROJECTS7of7  "},{"text":"PROJECTIOENTIFICATION, 11- OESIGN,APPROVALANO How to Prepare Internal ProJect Profiles, Concept Notes to Donors, and Full Proposals 3 1 ObJechves   • comprehenslveness m terms of addresslOg Ihe maJor areas donors expect lO see m • comprehenslveness m terms of addresslOg Ihe maJor areas donors expect lO see m  AOMINISTRATION any proposal (e g ,justlficatlon and antlclpated Impact on target beneficlanes, gender AOMINISTRATION any proposal (e g ,justlficatlon and antlclpated Impact on target beneficlanes, gender  Impllcabons, relevan! mstltulIOnal and proJectteam quahficatlonsand expenence, Impllcabons, relevan! mstltulIOnal and proJectteam quahficatlonsand expenence,  project management orgamzalIOn, roles andresponslbliltles methodology outpU!S and project management orgamzalIOn, roles andresponslbliltles methodology outpU!S and  aCtIVltles, ImplementatlOn schedule, budget, reportlOgand evaluatlOn plan) aCtIVltles, ImplementatlOn schedule, budget, reportlOgand evaluatlOn plan)  • clantv and conclseness m how the proposalls wntten (It should be underslandable • clantv and conclseness m how the proposalls wntten (It should be underslandable  by both general Ists and speclahsts) by both general Ists and speclahsts)  • vlsuallmpact of page layout and graphlcs presentatIOn so as to make II easy for lhe • vlsuallmpact of page layout and graphlcs presentatIOn so as to make II easy for lhe  • To provlde an overv!ew ofthe mternal revlew and subrnISSlOn process for proJect reader to follow • To provlde an overv!ew ofthe mternal revlew and subrnISSlOn process for proJect reader to follow  proposals requestmg spectal proJect fundmg proposals requestmg spectal proJect fundmg 3 3 Internal ProJect Profiles 3 3 Internal ProJect Profiles  • To provIde gUldelmes to prograro staff for fue preparatIon of detalled propasal, • To provIde gUldelmes to prograro staff for fue preparatIon of detalled propasal,  Prior 10 preparmg a detalled proposal, program staff should fiest prepare a 3 or 4 page Prior 10 preparmg a detalled proposal, program staff should fiest prepare a 3 or 4 page  mternal proJect pro file mc1udmg a Work Breakdown Slructure A sample formal IS mternal proJect pro file mc1udmg a Work Breakdown Slructure A sample formal IS 3 2 Background shown m FIgure 3 Thls wIIl be revlewed by Ihe Program Leader and the Dlrectors to ensure conslsteney wllh the CIA T and ca mlSSlon and lo sel pnontles for fundmg ralsmg, 3 2 Background shown m FIgure 3 Thls wIIl be revlewed by Ihe Program Leader and the Dlrectors to ensure conslsteney wllh the CIA T and ca mlSSlon and lo sel pnontles for fundmg ralsmg,  Sorne donors rely on a peer revIew to evaluate proposals based on fue followmg entena If II IS a specIaI proJeet Sorne donors rely on a peer revIew to evaluate proposals based on fue followmg entena If II IS a specIaI proJeet  • scIenuficmentlqualtty • scIenuficmentlqualtty 3 4 • relevance to mtematlOoal development 3 4• relevance to mtematlOoal development  • umovatIon • umovatIon  • potentIal to enhance the eapaclty of developmg countnes to conduct mnovatlve • potentIal to enhance the eapaclty of developmg countnes to conduct mnovatlve  research research  Other donors estabhsh an m-house evaluatlon 100m to evaluate large btlateral proposals Other donors estabhsh an m-house evaluatlon 100m to evaluate large btlateral proposals  The team normally conslst, of ooe or two sector speclaltsts who focus 00 Ihe techmcal The team normally conslst, of ooe or two sector speclaltsts who focus 00 Ihe techmcal  mertt of the proposal, a country desk afficer who IS usually a genera]¡st mterested m the mertt of the proposal, a country desk afficer who IS usually a genera]¡st mterested m the  developmeotal relevance oflhe prOjeCI' and a managernent specIaltst who facuses 00 the developmeotal relevance oflhe prOjeCI' and a managernent specIaltst who facuses 00 the  orgamzatlOnal and finanCIal aspects ofthe proposal orgamzatlOnal and finanCIal aspects ofthe proposal  The evaluatlOn tearo may use a pomt system or gnd to evaluate the proposals based on The evaluatlOn tearo may use a pomt system or gnd to evaluate the proposals based on  • relevan! tnstttutIonal expenence • relevan! tnstttutIonal expenence  • quahficatlons and relevan! expencnce of the proJect team • quahficatlons and relevan! expencnce of the proJect team  • techmcalmentlmefuodology • techmcalmentlmefuodology  • costs • costs  Donors recelve conSlderably more proposals lhan fuey can fund Consequently, propasa!s Donors recelve conSlderably more proposals lhan fuey can fund Consequently, propasa!s  mus! be of exceptIonal qualtty morder to compete successfully ThIS means propasals mus! be of exceptIonal qualtty morder to compete successfully ThIS means propasals  shouldhave shouldhave  • tecbDlcal qualtty m terms of ¡he defimtlOn of fue prob!ern, Its dcvelopmcntal relevance • tecbDlcal qualtty m terms of ¡he defimtlOn of fue prob!ern, Its dcvelopmcntal relevance  and raltonale and the proposed solutlon or mefuodology to solve!he problem and raltonale and the proposed solutlon or mefuodology to solve!he problem  "},{"text":"Concept Notes to Donors  Figure 3 Figure 3 Date Apn/1995 Date Apn/1995 INTERNAL PROJECT PROFILE FOR MANAGEMENT INTERNAL PROJECT PROFILE FOR MANAGEMENT APPROVAL OF NEW IDEAS APPROVAL OF NEW IDEAS Implementmg Program or Umt Implementmg Program or Umt Project Officer Project Officer ProJectTltle ProJectTltle ProJect Purpose ProJect Purpose The project eoncept note should be sent lo the donor agency to aseertalO mterest-m- The project eoncept note should be sent lo the donor agency to aseertalO mterest-m- prIncIpie and fundmg aV311ablhty before any work on a detaIled proposal for a speclal prIncIpie and fundmg aV311ablhty before any work on a detaIled proposal for a speclal proJeet commences A sample format IS shown m FIgure 4 Development Ratlonale proJeet commences A sample format IS shown m FIgure 4 Development Ratlonale IdenllficatlOn of problem and IÍs Importance How WtU thls proJect output contnbute to IdenllficatlOn of problem and IÍs Importance How WtU thls proJect output contnbute to 35 Proposal Format overcomlOg the problem? 35 Proposal Format overcomlOg the problem? Many donors have speclfic gUldehnes forprepanng proposalsand the gUldehnes Wltbm Many donors have speclfic gUldehnes forprepanng proposalsand the gUldehnes Wltbm each agencymay dlfferdependmg on the program each agencymay dlfferdependmg on the program Wlnle donor gUldelmes may vary, there are usually elements or components whlch Wlnle donor gUldelmes may vary, there are usually elements or components whlch vlrtually all donors expectto find 10 a proposal For those cases where donors do no! vlrtually all donors expectto find 10 a proposal For those cases where donors do no! supply speclfic proposa! gUldelmes, staff should ensure the followmg componentsarc supply speclfic proposa! gUldelmes, staff should ensure the followmg componentsarc ll1Cluded ll1Cluded • Tltle Page, Table ofContents Llst ofTables, FIgures, Appendlces, Aeronyms • Tltle Page, Table ofContents Llst ofTables, FIgures, Appendlces, Aeronyms • Execu!Ive Surnmary or Abstract • Execu!Ive Surnmary or Abstract • Background and RatlOnale • Background and RatlOnale • ProJect DescnptlOn • ProJect DescnptlOn • lmplementatIOnSchedule • lmplementatIOnSchedule • ProJect OrganIza!Ion and Management • ProJect OrganIza!Ion and Management • Budget • Budget • Reportmgand Control • Reportmgand Control • EvaluatIOn Plan • EvaluatIOn Plan  "},{"text":" CIAT ProJcct Development and ProJect Support Offices do not fulfill Ihe functIon of proJect management That rests mlh the ProJect Officer appomted from one of CIAT5 programs The ProJect Officer 15 responslble for drafung the mltJal proposa!, overseemg Ihe techrucallmplementatlOn of Ihe proJect and ensunng It 15 done mthm budget and on schedule, and draftmg Ihe techrucal progress reports to Ihe donar Apnl 1995 Apnl 1995 Figure 5 Figure 5 CHECKLlST CHECKLlST For Proposals belng submltted to ProJect Development Offlce For Proposals belng submltted to ProJect Development Offlce * These gUldelmes are for CIAT proposats where the donor has not ISSUed thelr own gUlde- * These gUldelmes are for CIAT proposats where the donor has not ISSUed thelr own gUlde- tmes for proposals tmes for proposals ~ Check that appropnate sectlon has been tncluded ~ Check that appropnate sectlon has been tncluded PROPOSAL ORGANIZATION (Prmted VerslOfl) PROPOSAL ORGANIZATION (Prmted VerslOfl)  "},{"text":"Table of Contents and Mise Llsts o Provlde lable 01 conten!s list 01 figures tables appendlces and acronyms Budget Budget o Consult PrC:Ject Support Office (Controller's Office) for o Consult PrC:Ject Support Office (Controller's Office) for  • Appropnate budgel format and line Items • Appropnate budgel format and line Items  • Standard unrt cosls (personnel vehlcle lease land use etc) • Standard unrt cosls (personnel vehlcle lease land use etc)  • InflaMn rate far years 2 and hence • InflaMn rate far years 2 and hence  • Apphcable Indlrect cost recovery rate • Apphcable Indlrect cost recovery rate  • Budget provlslon for PubhcatlonslDocumentalton (publtshlng and dlstnbutlng of research findlngs • Budget provlslon for PubhcatlonslDocumentalton (publtshlng and dlstnbutlng of research findlngs  acqulsltlon 01 books journals data base searches) acqulsltlon 01 books journals data base searches)  • Budget provlslon for Tratntng (preparatlon 01 tralmng matenals and delivery of tralmng per dlems and • Budget provlslon for Tratntng (preparatlon 01 tralmng matenals and delivery of tralmng per dlems and  travel 01 Instructors and tralnees) travel 01 Instructors and tralnees) O State any sub-contractlng provlslon wrth Instltutlonal partners OState any sub-contractlng provlslon wrth Instltutlonal partners O State rallonalelassumpllon for each maJor budget Ilem OState rallonalelassumpllon for each maJor budget Ilem Exeeutlve Summary Exeeutlve Summary  Oevelopmental relevance pnontles Ior NARS and expected benefits/lmpact Oevelopmental relevance pnontles Ior NARS and expected benefits/lmpact O Relevance lo donor pnonl19s ORelevance lo donor pnonl19s O Comparallve advantage 01 CIAT and consortla partners OComparallve advantage 01 CIAT and consortla partners PrOJect Desenpbon PrOJect Desenpbon O Locallon and general descnpllon Includlng goal purpose targa! groupS oulputs Inputs obJecllvely OLocallon and general descnpllon Includlng goal purpose targa! groupS oulputs Inputs obJecllvely  venfiable mdlca!ors and cntlcal assumpllons (Ioglcal lrama matnx) venfiable mdlca!ors and cntlcal assumpllons (Ioglcal lrama matnx) O End of-prOJect slatus OEnd of-prOJect slatus O Melhodology and descnptlon 01 maJor actlvllles Reler lo Work Breakdown Structure (WBS) figure linkmg OMelhodology and descnptlon 01 maJor actlvllles Reler lo Work Breakdown Structure (WBS) figure linkmg  actlVltles to outputs actlVltles to outputs O Implementatlon lime tablelduratlon 01 proJect (refer to chronogram 01 actlvltles whlch speclfies mllestones OImplementatlon lime tablelduratlon 01 proJect (refer to chronogram 01 actlvltles whlch speclfies mllestones  In Appendlces) In Appendlces) O Cross sectoral deslgn I.sues (gender Imphcatlons envlronmentallmphcatlons) and spln-off opportuntltes OCross sectoral deslgn I.sues (gender Imphcatlons envlronmentallmphcatlons) and spln-off opportuntltes O Future sustamabllity of the proJec! (plans 10 ensure some acltvrtles contmue even after donor lundmg ler OFuture sustamabllity of the proJec! (plans 10 ensure some acltvrtles contmue even after donor lundmg ler  the proJect ceases) the proJect ceases) ProJect OrganlZatlon and Management ProJect OrganlZatlon and Management O Speclfy roles and responslblhtles lor each Instltutlonal partner the executlng agency and lar lhe ProJect OSpeclfy roles and responslblhtles lor each Instltutlonal partner the executlng agency and lar lhe ProJect  Officer paslllon Officer paslllon  "},{"text":" Ihe dner Iroplcal and Ihe subtroplcal areas of Ihe world Ihrough Ihe mtroductlOn of preseleoled eassava germpla.m from Brazd ObJectlves to reduce food defiotts m margInal areas uf the dner troplCS Wlth spectsl emphasls on sub humld and semI and sub Saharao AfTIoa lo broaden the geoetlc base of the mlemallUoal cassava colleehoo by colleclmg aod evaluallllg the Brazlhan germplasm and developmg lmproved populatloos adapled lo Ihe dnor troples and the subtroplCs cassava germplasm tU the dner reglOlls of Northeast BraZl] evaluatIng cassava germplasm In Sltes In Brazll developmg ehle plant populatloos Ihrough tradmonal aod advaoced breedmg techruques traosfernog lmproved populallons lo Afnea ASla aud Latm Ameno. Ihrougb the mternahonal cassava network CIAT's role CIAT IS Ihe lead partner responglble for overan proJee! maoagement donor I OEVELOPMENT OF CASSAVA GERMPLASM FOR THE ORIER IOEVELOPMENT OF CASSAVA GERMPLASM FOR THE ORIER TROPICS ANO SUBTROPICAL AGROECOSYSTEMS OF AFRICA, TROPICS ANO SUBTROPICAL AGROECOSYSTEMS OF AFRICA,  ASIA ANO LATIN AMERICA  ASIA ANO LATIN AMERICA Donor Internabonal Fund for Agncultural De\\lelopment (IFAD) U S A DonorInternabonal Fund for Agncultural De\\lelopment (IFAD) U S A Locatlon EMBRAPA!CNPMF Cruz das Almas B ahla Brazil Durahon 5 years (1990 1994) Locatlon EMBRAPA!CNPMF Cruz das Almas B ahla BrazilDurahon5 years (1990 1994) Status Ongomg Total value USS950000 StatusOngomgTotal valueUSS950000 Goal Thls proJecI alms lo eahaoeo food secunly m Outputs  Goal Thls proJecI alms lo eahaoeo food secunly m Outputs lmproved weltare of small farmers m th. target reglOn  lmproved weltare of small farmers m th. target reglOn lmproved gennplasm management aod overall research capaclry of nahonal lmproved gennplasm management aod overall research capaclry of nahonal mshtutlOns workmg wlth cassava   mshtutlOns workmg wlth cassava DescnptIon of actlvlhes Thls proJee! lS belo@ conducted m Brazd, uoder agrooments DescnptIon of actlvlhes Thls proJee! lS belo@ conducted m Brazd, uoder agrooments among CIAT Empresa Brasiler. de PesquIs, Agropecuana (EMBRAPA) through lIs Centro among CIAT Empresa Brasiler. de PesquIs, Agropecuana (EMBRAPA) through lIs Centro NaCIOnal de PesqUisa de MandIOca e Frullcultura (CNPMF) and the Empresa CatarInen.e de NaCIOnal de PesqUisa de MandIOca e Frullcultura (CNPMF) and the Empresa CatarInen.e de PesquIs, Agropecuana (EMPASC)   PesquIs, Agropecuana (EMPASC) Pnnclpal acl1vlt1es lnclude   Pnnclpal acl1vlt1es lnclude collect1ug aud conservmg   collect1ug aud conservmg  "},{"text":"to Prepare Contracts, Progress and EvaluatlOn Reports for Donors 4 1 ObJectlves lhe prOJect requlres a formal contraet, lhe ProJect Support Office works Wlth lhe ProJect Manager to prepare the proJeet contraet Wllh lhe donor The terms of referenee for lhe Scope ofWork speclfied In lhe contract are usually based on the melhodology, acllVIlles, Implementatlon schedule, orgaruzallonal strueture, budget reportmg proVISlOns and lhe evaluatlOn plan outlmcd In the proJect proposal A sample outline of a proJcct contraet IS shown m FIgure12 Sample ProJect Budget Format by Standard I Figure 12 Oate Apnl 1995 I Sample ProJect Budget Format by Standard I Figure 12 Oate Apnl 1995 I _ ObJect of Expendlture (In current US$) Inflanon ACIATGUIDEFOR PROJECTIDENTIFICATION, DESIGN,APPROVALAND -Sample Outhne For A ProJect Contract 4 4 Progress Reportmg and ProJect Momtormg _ ObJect of Expendlture (In current US$) Inflanon ACIATGUIDEFOR PROJECTIDENTIFICATION, DESIGN,APPROVALAND -Sample Outhne For A ProJect Contract 4 4 Progress Reportmg and ProJect Momtormg UNE ITEM Vear N° 1 The ProJect Support Office wIll advIse tbe ProJecl Officerwhat mflauon rate should be Vear N° 2 Vear N° 3 TOTAl ADMINISTRA ilON The responslblhty for prepanng donor reports hes vnth the ProJect Officer based on UNE ITEMVear N° 1 The ProJect Support Office wIll advIse tbe ProJecl Officerwhat mflauon rate should be Vear N° 2 Vear N° 3 TOTAl ADMINISTRA ilON The responslblhty for prepanng donor reports hes vnth the ProJect Officer based on PERSONNEL Senior staff Support staff Clencal staff apphed morder to convert a budget prepared m constant dollars to one whlch IS based Page 1 of9 mput from the program slde and financlal mput from the ProJect Support Office In current dollars Most CIAT proposalssubmltted to donors wIll be based In eurrent The pnnclpal reports assoclatcd Wlth most proJects are dollars wltb astated mflauonrate mcluded Contraet Between And CIAr • Annual ProJect Work Plan PERSONNEL Senior staff Support staff Clencal staffapphed morder to convert a budget prepared m constant dollars to one whlch IS based Page 1 of9 mput from the program slde and financlal mput from the ProJect Support Office In current dollars Most CIAT proposalssubmltted to donors wIll be based In eurrent The pnnclpal reports assoclatcd Wlth most proJects are dollars wltb astated mflauonrate mcluded Contraet Between And CIAr • Annual ProJect Work Plan Temporary Honorana Total personnel 3 8 Wntmg Style for Proposals • Techmcal and financlal Progress Reports Ce g, Quarterly, Seml-annually or Annually} DesenptlOn of Servlees The followmg pnnclples shouId be followed • To provlde gutdeltnes lO program staff for the preparatlOn of!he budget (An appendlx should contalfl selected parts ofthe proJect proposal) • Mld-proJect and/or End-of-PrOJcct EvaluatlOn (completed by tbe external TRAVEL Natlonal lO amaxtmUlfi oftwo lmesoftext) dunng the proJect Imp!ementatlon stage Total travel • Sentences should be kept short (16 lo 20 words on averagewhlch IS tbe eqUlvalent • To provlde an overvlew of ¡he contractmg, reportmg and evaluatlOn reqUlrements Date ofCornpletlOn ofServlces IntematlOnal Sentence Length requtrements and evaluatlOn plan to be Included In proJect proposals evaluator) Temporary Honorana Total personnel 3 8 Wntmg Style for Proposals • Techmcal and financlal Progress Reports Ce g, Quarterly, Seml-annually or Annually} DesenptlOn of Servlees The followmg pnnclples shouId be followed • To provlde gutdeltnes lO program staff for the preparatlOn of!he budget (An appendlx should contalfl selected parts ofthe proJect proposal) • Mld-proJect and/or End-of-PrOJcct EvaluatlOn (completed by tbe external TRAVEL Natlonal lO amaxtmUlfi oftwo lmesoftext) dunng the proJect Imp!ementatlon stage Total travel • Sentences should be kept short (16 lo 20 words on averagewhlch IS tbe eqUlvalent • To provlde an overvlew of ¡he contractmg, reportmg and evaluatlOn reqUlrements Date ofCornpletlOn ofServlces IntematlOnal Sentence Length requtrements and evaluatlOn plan to be Included In proJect proposals evaluator) OPERATIONS Supphes and servlCes Research stal.on support Contract Amount Steenng comm.ttee Paragraph Length • DIscuss only one maJor Idea m a paragraph It IS much eas¡erto read a page Wltb 4 4 2 Background Basls ofPayrnent OPERATIONS Supphes and servlCes Research stal.on support Contract Amount Steenng comm.ttee Paragraph Length • DIscuss only one maJor Idea m a paragraph It IS much eas¡erto read a page Wltb 4 4 2 Background Basls ofPayrnent Total operat.ons 10 6 paragraphs Ihat 2 or3 paragraphs Try notto exceed ten hnes oftextfor a The ProJect Support Offiee, as pan of lhe Office of Fmance and AdmmlstratlOn, Total operat.ons10 6 paragraphs Ihat 2 or3 paragraphs Try notto exceed ten hnes oftextfor a The ProJect Support Offiee, as pan of lhe Office of Fmance and AdmmlstratlOn, INSTITUTIONAl DEVELOPMENT Workshops/Conlarences smgleparagraph provldes proJcct support to bolh sClentlfic and management staff m the areas of budget formulatlon and control, contractmg, fmanclal progress reportmg, Method ofPayrnent INSTITUTIONAl DEVELOPMENT Workshops/Conlarences smgleparagraph provldes proJcct support to bolh sClentlfic and management staff m the areas of budget formulatlon and control, contractmg, fmanclal progress reportmg, Method ofPayrnent InlormatlOn d.ssem.natlOn Dacument acqu.srt.ons and matenals devalopment Staff tra.nlng Support lor proJects at othar .nst.tut.ons coordmatlOn of donor proJect evaluatiOns, and central archtvmg and record keepmg Vou:e proposal preparabon phase • Whereposslble, usetheactlvenotthepasslVe VOlee for prOJects It works elosely Wllh the ProJeet Development Office durmg the Interest on Overdue Accounts InlormatlOn d.ssem.natlOn Dacument acqu.srt.ons and matenals devalopment Staff tra.nlng Support lor proJects at othar .nst.tut.ons coordmatlOn of donor proJect evaluatiOns, and central archtvmg and record keepmg Vou:e proposal preparabon phase • Whereposslble, usetheactlvenotthepasslVe VOlee for prOJects It works elosely Wllh the ProJeet Development Office durmg the Interest on Overdue Accounts Total .nsbtut.onal development Techmcal Jargon Confidentlahty Total .nsbtut.onal development Techmcal Jargon Confidentlahty DIRECT COSTS Veh.cles use (leas.ng rental) • Wntetbemam textso thata generahst m adonor ageney can easIlyunderstand the matenal Putm theappendlces those techmcal seCtlons Wlth addltlOnal background 4 3 Contractmg Appropnate Law DIRECT COSTS Veh.cles use (leas.ng rental) • Wntetbemam textso thata generahst m adonor ageney can easIlyunderstand the matenal Putm theappendlces those techmcal seCtlons Wlth addltlOnal background 4 3 Contractmg Appropnate Law Space use (Land offlCa) mforrnatlon tbatwtll only be of mterestto thesector speclaltst Space use (Land offlCa) mforrnatlon tbatwtll only be of mterestto thesector speclaltst Total dorect costs TernunatlOn or Suspenslon ofServlces Total dorect costsTernunatlOn or Suspenslon ofServlces CAPITAL Type JusnficatlOn CAPITALType JusnficatlOn Veh.cles F.eld and laboratory Off.ce • Use lefbusuficauon only T extWhlChls Justlfied on both the leftandnght margms 1S harderforthereadertoscan Effecttve Date Veh.cles F.eld and laboratory Off.ce • Use lefbusuficauon only T extWhlChls Justlfied on both the leftandnght margms 1S harderforthereadertoscan Effecttve Date Total cap.tal INDIRECT COSTS The terms ofpayment to CIAT are also speeIl'ied III Ihe eontraet (e g , seml-annual Loglc • Ensure the sequence ofthoughts, both wlthm and between paragrapbs, 1S 10gIcal advances based on submlsslon of progress reports) Total cap.tal INDIRECT COSTSThe terms ofpayment to CIAT are also speeIl'ied III Ihe eontraet (e g , seml-annual Loglc • Ensure the sequence ofthoughts, both wlthm and between paragrapbs, 1S 10gIcal advances based on submlsslon of progress reports) TOTAl The CIAT lawyer revlews the draft contraet before It IS sent by lhe ProJeet TOTAlThe CIAT lawyer revlews the draft contraet before It IS sent by lhe ProJeet  For further guldance, staffshould consultCIATWorklDgDoCUlfient# 120 'Notes for Support Office to lhe donor --, For further guldance, staffshould consultCIATWorklDgDoCUlfient# 120 'Notes for Support Office to lhe donor--,  AuthorsusmgCIAT's Edltonal Servlces \" AuthorsusmgCIAT's Edltonal Servlces \" Fmanclal Controller 2of9 Fmanclal Controller2of9  "},{"text":"o QUARTERL y FINANCIAL FORECAST     I  I A. REPORT SUMMARY   A. REPORT SUMMARY  Thls 15 the thrrd progre5s report and covers the flrStand second quarters offiscal year Thls 15 the thrrd progre5s report and covers the flrStand second quarters offiscal year  1993/94 (Apnll stto September 30, 1993)  1993/94 (Apnll stto September 30, 1993)  Start Apnl 1, ) 993 FIOIsh September 30, 1993 Cost LlmltatJon $ Start Apnl 1, ) 993FIOIsh September 30, 1993Cost LlmltatJon $  ProJect Progress and Performance to Date  ProJect Progress and Performance to Date  (a) Accomphshments   (a) Accomphshments  (b) Schedules    (b) Schedules  (e) CasI    (e) CasI  (d) Underspendmg   (d) Underspendmg  (e) Overspendmg   (e) Overspendmg  (f) Farecast    (f) Farecast  Progress Toward Achlevmg ProJect ObJectlves  Progress Toward Achlevmg ProJect ObJectlves  Revlew ofCrltlcal AssumptlOns  Revlew ofCrltlcal AssumptlOns  P rOJect Mdestones (a) Rcaehed   , , P rOJect Mdestones (a) Rcaehed, ,  (b) Scbeduled    (b) Scbeduled  Can Donar Belp?   Can Donar Belp? B REPORT ON PROJECT ACTIVITIES  BREPORT ON PROJECT ACTIVITIES  Output No 100   Output No 100  AcI1vrty No 10 1   , , AcI1vrty No 10 1, ,  Estlmated ResuIt   Estlmated ResuIt  Start Fnd Esumated Time Esúmated Cost , StartFndEsumated TimeEsúmated Cost,  Accomphshment Achlevement lo Date Planned lO Date TIme Time to date Fmances U sed lO Date $ Planned to Date $ , ' . , <t \"{ Accomphshment Achlevement lo Date Planned lO DateTIme Time to dateFmances U sed lO Date $ Planned to Date $, ' . , <t \"{  E APPENDICES AppendlxA ActlVlty Revlew and Comment LogtcalFrameworkAnalvS1s Vanance Vanance \" ~~ ,¡ , {~ , E APPENDICES AppendlxA ActlVlty Revlew and Comment LogtcalFrameworkAnalvS1s VananceVanance\" ~~ ,¡ , {~ ,  AppendlxB AppendlxC Provlde a narratJve repon on proJect actlVltles where slgmficant varlances have WorkBreakdoWt1 Strucrure ImplementattonSchedule(Ganttchart) occurred ~ 't :' , AppendlxB AppendlxC Provlde a narratJve repon on proJect actlVltles where slgmficant varlances have WorkBreakdoWt1 Strucrure ImplementattonSchedule(Ganttchart) occurred~ 't :' ,      \" \"      40f9 40f9  "},{"text":"Sample Format for an End-of-ProJect Report    Figure 16 Figure 16   Date Apn¡ 1995 Date Apn¡ 1995 Abstract  Abstract 1 O Introductton Baslc PrOJeet Data 1 O Introductton Baslc PrOJeet Data 1 I Background 1 IBackground 1 2 ProJcct Descnpt!on 1 2ProJcct Descnpt!on 1 3 KEY IDENTIFICATION DATA EvaluattonMethodology 1 3 KEY IDENTIFICATION DATA EvaluattonMethodology  1 3 I I 32 • proJcc! tttle, numbcr, sector eountry General Approach Sources of Data I 33 • executlOg ageney and eonsortla partners Instruments I 3 4 • momtonngagency,lfappheable Personnel 1 3 5 Llmaatlons • evaluatlOo agency, Ifapphcable 1 3 I I 32 • proJcc! tttle, numbcr, sector eountry General Approach Sources of Data I 33 • executlOg ageney and eonsortla partners Instruments I 3 4 • momtonngagency,lfappheable Personnel 1 3 5 Llmaatlons • evaluatlOo agency, Ifapphcable I 4 Orgamzauon ofReport I 4Orgamzauon ofReport KEY FINANCIAL DATA 2 O ProJect Ranonale 2 l • total proJect cost (planned and actual) IntroductlOn 22 • totaldonorcontnbutton ProJectAssumpttons 2 3 ProJeel DcsIgn [ssues • lotalotberfinanclOg(speclfy) KEY FINANCIAL DATA 2 O ProJect Ranonale 2 l • total proJect cost (planned and actual) IntroductlOn 22 • totaldonorcontnbutton ProJectAssumpttons 2 3 ProJeel DcsIgn [ssues • lotalotberfinanclOg(speclfy) 2 4 Donar Prtor1l1es 2 4Donar Prtor1l1es O Efficlency KEYDATES O Efficlency KEYDATES 3 1 ProjectOrgamzallOnal Structure • date of offielal request 3 1ProjectOrgamzallOnal Structure • date of offielal request 3 2 CoordmatIon • date of project approval 3 2CoordmatIon • date of project approval 3 3 PrtOrtty Mod!ficatlOns • date oC slgnature of contractlagreement 3 3PrtOrtty Mod!ficatlOns • date oC slgnature of contractlagreement 34 • startmg date Inputs • termmatlon date 34• startmg date Inputs • termmatlon date O Effecnveness O Effecnveness 4 I 42 PROJECT DESCRlPTION Techmcal Needs Trammg(Graduates) 4 I 42 PROJECT DESCRlPTION Techmcal Needs Trammg(Graduates) 4 3 Resource UtIltzatlOn • ProJect Background & RatlOnale 4 3Resource UtIltzatlOn • ProJect Background & RatlOnale  4 3 1 • ProJeet DescnptlOn (LF A and WBS) Personnel 4 3 1 • ProJeet DescnptlOn (LF A and WBS) Personnel  432 EqUlpmentand FacIlIties 432EqUlpmentand FacIlIties 44 4 5 PROJECT ASSESSMENT TrammgCosts Ach!evement of Goals and Purpose 44 4 5 PROJECT ASSESSMENT TrammgCosts Ach!evement of Goals and Purpose  • Achlevement re goal, purpose, outputs, mputs • Achlevement re goal, purpose, outputs, mputs O Sustamabthty • Economlc effects O Sustamabthty • Economlc effects 5 l Recurren! Costs • SocIal effects 5 lRecurren! Costs • SocIal effects 5 2 Personnel Avadablhty • Instltuttonal effecls 5 2Personnel Avadablhty • Instltuttonal effecls 5 3 Future Role ofDonor • RoleofWomen 5 3Future Role ofDonor • RoleofWomen  • MalO problems and constralOls • MalO problems and constralOls O ConcluslOnsandRecommendanons O ConcluslOnsandRecommendanons O Lesson Learned LESSONS LEAR.~ED O Lesson Learned LESSONS LEAR.~ED 7 l IntroductlOn • OperatlOnallessons 7 lIntroductlOn • OperatlOnallessons 7 2 Management • Developmentallessons 7 2Management • Developmentallessons 7 3 Capae!ty from donor eountry 7 3Capae!ty from donor eountry 7 4 [nstItuttonal Developmen! 7 4[nstItuttonal Developmen!   a of9 a of9  "},{"text":" In consultatlOn wlth relevan! program and sclennfic resource group leaders, are responslble for the preparallon ofthe proJect profiles• Program Leaders are responslble for prlOfltlzlOg proJect Ideas wlthm thelrprogram and submlttmg Ihe profiles lo the DOG, Resea!ch _____ R __ es_o_u_r_~_e_~_a_D_a_g_e_1D_e_n_t_Res __ e_a_r_C_b ____ ..,) (~ ____ G __ e_T1D __ p_la_5_m __ D_e_v_e_lo_p_m __ e_nt_R __ es_e_a_rc_b ____ .,) (~ ________ I_ns_t_lt_u_t_m_n_a_IR __ cl_a_t_lo_ns ________ .r) DG approves/revtsesreoommendatlonson pnonllZallon S ubmlts pTOJect con.:ep1lí:Otes orpre proposals exceedmg $200 000 tú perspéL11VC donor 10 ascertam mterest In recenlmg a dctadcd ro sal (        (     Figure 17    Figure 17   CIAT Internal Revlew and Prlorltlzmg of ProJect Ideas  CIAT Internal Revlew and Prlorltlzmg of ProJect Ideas [~ Tropical Lowlands Program H.IISldes Program Land Management Beans Program Progrnm C~ava Trop ~or.ges Rlcc Progrnrn Prognlm VRU BlOrnetncs BRU GRU InfQrmattonand J)(K:umentallQnUmt Development PubhcAwarenessUmt i JnstltuUonal Commurucatlons.md I [~ Tropical Lowlands ProgramH.IISldes ProgramLand ManagementBeans Program Progrnm C~avaTrop ~or.ges Rlcc Progrnrn Prognlm VRU BlOrnetncs BRU GRUInfQrmattonand J)(K:umentallQnUmt Development PubhcAwarenessUmt i JnstltuUonal Commurucatlons.md I s e t proJect arcas alread)' ldenttfted 10 CIA T Actlón Plan n I o r ¡ SClentlslS1denüfy proJecl Ideas conslstent \\'11th those  s e I e n t 1 s t s s e t proJect arcas alread)' ldenttfted 10 CIA T Actlón Plan n I o r ¡ SClentlslS1denüfy proJecl Ideas conslstent \\'11th thoses e I ent1sts  PL    UH   U11 PLUHU11 PLsronsohdate        PLsronsohdate & rnnk. proJect        & rnnk. proJect Ideaswlthm        Ideaswlthm program        program AD RMR pnontlzt::s        AD RMR pnontlzt::s proposed ItstofproJect        proposed ItstofproJect Ideas for resource m~r=~~t ________________________ ~========~~ __ ~==============~~ ___________________ J Ideas for resource m~r=~~t ________________________ ~========~~ __ ~==============~~ ___________________ J Stlt11hfit RtsoUrttGroupCommtttee Rank. Ideas relevant 10 ea<:\" SRG PPMG .hares w.1h SRG Commlltee ProJcctPortfoJloManagementGroup Ideas and matches ro mdlvldual dooors    BRU GRU iMS lPM Bíotechnaiogy Resean::h urut Genetlc Rosoul\"Cü UI'Ut =: IfllormallOrt Manegement SY$tom Integrated Pesl Manage- Stlt11hfit RtsoUrttGroupCommtttee Rank. Ideas relevant 10 ea<:\" SRG PPMG .hares w.1h SRG CommllteeProJcctPortfoJloManagementGroup Ideas and matches ro mdlvldual dooorsBRU GRU iMS lPMBíotechnaiogy Resean::h urut Genetlc Rosoul\"Cü UI'Ut =: IfllormallOrt Manegement SY$tom Integrated Pesl Manage- the resu1ts of pnonttztng exerctse Pro¡«tDovdop ... nIOffieo Prepares bSllng uf all CIA T pre¡cct .deas forspec.al preJcc, fund.ng Programsand OperatJonsCommJttec Program Operahons Commlttec approves me resu(ts ofpnonhZtng exerCI5e and submlts tinal recommendauollS to DG I [)G    mentSRG '\" Pl\"OQOlm Leader PPtttG =: P(t)joet Portfoho M~ PL mentGroop S = $MIO( Staff SRGL Sde:lnbflc RnouraM Group Leader the resu1ts of pnonttztng exerctse Pro¡«tDovdop ... nIOffieo Prepares bSllng uf all CIA T pre¡cct .deas forspec.al preJcc, fund.ngProgramsand OperatJonsCommJttec Program Operahons Commlttec approves me resu(ts ofpnonhZtng exerCI5e and submlts tinal recommendauollS to DG I [)GmentSRG '\" Pl\"OQOlm Leader PPtttG =: P(t)joet Portfoho M~ PL mentGroop S = $MIO( Staff SRGL Sde:lnbflc RnouraM Group Leader  "},{"text":"Overvlew of tbe ProJect Identlficanan, Pnorltlzmg and Implementanon Process In relatlon lO !he proJect cycle, the ProJecl Developrnent Office 15 responslble for provldmg servlces lo the programs for the steps up 10 and mcludmg recelvmg approval for Ihe proposal frOID the donor agency Thereafter, the ProJcct Suppart Office take5 over for Ihe contraetmg, reportmg lo tbe donor on ¡he ImplernentatlOn ofthe proJect, and coordmatmg any donor proJect evaluatlOns In olher words, the ProJect Development Office IS beavlly mvolved m Ibe early stages of the proJect cycle whereas ¡he PrOJeCI Support Office IS more mvolved wlth tbe later steps of ¡he proJect cycle IACIAT GUIDE FOR PROJECT IDENTIFICATION DESIGN APPROVALANDAOMINISTRATION ~ IACIAT GUIDE FOR PROJECT IDENTIFICATION DESIGN APPROVALANDAOMINISTRATION~ 5 4 Figure 18 provldesal1lllustratlonof!heCIA Tprocessfor!hctdenttficatlOn, 5 4 Figure 18 provldesal1lllustratlonof!heCIA Tprocessfor!hctdenttficatlOn, pnon tlZlltlOn, deslgII, ImplementaUon and evaluabon of proJects ProJect Ideas are first pnon tlZlltlOn, deslgII, ImplementaUon and evaluabon of proJects ProJect Ideas are first approved m pnnclple by the Program Leader, then bythe PPMGand then the Program approved m pnnclple by the Program Leader, then bythe PPMGand then the Program Operal!ons COlrumttee and DG before any workcornrnenees on the preparahon of a Operal!ons COlrumttee and DG before any workcornrnenees on the preparahon of a detalled proposal  detalled proposal The PPMG and the Program OperallOns COmmlttee pnonbzes a11 SpeClaI proJect¡deas The PPMG and the Program OperallOns COmmlttee pnonbzes a11 SpeClaI proJect¡deas on a SIX month basls (under certam condmons, meel!ngs can be called earherto approve on a SIX month basls (under certam condmons, meel!ngs can be called earherto approve Ideas havmg lrnrnedIate donor opporturutles) Ideas havmg lrnrnedIate donor opporturutles) 5 5  5 5 • IdentLficatlon  • IdentLficatlon • apprwsal and deslgn  • apprwsal and deslgn • approval  • approval • contraetmg, proJcct Implementatlon, momtonngandcontrol • contraetmg, proJcct Implementatlon, momtonngandcontrol • termmatlon, and-of-proJect evaluabon, and long-term lIDpact assessment • termmatlon, and-of-proJect evaluabon, and long-term lIDpact assessment  "},{"text":"Approval ResponslbdlÍles for ProJect Ideas and Proposals Figure 19 IlIustrates the mternal CIAT approval process for proJects dependmg upon whetherthey are supported Wlth mtemal fimdmg from coreorsupported byspeclal proJect fundmg In lhe case ofmternally fimded proJeets supported from eore, !he approval ofthe Progmm Operallons Cornrnlttee IS reqUlred forall proJects exceedmg $80,000peryear for crA T or $200,000 total In the case of speclal proJectfimdmg, the Program Leader has !heresponslblhty for approvmg proJect Ideas up to $200,000 whereas the Program OperatlOTlS COmmlttee relams responslb¡JJty for approvmgall proJectIdeas exceedmg$200,000 The DG retatns legal SlgtUng authonty for a11 proposals gomg lo donors, regardless ofthe SlZC of budget • TheProgramOperabonsCommltteelsresponstbleforpnonttzmgproJecttdeas subnutted bythevanous program leaders and thenmakmg areconunendallon lothe DtrectorGeneralforthoseproJectsexceedmg$200,OOO • The Dtrector General has the fina1 responslbthty for theapproval ofthe proJect tdeaand thenforwardmgthe concept note orpre-proposal lo a prospectlve donor • The ProJect Development Office provldes adVlce to the program staff on!he developmenlofthe proJectprofileandconverts the profile mto desktop pubhshmg format The POO Wlth asslstancefrom thesclentlsl also prepares thecover letter fromtheDGtotheprospecttvedonorfortheprofileorpre-proposal Figure 19 IrCIATINTERNAlPOLlCIES ( CIAT fundmg In lhe case ofmternally fimded proJeets supported from eore, !he approval ofthe Progmm Operallons Cornrnlttee IS reqUlred forall proJects exceedmg $80,000peryear for crA T or $200,000 total In the case of speclal proJectfimdmg, the Program Leader has !heresponslblhty for approvmg proJect Ideas up to $200,000 whereas the Program OperatlOTlS COmmlttee relams responslb¡JJty for approvmgall proJectIdeas exceedmg$200,000 The DG retatns legal SlgtUng authonty for a11 proposals gomg lo donors, regardless ofthe SlZC of budget • TheProgramOperabonsCommltteelsresponstbleforpnonttzmgproJecttdeas subnutted bythevanous program leaders and thenmakmg areconunendallon lothe DtrectorGeneralforthoseproJectsexceedmg$200,OOO • The Dtrector General has the fina1 responslbthty for theapproval ofthe proJect tdeaand thenforwardmgthe concept note orpre-proposal lo a prospectlve donor • The ProJect Development Office provldes adVlce to the program staff on!he developmenlofthe proJectprofileandconverts the profile mto desktop pubhshmg format The POO Wlth asslstancefrom thesclentlsl also prepares thecover letter fromtheDGtotheprospecttvedonorfortheprofileorpre-proposal Figure 19 IrCIATINTERNAlPOLlCIES ( CIAT  "},{"text":"Responsibility for Approval and PrlorltlzatJon of New ProJect Ideas and Proposals  The lead mstltute should have an mternaI process forthe tecluncal andmanagement The lead mstltute should have an mternaI process forthe tecluncal andmanagement revlew of proposals   revlew of proposals F or CIA T, the ProJectDevelopment Office 15 responslble for producmg the final verslOn F or CIA T, the ProJectDevelopment Office 15 responslble for producmg the final verslOn of aH proposals where CIAT 15 the ¡ead partnerand wluch are subnutted to outslde of aH proposals where CIAT 15 the ¡ead partnerand wluch are subnutted to outslde donors forfundmg T1us apphes 10 proposals forboth the extenslon of current proJects donors forfundmg T1us apphes 10 proposals forboth the extenslon of current proJects as well as fornew proJects Figure 20 Illustrates the revlewprocess at CIA T for SpeClal as well as fornew proJects Figure 20 Illustrates the revlewprocess at CIA T for SpeClal proJect proposals   proJect proposals Formal submlsslon of speclal proJect pre-proposals to In order to ensurethat CIAT proposals are ofthe lughestquallty, the ProJect Formal submlsslon of speclal proJect pre-proposals to In order to ensurethat CIAT proposals are ofthe lughestquallty, the ProJect donor where CIAT share oflotal budgel IS <$200,000 or Development Office rehes on the asslstanceofvanous sectlons \\.VIthm ClA T mcludmg PL wlth DDG Research approval and PDO coordlnallon donor where CIAT share oflotal budgel IS <$200,000 or Development Office rehes on the asslstanceofvanous sectlons \\.VIthm ClA T mcludmg PL wlth DDG Research approval and PDO coordlnallon $80,000 peryear   $80,000 peryear Program and SClentdic Resource Group Staff  Program and SClentdic Resource Group Staff Formal pnontlzatlon of core funded pro¡ects and speClal • responslble forthe tecluncal ments ofthe proposal and preparmg the fust draft Program OperaMns Commltte makes recommendallon lo Formal pnontlzatlon of core funded pro¡ects and speClal • responslble forthe tecluncal ments ofthe proposal and preparmg the fust draft Program OperaMns Commltte makes recommendallon lo pro¡ect Ideas lo donor where CIA T share of lolal budgells conslstent \"''Ith donor and PDO guldehnes DG based on PPMG revlew of profiles pro¡ect Ideas lo donor where CIA T share of lolal budgells conslstent \"''Ith donor and PDO guldehnesDG based on PPMG revlew of profiles grealer Ihan $200 000 or $80 000 per year • The ProJeet Officer mUS! allow sufficlent tlme to ctrCulate the draft proposal and grealer Ihan $200 000 or $80 000 per year • The ProJeet Officer mUS! allow sufficlent tlme to ctrCulate the draft proposal and rnVlte cornments from othersemorstaff and tite DDG, Research T1us peerrevlew rnVlte cornments from othersemorstaff and tite DDG, Research T1us peerrevlew Formal SubmlSSlon of speclal pro¡ect pre-proposals and final proposals lo donors where CIAT share of lolal budget \\.VIII help ensure thetechmea! mentofthe proposal lbs expected thata! least one DG wllh PDO coordmatlon ofthe staff oonductrng tite peerrevlewoftlte proposal \\.VIII come fromanotlter Formal SubmlSSlon of speclal pro¡ect pre-proposals and final proposals lo donors where CIAT share of lolal budget \\.VIII help ensure thetechmea! mentofthe proposal lbs expected thata! least one DG wllh PDO coordmatlon ofthe staff oonductrng tite peerrevlewoftlte proposal \\.VIII come fromanotlter exceeds $200,000 or $80,000 per year program titan tltat ofthe ProJect Officer  exceeds $200,000 or $80,000 per year program titan tltat ofthe ProJect Officer ProJect Support Office i.  ProJect Support Officei. • responslble forprovldmg program staffW1th standard costs for budgetlterns and • responslble forprovldmg program staffW1th standard costs for budgetlterns and forarrangmgthe slgnmgoffoftlte budget page bytheFmanctal Controller forarrangmgthe slgnmgoffoftlte budget page bytheFmanctal Controller PL POC = Program Operatlons Commltlee = Program leader CommumcatIons Umt ODG = Deputy Director General-Research DG = Director General PL POC = Program Operatlons Commltlee = Program leader CommumcatIons UmtODG = Deputy Director General-ResearchDG = Director General • responslble foredllmg the final verslon ofproposal before tI IS converted to • responslble foredllmg the final verslon ofproposal before tI IS converted to desk1oppubhslungformat   desk1oppubhslungformat ProJcct Development Office   ProJcct Development Office • responslble for ooordmanng the proposa! preparatlon process, ensunng tltal tite • responslble for ooordmanng the proposa! preparatlon process, ensunng tltal tite proposa! addresses maJor donorconcerns, and preparmg the fmal verslonoftlte proposa! addresses maJor donorconcerns, and preparmg the fmal verslonoftlte proposal m desktop pubhslung format  proposal m desktop pubhslung format • The PDO \\\\<111 arrangefortranslatlons ofproposals mto Sparush, Ifrequrred, W1t1t • The PDO \\\\<111 arrangefortranslatlons ofproposals mto Sparush, Ifrequrred, W1t1t CrA Ts Cornmurncatlon Umt The PDO \\' ,' 111 supply acopyofthe final proposal CrA Ts Cornmurncatlon Umt The PDO \\' ,' 111 supply acopyofthe final proposal on diskette m WordPerfect to tite Cornmurncatlons Umt on diskette m WordPerfect to tite Cornmurncatlons Umt  "},{"text":"Teshmcal and Management Revlew ofDraft ProposaIs The G.e.r.m.p.l.as.m . . D.e.v.e.lo.p.m . . e.u.tR . . es.ea . . r.ch .... ~Jr. (~ ...... lU.S.t.lt.u.tl.o.u.a.IR.e.l.a.ú.o.D8 ...... ..,) • CIATnowusesdesktoppubhshmgsoftware(pageMaker)forthepreparanonof lhe final proposal Images from CIA Tsconslderableshde mvenlory are mcreasmgly bemg mcorporated mto the proposal to emphaslze key Ideas In lhe !eX! COTe actlVltles These charges are presently 20% m ¡he case ofColombla-based actlvltles (where relatlvely more central serv¡ces are provlded on an mdlrect costmg basls) and 15% In tbe case of aCllVll¡eS unplemented m other countrles Wherever posslble, CIA T trIes to recover tbese rates for mdlrect costs assoclated wltb speclal proJects Both tbe ProJect Deyelopment Office and the ProJect Support Office are funded by the prOJects whlch tnclude a componen! for mdlrect costs Once tbe PDO and PSO costs have been covered, the rest of the mdlrect costs recillved from tbe donors for proJects are then redlstnbuted to CIA 1\"5 operatmg programs The PrOJect Support Office wlll advlse the ProJcct Officer as to what mflatlOn rate should be apphed morder to convert a budget prepared m constant dollars to one wlllch 15 ba5ed m curren! dollars Most C1AT proposals submltted to donors wlll be based m curren! dollars wlth a stated mflatlon rate mcluded lead mstttute should have an mtema] process forthe techrucal and management reVlew of proposals (e g , see Figure 20) lus theresponslbIllty ofthe ProJectOfficerto allow sufficlent tIme toclrculate the draft proposal and inVite cornments from other semor staff and the DDO, Research TIus peerrevlewWlIl helpensurethetechrucal ment ofthe proposal It IS expected thatatleast one ofthe staff conductrng the peer reVlewoftheproposalWlllcomefromanotherprograrnthanthatoftheProJectOfficer 59 CIATOrgaruzanon Figure 21 shows the management structure forexecutmg CIA 1\"5 proJect-based work prograrn The empbasls on decentrallZed deClSlOn makmg, coupled, where posslble, Wlth delegatJon of authonty and responslblhty to the proJect level TIus \"empowerment\" of SClentlsts and SClentlfic tearns 15 coordmated by research leaders (who represent speclfic research programs and SROs)and by overall coordmabon attheduectors' level These reporung lmes are expected to proVlde the CenterWlth the necessruy balanceof flexlbIllty on the one band, and coordmatlOn and synthesls ofresearch efforts on the other  A CIAT GUIOE FOR PROJECT IDENTIFICATION  A CIAT GUIOE FOR PROJECT IDENTIFICATION  DESIGN APPROVAlANDADMINISTRATION DESIGN APPROVALANDADMINISTRATION  DESIGN APPROVAlANDADMINISTRATION DESIGN APPROVALANDADMINISTRATION  5 8 Graduate Student Stlpends (1995) 577 ProVlsl()nforPubhcahons/DocumentatlOn North Amerlca 5 8Graduate Student Stlpends (1995) 577 ProVlsl()nforPubhcahons/DocumentatlOn North Amerlca   Cahto 1111S provldes forpubhsltmgand dlstnbutmg ofresearch findmgs, acqUl51tIon of Ottawa, Canada $1,240 PrOV1SIOn forroom, board and mSurance US$l,OOO month Iy books, JOUl'Ual, and data base searches It 15 suggested the ProJect Officer Chlcago, U S A 1,030 Cahto1111S provldes forpubhsltmgand dlstnbutmg ofresearch findmgs, acqUl51tIon of Ottawa, Canada $1,240 PrOV1SIOn forroom, board and mSurance US$l,OOO month Iy books, JOUl'Ual, and data base searches It 15 suggested the ProJect Officer Chlcago, U S A 1,030    provlde 3% of operatmg expenses (excludmg capital) for these Items Mlaml,USA 655 provlde 3% of operatmg expenses (excludmg capital) for these Items Mlaml,USA 655 Tropical Lowlands Prograrn H.lIs.des Program Saenllsts prepare draft propasal LandUse Management conslStent Wlth oonorlPOO The preparatIon ofhlgh quallty proposals 18 a tIme consummg process Beans Cassava TropIcalFora¡¡es Prograrn Program Program Rice BRU GRU Program VRU SRU New York USA 905 573 CIATHotelAccommodatlOnforConferences(1995) Smgleroom US$54 permght Washmgton,DC 955 578 Pbotocoples • Program Staffshould submlt draft proposals lo the PDO oue mouth before the donor due date m orderto allowsufficlenttlme to prepare a frnal verSlOn, have a revlew by peers and the DDG, Research, and convert the proposal to desktop publIshmg fOnnaL Double Apartment Meals Black and whlte US$004 per page Europe 73 perntght Color US$1 14 per page Cahto Copenhagen, Denmark $1,500 89 per mght(Accommodates 1 to 3 people) ~ London,England 1,425 18 dally(3 meals) 579 Mlaml Office Purchases Pans, F rance 1,425 InfQrmatiOnand DocumeotalJon Umt Instttutlonal Developrnent CornmunlcatloríS andPubhc Awareness Umt Tropical Lowlands PrograrnH.lIs.des Program Saenllsts prepare draft propasal LandUse Management conslStent Wlth oonorlPOO The preparatIon ofhlgh quallty proposals 18 a tIme consummg process Beans Cassava TropIcalFora¡¡es Prograrn Program Program Rice BRU GRU Program VRU SRU New York USA 905 573 CIATHotelAccommodatlOnforConferences(1995) Smgleroom US$54 permght Washmgton,DC 955 578 Pbotocoples • Program Staffshould submlt draft proposals lo the PDO oue mouth before the donor due date m orderto allowsufficlenttlme to prepare a frnal verSlOn, have a revlew by peers and the DDG, Research, and convert the proposal to desktop publIshmg fOnnaL Double Apartment Meals Black and whlte US$004 per page Europe 73 perntght Color US$1 14 per page Cahto Copenhagen, Denmark $1,500 89 per mght(Accommodates 1 to 3 people) ~ London,England 1,425 18 dally(3 meals) 579 Mlaml Office Purchases Pans, F rance 1,425InfQrmatiOnand DocumeotalJon UmtInstttutlonal DeveloprnentCornmunlcatloríS andPubhc Awareness Umt  gwdehnes 5 7 CIAT GUldehncs for Costmg ProJcct Budgcts ,-For CIAr or lCA Employees Smgleroom Double Admmlstrattve cltarge for purchases F rankfurt, Germany Shlpptllgeharge Rome,ltaly Amsterdam, Netherlands US$28 permght 41 permght 1,425 10% of FOB value 1,530 $30 per lb 1,425 gwdehnes 5 7 CIAT GUldehncs for Costmg ProJcct Budgcts ,-For CIAr or lCA Employees Smgleroom Double Admmlstrattve cltarge for purchases F rankfurt, Germany Shlpptllgeharge Rome,ltaly Amsterdam, NetherlandsUS$28 permght 41 permght 1,425 10% of FOB value 1,530 $30 per lb 1,425 PLs revtew draft proposal lflconsultallon  PI 5 7 1 Indlrect Costs Oslo, Norway 5710 TelecommunlcatIons Faxes Charges Apartment Madnd,Spam PLs revlew Colomblll USS094 per page 1,500 1,370 Stockholm, Sweden 1,570 draft propasal In OOfIsuttaUoo 5 7 4 Slmultaneous TranslatIon Costs forConferences (1995) 50 permght Central & South Amenea US$406 per page Zunch, SWltzerland 1,425 UH OH PLs revtew draft proposal lflconsultallonPI 5 7 1 Indlrect Costs Oslo, Norway 5710 TelecommunlcatIons Faxes Charges Apartment Madnd,Spam PLs revlew Colomblll USS094 per page 1,500 1,370 Stockholm, Sweden 1,570 draft propasal In OOfIsuttaUoo 5 7 4 Slmultaneous TranslatIon Costs forConferences (1995) 50 permght Central & South Amenea US$406 per page Zunch, SWltzerland 1,425UHOH wúh Qther staff aOO SRGS Dn\"dopmrat omc:e Prepares fmal proposaJ Wlth asSlstance from PSO and North Amenca Two translators are reqUlred for a conference 1995 cost 15 295,000 Colomblan Wlth other staff aod SRGS , I'm'«' DenJopmeat Offiee Prepares. final proposa) wnh ilSSlstance fmm PSO and US$444 per page Europe Afrlca US$4 75 per page pesos per translator per day ASia & Oeeanla US$575 pee page Cahto Catro, Egypt $1,710 Afnca US$719 per page Nalrobl, Kenya 3,065 DrvdopmelU ONiCf Prepares (mal proposal Wlth asststance from PSO and wúh Qther staff aOO SRGSDn\"dopmrat omc:e Prepares fmal proposaJ Wlth asSlstance from PSO and North Amenca Two translators are reqUlred for a conference 1995 cost 15 295,000 Colomblan Wlth other staff aod SRGS , I'm'«' DenJopmeat Offiee Prepares. final proposa) wnh ilSSlstance fmm PSO and US$444 per page Europe Afrlca US$4 75 per page pesos per translator per day ASia & Oeeanla US$575 pee page Cahto Catro, Egypt $1,710 Afnca US$719 per page Nalrobl, Kenya 3,065DrvdopmelU ONiCf Prepares (mal proposal Wlth asststance from PSO and   Umt 5 75 Dally Rental Rate for Conference Rooms (1995) Um\\ Lagos, Nlgena 3,000 5711 Alrfares(l995) Klgah, Rwanda 2,800 Commumcauons Umt Umt 5 75 Dally Rental Rate for Conference Rooms (1995) Um\\ Lagos, Nlgena 3,000 5711 Alrfares(l995) Klgah, Rwanda 2,800Commumcauons Umt AD RMR rftVlews and Inrtlals approval of revlsed propasal to be fOlwanled lo DDG Research DDG R revwws and mmals approval of tévlSed proposal to be forwarded to OG Wuhout InterpretatlOn EqUlpment W¡th InterprefatlOn Johannesburg, South Afbca 3,390 The followmg are estlmated alrfares iD L:S dollars (return, excurslOn class) for 1995 Dar Es Salaam, Tanzama 3,065 EqUlpment Kampala, Uganda 3,065 La/m Amerzca DG Personnel Costs (1995) ASsoclate 1 US$33,690 Annually Techmclan 1 10,520 ASsoclate 2 30,175 Techmclan2 9,200 Asslstant 1 19,720 Techmclan3 8,300 Asslstant 2 15,300 Worker 1 7,955 Audltonum Nanfio Mmsca Calima and Talrona Tumaco and QUlmbaya 500,000 Col pesos 250,000 200,000 150,000 700,000 Col pesos Buenos Aires, Argentma $1,160 ASia 400,000 320,000 576 Vehlcles Lease ID Colombia Callto AnnualLease Monthly Lease Aa IR ;o AsSOClate DlrectoI Instrtutrona! RelalJOns AD IR revlews and IMlals approval af revJsed proposallo be 1000a«led lo DG La Paz, Bohvla Santa Cruz, Bohvla Brasilia, Braztl Rto,Braz!l Salvador, Brazll San Jose, Costa Rica Santiago, Chile 1,020 Cahto Canberra, Austraha $2,870 1,240 BelJmg,Chma 2,980 1,080 Tokyo, Japan 2,515 940 Manila, Phlhppmes 2,880 940 Smgapore 3,140 370 1,170 Talpel 2,880 AD RMR rftVlews and Inrtlals approval of revlsed propasal to be fOlwanled lo DDG ResearchDDG R revwws and mmals approval of tévlSed proposal to be forwarded to OG Wuhout InterpretatlOn EqUlpment W¡th InterprefatlOn Johannesburg, South Afbca 3,390 The followmg are estlmated alrfares iD L:S dollars (return, excurslOn class) for 1995 Dar Es Salaam, Tanzama 3,065 EqUlpment Kampala, Uganda 3,065 La/m Amerzca DG Personnel Costs (1995) ASsoclate 1 US$33,690 Annually Techmclan 1 10,520 ASsoclate 2 30,175 Techmclan2 9,200 Asslstant 1 19,720 Techmclan3 8,300 Asslstant 2 15,300 Worker 1 7,955 Audltonum Nanfio Mmsca Calima and Talrona Tumaco and QUlmbaya 500,000 Col pesos 250,000 200,000 150,000 700,000 Col pesos Buenos Aires, Argentma $1,160 ASia 400,000 320,000 576 Vehlcles Lease ID Colombia Callto AnnualLease Monthly Lease Aa IR ;o AsSOClate DlrectoI Instrtutrona! RelalJOns AD IR revlews and IMlals approval af revJsed proposallo be 1000a«led lo DG La Paz, Bohvla Santa Cruz, Bohvla Brasilia, Braztl Rto,Braz!l Salvador, Brazll San Jose, Costa Rica Santiago, Chile 1,020 Cahto Canberra, Austraha $2,870 1,240 BelJmg,Chma 2,980 1,080 Tokyo, Japan 2,515 940 Manila, Phlhppmes 2,880 940 Smgapore 3,140 370 1,170 Talpel 2,880 ( 101o1\\gl<4k\\ll~liHh1   AssIstant3 Sedan QUIto, Ecuador 10,800 Worker2 $3,200 390 7,715 270 ( 101o1\\gl<4k\\ll~liHh1AssIstant3 Sedan QUIto, Ecuador10,800Worker2 $3,2003907,715 270   5712 BthnguaJ Secretary Secretary admrnlStratlve rees Caracas Venezuela 15,340 7,300 lnsurance, Educallon allowance and !rayel Home leave, Officlal vehlcle and SemorStaff Post Doctoral F ellow 51,200 (J) 400 Bus 8,600 720 MontevIdeo, Uruguay 1,160 (1) Inc/ude {he benefits as follow Housmg allowance Hardsblp allowance Retrrement Statlon Wagon 5500 Truck 5,150 Lima, Peru 640 430 MeXlcoClly, Mexlco 790 470 Tegucigalpa, Honduras 920 107000 (1) Plck-up 4,500 390 GuatemalaClly, Guatemala 395 Inflatlon 5712BthnguaJ Secretary Secretary admrnlStratlve rees Caracas Venezuela 15,340 7,300 lnsurance, Educallon allowance and !rayel Home leave, Officlal vehlcle and SemorStaff Post Doctoral F ellow 51,200 (J) 400 Bus 8,600 720 MontevIdeo, Uruguay 1,160 (1) Inc/ude {he benefits as follow Housmg allowance Hardsblp allowance Retrrement Statlon Wagon 5500 Truck 5,150 Lima, Peru 640 430 MeXlcoClly, Mexlco 790 470 Tegucigalpa, Honduras 920 107000 (1) Plck-up 4,500 390 GuatemalaClly, Guatemala 395 Inflatlon  rCIAT INTERNAL POLlCIES rCIAT INTERNAL POLICIES rclAT INTERNAL POUCIES rclAT INTERNAl POllCIES   120f16 rCIAT INTERNAL POLlCIES rCIAT INTERNAL POLICIES rclAT INTERNAL POUCIES rclAT INTERNAl POllCIES120f16  "},{"text":"5 10 RelatlOnshlp between Core and Complementary Funded ProJects ACflon Plan was bemg Implemented, proJects were Idenbfiedand developed as centers ofactlVlty, resourceallocatlOn, andaccountablhty The proJect-based orgamzatlon ofCIAT today IS shown m Figure22The fielddefmed bythe axes \"SclentlÍlc ResourceOroups\" and \"Programs\" 15 thedomam ofthe pro)ects, wlnch, although d1ffenng m extent, cut across any numberof research programs and sclentlfic resource groups Bu!, forthe sakeof orgamzatlonandaccountablhty. each proJect 18 asslgned totheresearch program to wlnch Itmost contnbutes T1nsmodus operandl guaranteesalngh degreeofmterdependence and flUldlty among proJects Atthe same time, the Center IS assured thatthe sum total ofthe proJects dl!ectly contnbutes tothe mandates and obJectlves of each research programand SRO--and therefore to the overaU rmsslOnand obJectlVes ofCIAr CIA T sclentlsts generate outputs related to speclfic cropsand agroecosysterns through proJects !hatare \"housed\" m SIX research programs and five sClentlfic resource groups Most financlal resources areasslgned to all proJects together, Wlth some central costs that cannotreadJly be attnbutedto proJects (e g ,adnurustratlOnand mamtenance) •   • ~ Internal Audlt ~ Internal Audlt Assoc Director  Assoc Director Inst Relattons  Inst Relattons I _L.  I_L. R&DLmkages Support BUSI ness pmení Develo port Sup -, ..... R&DLmkages SupportBUSI ness pmení Develo port Sup -, ..... ¡¡. Tralmng & ¡¡. Pubhc ¡¡. Tralmng &¡¡. Pubhc Conferenees Awa reness ConfereneesAwa reness ¡. Informatlon + ProJe el ¡. Informatlon+ ProJeel + PubllCaúons Dev elopment + PubllCaúonsDevelopment lfrCIAT INTERNAL POLlCIES lfrCIAT INTERNAL POLlCIES  "},{"text":" Wlth proJectsas 1ts key operanonal and budgetaryurut, crA T ¡sable toacrneve full transparency and accountablhty In Its pnontles, outputs, expencbtures, and Income 11I1s enables the CGIAR, otherdonors, andnatlonal partners lo see clearly howresources are deployed and thepurposes for wluch they are used Coreresources provlded by the CGIAR constItutethe mam partofCIA 1's budget Theseresources are asslgned to projectsaccordmg lo pnontIesdetellllmed WIth theCGIAR and T AC These pnonúes fOllll the backbone ofCIA T's proJect structure and these resources are Its hfeblood But the pro] eet structure also enables the Centerto attract other donors and mvestors Pnonty IS placed on attractrng addlúonal fundmg foroulputs that contnbutedrrectly to theacluevementofCIA 1'score goalsWItlunlts CGIARmandate Complementary funds are also sought to speed up and extend the scope of apphcatlon theCenter's core oUlputs (e g , throughreg¡onal getmplasmnetworks)Complementary resources can also be used toproduceothercomplementary outputs andsemcesdemandedbyCIATpartners,especlallymLatlnAmencaandthe Canbbean, wheretheCenterfulfillsanecoreg¡onalfunctlon Thesecomplementary oUlputsareclosely relatedtoCIAT coreoulputsandcapacltles(e g , trammgm molecular markers or GIS methods) The resources generated to dehver these outputs allowCIA Tto expand !hecapaclty of lts sClenúfie resource groups (e g , through extra VlSltutg sclentlsts orpostdoctoral fellows) Thus, CrA 1'5 pro]ectstructureenables It to merge funds froma vanety of sources mto a single total budget These resources are deployed synerglstlcallyto produce an mterrelated set ofcoreand complementary oUlputs AlI oUlputsdenve from CIA 1's core capaclt1es, wrnch expand or contraet accordmg 10 !he resource available A CIAT GUIDE FOR PROJECT IDENTIFICATION DESIGN APPROVALANDADMINISTRAT10N I   A CIAT GUIDE FOR PROJECT IDENTIFICATION DESIGN APPROVALANDADMINISTRAT10NI  Figure 22  Figure 22 Tlhe Pmject-Ibased Oll'gamza~ñoll1l of CIAT Todlay Tlhe Pmject-Ibased Oll'gamza~ñoll1l of CIAT Todlay SCIENTIFIC RESOURCE GROUPS   SCIENTIFIC RESOURCE GROUPS Germplasm Development ft-BlOtechnology DIsease and Pest Management ProductlOn Systems and SOlls Management Land Management +GIS Germplasm Development ft-BlOtechnologyDIsease and Pest ManagementProductlOn Systems and SOlls ManagementLand Management +GIS     Beans \" ;u Beans\" ;u    4 Cassava o el 4Cassavao el ]11ro)]~  Tropical Forages Rice ;u > E ]11ro)]~Tropical Forages Rice;u > E     Tropical Tropical     Lowlands Lowlands     HIlIsldes HIlIsldes     150116 150116  "}],"sieverID":"5e83a8b8-de88-4342-9573-48ae2c4ac21c","abstract":"Sample ProJec! Orgamzabon Chart 11 7 Sample Pro)ect Implementatlon Schedule 12 8 Sample Pro)ect Expenenee Sheet 13 9 Sample CIA T CV 14-16 10 Sample Pro)ect Budget Fonnat By Standard Ob)ec! of Expendlture 18 11 Sample ProJect Budget Fonnat by Both Actlvlty and Standard Ob)ec! of Expendlture 19 12 Sample Outlme for a Pro)ec! Contrae! 2 13 Sample Llst of Contents for a ProJec! Technlcal and F manclal Progress Report 4 14 Examples ofIssues and Questlons m Pro)ect EvaluatlOns 7 15 Sample of an EvaluatlOn Report Oullme 8 16 Sample Format for an End-of-Pro)eet Report 9 17 CIAT Techmcal and Management Revlew of Project ldeaslProjec! Profiles 2 18 Overvlew of Actlvltles 10 Speclal PrOject Identlficabon Approval and ImplementatlOn"}

data/part_1/0160b88e4a3c6d813383928bb90a4851.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0160b88e4a3c6d813383928bb90a4851","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/888da397-4473-4d92-9d69-1a4ded7ba15f/retrieve"},"pageCount":11,"title":"Unpacking 'gender' in joint forest management: Lessons from two Indian states","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":87,"text":"Since the mid-to late 1980s, there has been a decentralization of forest governance globally, with increasing co-management rights and responsibilities devolved to forest-dependent communities (Agrawal et al., 2008). Collaborative governance arrangements have emerged, typically premised on the idea of a sharing of power, responsibilities and benefits between governments and resource users, with the latter participating in decision-making processes (Ansell and Gash, 2008). Such arrangements are intended to enhance not only the efficiency but also the inclusiveness and equity of natural resource management processes (Ribot et al., 2010)."},{"index":2,"size":114,"text":"As the promise and perils of these arrangements have come to the fore, so too has women's global underrepresentation in the user groups that co-manage forested areas (Sunderland et al., 2014). The capacity of different actors to influence how local forests are managed hinges on their social position, which is shaped by their gender, caste or ethnicity, age, socio-economic status, and other attributes (Varughese and Ostrom, 2001;Blaikie, 2006;Mukherjee et al., 2017). Notably, social structures that mediate gender roles, expectations and relations pose constraints to women's active participation in local governance. Hence, even when women are formally represented in user groups, their presence often remains nominal and their participation limited and lacking influence (Agarwal, 2010)."},{"index":3,"size":148,"text":"India is home to the largest forest-dependent population in the world, and is considered a forerunner in developing policies to engage forest dependent communities in the management of forest lands. It has created formal measures to provide space for women and marginalized groups to participate in forest co-management schemes, including through its Joint Forest Management (JFM) programme. In JFM, efforts to engage women and historically marginalized groups are manifest in rules that endow membership in forest management institutions to all adult residents of forest-dependent communities, and quotas for these groups in the Executive Committee (EC) of forest user associations. In India and beyond, however, the active engagement of women and marginalized communities remains the exception rather than the norm (Nightingale, 2002;Agarwal, 2010;Persha and Andersson, 2014). Understanding this process of exclusion is critical to foster more equitable arrangements that safeguard the rights of, and offer benefits to, marginalized groups."},{"index":4,"size":255,"text":"A significant body of research has called attention to gender and social inclusion within the JFM context. Yet, this work, and the practice on which it reflects, has often conceptualized women as a unified group, rather than diversified actors with differentiated interests and experiences. As Godbole (2002, p.3) indicates, gender concerns in India's JFM programme remain a 'local and depoliticised issue and related to an undifferentiated category called women'. The rhetoric about women's role in JFM is minimally present within implementation, and some authors suggest that there is an intentional lack of clarity regarding women in the programme (Jewitt, 2000;Agarwal, 2001;Sarker and Das, 2002), similar to the lack of clarity regarding marginalized forest dwellers. In only few cases (e.g. Agarwal, 2000;Nightingale, 2002) are caste and ethnicity acknowledged as other important social factors interacting with gender to shape women's interests and engagement in JFM, and empirically-based analyses of these processes are scarce. The relative silence around intersectionality in the forestry sector stands out against the rich engagement with questions of caste and gender-and their enmeshment-in an Indian context (e.g. Purkayastha et al., 2003;Rao, 2003;Rege et al., 2013;Devika, 2010). It critically limits our understanding of the processes of social exclusion that characterize JFM and the management of other common property resources. A situated, emic perspective on why local women and men participate in JFM can shed light on how social position, as experienced through the daily life of participants, affects interest and capacities to participate, and how individuals exercise their agency to open up spaces of participation."},{"index":5,"size":153,"text":"Hence, this paper draws on the narratives of local women and men to examine how social differentiation shapes participation in JFM in the Indian states of Karnataka and Madhya Pradesh. In Karnataka, which is considered an exemplary state for JFM, we demonstrate that caste and socio-economic status, which are linked to landholdings, play a critical role in determining livelihood strategies and rural dwellers interests' in the forest and in JFM. In Madhya Pradesh, home to a large number of tribal peoples, where JFM is poorly functional and forest areas increasingly degraded, uneven relations among different tribes and castes underpin exclusions in JFM. In both states, gender significantly affects capacity to engage in JFM due to norms that relegate public affairs to men and exclude women, particularly when lacking formal education. In conclusion, we argue that the focus on gender is necessary but not sufficient to understand differentiated interests, constraints and opportunities in JFM."}]},{"head":"Situating social exclusions in JFM","index":2,"paragraphs":[]},{"head":"JFM in historical perspective","index":3,"paragraphs":[{"index":1,"size":185,"text":"Current day perspectives on and participation in JFM must be understood within a historical trajectory of appropriation of the forest by the state dating back to colonial times. In the late 19th century, colonial systems that declared uncultivated commons as state-owned forest land were focused on commercial exploitation and control of the forest, and not on forest-dependent communities (Gadgil and Guha, 1993). In 1878, the Indian Forest Act, which gave way to the present-day Indian Forest Act (IFA) (1927), classified the landscape into 'Reserved', 'Protected' and 'Village' Forests (Agarwala, 1985). Reserve Forests offered no rights to local people, unless otherwise specified; Protected Forests offered them rights to pursue all activities, unless explicitly prohibited; and Village Forests were designated to meet local needs (though no lands were set aside under this designation during the colonial period) (Guha, 2001;Sarin et al., 2003). At this turning point in India's history of forest management, the colonial forest department reserved more than one fifth of India's forests, appropriating land from customary users through a forest 'settlement' process, which recorded the settlement rights of certain forest users (Gadgil and Guha, 1993)."},{"index":2,"size":111,"text":"The post-independence period saw the continued capture of forests by the state, justified in terms of conservation and wildlife protection goals, despite unabated state-led commercial felling (Guha, 2001;Springate-Baginski et al., 2013;Kumar et al., 2015). Valuable nontimber forest products (NTFPs) were nationalized, and the central government consolidated power over forest management in relation to individual Indian states (Sarin et al., 2003). The Forest Conservation Act (FCA) of 1980 shifted the power to grant tenure rights to customary users from individual states to the central government. Where customary rights had not yet been recorded, lands were listed as government forests, and 'illegal encroachers' were put at risk of eviction (Sarin et al., 2003)."},{"index":3,"size":116,"text":"In the late 1970s and 1980s, 'farm forestry', 'social forestry', and more participatory forest management systems emerged amid pressure from social movements and global environmental concerns, rapid deforestation and degradation, and heightened awareness and advocacy around land ownership and forest rights. Departing from previous policies focused on maximizing forest-based revenue for national interests, the Indian National Forest Policy of 1988 represented an attempt to reconcile forest conservation and livelihood goals, recognizing forest dwelling communities as vital to forest landscapes (GoI, 1988;Sundar et al., 2001). The policy was meant to foster the participation of forestdependent people in the management of state-appropriated forest lands, and gave way to the JFM approach in 1990 (Pratap, 2010;Springate-Baginski et al., 2013)."},{"index":4,"size":243,"text":"JFM offers no legal sanction to secure the land tenure and rights that are central to community management of natural resources (Saigal, 2003;Springate-Baginski et al., 2013;Kumar et al., 2015). The government retains legal ownership over the forest, and communities have limited usufructs rights to specified forest products for subsistence and sale (Murali et al., 2002). Hence, JFM co-exists uncomfortably with more progressive constitutional and legislative mandates to strengthen local rights and decentralize governance among forest-dependent communities. Such mandates include the Scheduled Tribes and Other Traditional Forest Dwellers (Recognition of Forest Rights) Act (FRA) (2006), which addresses the rights of Scheduled Tribes and Other Traditional Forest Dwellers (OTFD) to access traditional forestlands, use and sell non-timber forest products, conserve and manage community forest resources, and which stipulates the right of habitation and 'any other right traditionally enjoyed by these communities' (GoI, 2006). They also include the Panchayats (Extension to the Scheduled Areas) Act (PESA) (1996), that provides for local self-governance in Schedule V (tribal majority) areas. PESA imbues governing authority over a community's development and resources, including in communitybased forest management, to the Gram Sabha; the constituency of all adult voters of a self-defined community (GoI, 1996). In contrast, JFM establishes new village forest management or protection committees under the supervision of the Forest Department and does not refer to PESA (Sarin et al., 2003). These contradictions and historical and political trajectories contextualize local communities' current interests in jointly managing forests with the state."}]},{"head":"Theorizing participation in JFM","index":4,"paragraphs":[{"index":1,"size":125,"text":"India's JFM programme comprises more than 100,000 village forest protection committees that co-manage 22 million hectares of forested land (Bhattacharya et al., 2010). In these groups-referred to as Village Forest Committees (VFCs) in Karnataka and JFM Committees (JFMCs) in Madhya Pradesh-residents jointly manage delineated forest areas with the state. JFMCs or VFCs comprise a general body formed by all adult villagers who seek membership, for a symbolic fee, and an Executive Committee (EC) of 10-15 elected village representatives and a State Forest Department (SFD) official. In theory, the EC is the main decision-making body at the community level and is responsible for daily management decisions, drafting a forest management plan, and ensuring fair benefit sharing both between communities and the SFD and among local residents."},{"index":2,"size":208,"text":"To promote equity in terms of decision-making and benefit sharing, the JFM handbook stipulates general requirements for the representation of socio-politically marginalized groups in the EC: if SCs and STs represent more than 10% of the village's population, each group must have one representative on the EC. If the two categories together represent 15 percent or less of the total population, the EC should include at least one SC or ST member. At least one landless member should be elected, and women should make up at least one third of the EC (GoI n.d., p. 9). There is considerable variation in state-specific JFM provisions, however, and several states have quotas within quotas, specifying the minimum number of women from marginalized groups who should occupy reserved seats. 1  Yet, quotas alone do not adequately address equity concerns. Scholars have questioned the value of 'threshold criteria' or reservedseat polices on the basis that they can encourage a tokenistic presence (Locke, 1999;Sundar, 2000;Mohanty and Sahu, 2012). A focus on numbers can conceal the hierarchies and social norms that privilege the participation of upper castes in public decision-making, while the interests of marginalized groups, who are usually the most forest dependent community members, remain unheard (Nightingale, 2002(Nightingale, , 2011;;Persha and Andersson, 2014)."},{"index":3,"size":103,"text":"In what follows, we draw on Agarwal's (2001) concept of participation as a six-rung ladder that moves from nominal or passive participation at its lowest end to high and active participation on the other. Moving up the ladder, participants' capacities to understand, have a voice in, and influence decision-making processes increase. An inclusive and empowered participation characterizes the top rung of the ladder, where institutional barriers are dismantled and diverse individuals and social groups engage in decisions that affect their lives. Based on this notion, Agarwal (2001) describes 'participatory exclusions' as the paradoxical situation whereby exclusions are experienced even within seemingly participatory institutions."}]},{"head":"Conceptualizing intersectionality in an Indian context","index":5,"paragraphs":[{"index":1,"size":228,"text":"Feminist theories on intersectionality can add analytical purchase to our understanding of inclusive participation in JFM. Intersectionality refers to how multiple axes of social differentiation, such as gender, age, ethnicity or caste, and socio-economic status, among others, intersect and co-constitute each other to create unique social locations (Crenshaw, 1989). The subjectivities thus created are contextually specific and dynamic, varying across time and place (Hankivsky, 2012). As systems of domination, oppression or discrimination cross, they are compounded, such that the grouping of 'the poor' or 'lower castes' or 'women' under-estimates the disadvantages of multiply disadvantaged women. Mollet and Faria (2013) calls for analyses that engage with intersectionality so as to generate a more complex and messier notion of gender, which explicitly accounts for race, racialization and racism. Analyzing the processes by which multiple relations of marginalization intersect and shape participation in community forestry requires us to 'specify the particularity that each inequality brings to each instance' (Walby et al., 2012, p. 235). For instance, in the United States, Latino and African American women considered that despite their inseparability, in many instances 'race' played a more significant role in shaping their marginalization than gender (hooks, 1990;Kobayashi and Peake, 1994). In a Nepalese (Nightingale, 2011) or Indian context, several scholars emphasize the intersection of gender, caste, class, religion, and age, challenging the conception of 'casteless gender' and 'genderless caste' (Rege, 2006)."},{"index":2,"size":98,"text":"Already one hundred years ago, Ambedkar (1916), the father of the Indian constitution, argued that strict adherence to endogamy (or marrying within classes), which maintains the caste system, is enforced through the control of women's sexuality and mobility. As Chakravarti (1993, p. 579) notes, The purity of women has a centrality in brahmanical patriarchy 2 […] because the purity of caste is contingent upon it […] The safeguarding of the caste structure is achieved through the highly restricted movement of women or even through female seclusion. Women are regarded as gate-ways-literally points of entrance into the caste system."},{"index":3,"size":65,"text":"Restrictions on women's mobility are particularly prominent among 'upper caste' communities, which are considered the purest and most at risk of being polluted (Rao, 2003). Particularly among wealthier upper caste women, the withdrawal from non-domestic economic activities is a status marker and reinforces women's economic dependence on men (Kandiyoti, 1988). The social honour that accompanies such practices make women complicit in their subordination (Chakravarti, 1993)."},{"index":4,"size":151,"text":"Indian Scholars also underscore the overlap of caste with class, as the social structure that maintains people in hereditary (caste) positions and occupational classes has material consequences. For so-called 'lower caste' groups, discriminatory institutions limit not only economic mobility, but also educational achievements and participation in governance structures (Deshpande, 2000, Deshpande, 2006). Attempts to redress these inequalities have led to official designations by the Government of India for various historically disadvantaged castes, referred to as Scheduled Castes (SCs) and Adivasi (indigenous) peoples or Scheduled Tribes (STs), which entitle listed peoples to certain forms of government support as per the Scheduled Castes and the Scheduled Tribes (Prevention of Atrocities) Act, 1989[Act No. 33 of 1989], (GoI, 1989). Such entitlements include affirmative action in education as well as in governance; or reserved seats for lower castes and women, in some cases with constitutionally mandated proportions of Dalit or tribal women (Stephen, 2012;Haritas, 2016)."},{"index":5,"size":86,"text":"Yet, the effectiveness of these reservations for levelling power relations and life chances is a matter of debate (e.g. Bryld, 2001;Ban and Rao, 2008). Movements such as Dalit feminism underscore that the historical oppression of so-called backward castes and minorities continues to be reflected in modern institutions and organizations (Rege, 2006;Rege et al., 2013). They advance the need to center analyses of caste and gender discrimination on the experiences of Dalit women, whose subjectivities are distinct from those of upper caste women and feminists (Rege, 1998)."},{"index":6,"size":85,"text":"In this study, we focus on how intersecting relations of gender and caste or tribal affiliation, which are also strongly associated with landholdings and education, position women in the study sites. We show that these enmeshed relations, and the places and environmental histories that embed them, mediate local interest and engagement in forest governance. Following Thompson (2016) and Westholm (2016, p. 514), we demonstrate the 'situated specificity of social life', and the importance of place in shaping social inclusion and exclusion in communal forest management."}]},{"head":"Research context and methods","index":6,"paragraphs":[]},{"head":"Study sites","index":7,"paragraphs":[{"index":1,"size":132,"text":"This study is situated in Uttara Kannada District in the state of Karnataka, and Mandla District in the state of Madhya Pradesh, in south-western and central India, respectively. The two sites offer distinct geographical, socio-cultural, and political-economic contexts for studying exclusions in the context of JFM. As explained below, the first presents exclusions on the basis of intersecting relations of caste and gender, whereas the second demonstrates that exclusions also occur among different tribal communities, which are often grouped together in government classifications referring to disenfranchised populations. Situating the study in these contrasting contexts, in which JFM has followed separate trajectories, offers insight into the pervasiveness of social exclusions across distinct manifestations of JFM, the plural processes by which these occur, and the different meanings they hold for local women and men."},{"index":2,"size":129,"text":"Uttara Kannada is located in the Western Ghats, which is covered by a lush and biodiverse tropical rainforest (Myers et al., 2000). An area of about 170,000 ha, or 80% of the District, is under forest cover (Forest Survey of India, 2017). Karnataka adopted JFM in 1993 and is hailed as an example of successful JFM (Assis et al., 2010). Uttara Kannada District now counts over 500 VFCs. Home to the Appiko movement-a civil protest initiated in 1983 against illegal logging and in support of sustainable forest management (Feeney, 1998)-the area is known for local people's custodianship and protection of the forest (Pinto, 2013). Yet, rapid population growth and infrastructural development, such as dam and road construction, have significantly increased the pressure on forest lands and resources (UNDP, 2005)."},{"index":3,"size":160,"text":"The population of Uttara Kannada mainly consists of native Hindus (70%) of different castes, with 8.1% of the population coming from SCs and 2.4% from STs (GoI, 2011). These social groups show differences in terms of landholdings and forest dependency, as well as in education and socio-economic and political opportunities. Havik Brahmins are on the whole the wealthiest group and own larger landholdings. They have been farming betel nut (Areca catechu) intercropped with various spices and fruit trees since colonial times and were ceded exclusive privileges to gather mulching material for their spice gardens from adjoining lands under British rule. These lands, which are particular to Uttara Kannada, are known as 'soppina-betta' or 'betta' lands. Although some Havik Brahmins are poor, many families have prospered primarily from the sale of spices and betel nuts. Havik Brahmins tend to have better access to education and stronger social and political networks than other ethnic communities in Uttara Kannada (Hegde et al., 2017)."},{"index":4,"size":109,"text":"The Khare Vokkaliga are the second largest farmer group and among those living in the region for the longest time. They, and other resident groups such as the Marathi, Poojari, and Sherugars, are classified as an Other Backward Class (OBC) 3 in Karnataka. They are predominantly small-scale and subsistence farmers who cultivate paddy, kitchen gardens, and some betel nut palms. They depend on common property forest lands for fuelwood, poles, fodder, food and medicinals. They also work as waged laborers on the betel nut farms of larger landowners and rely on additional income from the sale of NTFPs collected in the forests (Rai and Uhl, 2004;Assis et al., 2010)."},{"index":5,"size":59,"text":"The Siddhis and Naiks are the most populous STs in the study site. They have only marginal landholdings and mostly live on 'encroached' lands in hamlets located in the forests. Although they work for wages, forests play a vital role in their livelihoods, with women especially spending substantial time collecting fuelwood and NTFPs for subsistence and sale (Grosse, 2016)."},{"index":6,"size":68,"text":"In Uttara Kannada, ethnicity and identity are closely linked to the caste system and the social norms it embeds. As noted above and observed in the study site, Brahmanical patriarchy places particular restrictions on Brahmin women's movements and behaviours. Patrilineal descent and inheritance give men rights to land (among landholding families) and livestock (Feeney, 1998). Independent of their ethnicity, women are generally responsible for domestic work and caregiving."},{"index":7,"size":262,"text":"During the seasons of paddy planting and harvesting as well as betel nut harvesting, their workload increases with seasonal agricultural tasks. These tasks vary depending on women's ethnicity, caste, marital status as well as socio-economic status, and whether the household is organized in a traditional extended family or as a nuclear family. Given social sanctions pertaining to their mobility, Havik Brahmin women generally carry out activities in their homes and immediate surroundings, including on betta lands where they collect tree products. In contrast, women from lower castes travel to or live on the farms of their employers, particularly during the harvesting season, and enter the forest more frequently to collect firewood and NTFPs (Grosse, 2016). Mandla District, the second study site, is located in the Satpura Hills of south-east Madhya Pradesh. Dry deciduous, biodiverse forests cover 44% of the district (Forest Survey of India, 2017) and carry high value products including teak (Tectona grandis) and sal (Shorea robusta) for timber and numerous NTFPs. Since the 1970s, the creation of wildlife sanctuaries, national parks, and protected areas have increased pressure on the livelihoods of forest-dependent communities (Mukherjee, 2009;Véron and Fehr, 2011). Outside of protected areas, forests used for subsistence living are often degraded (Debnath and Dasgupta, 2006). Madhya Pradesh adopted JFM in 1991 (Buckles, 1999). At the time of the study, Mandla District counted 285 JFMCs, although according to the District Forest Officer, only 30 of these were active (pers. comm., December 1, 2015). All study participants from the district characterized JFM and relations between the Forest Department and local residents as conflict-ridden."},{"index":8,"size":106,"text":"The state of Madhya Pradesh has the largest population of STsapproximately 14 million people -living in the forest and in forest fringe areas (GoI, 2011). As in India's other highly forested tribal areas, it harbours a particularly high concentration of poverty (World Bank, 2016). Mandla District is populated by a majority of STs (58%), primarily of Bhil (37%) and Gond (35.6%) descent, OBCs such as the Panka and the Ahir 4 , and members of the General Class. 5 The district's main religions are Hinduism (80.5%), followed by 'Other Religions and Persuasions' (16.5%), and a small number of Muslims and Christians (together roughly 3%) (GoI, 2011)."},{"index":9,"size":175,"text":"Mandla's population mainly consists of small-scale farmers or landless labourers who sharecrop. Forest dependency decreases as the size of landholdings increase, but all groups are highly dependent on NTFPs as well as on scarce fuelwood and water resources (Véron and Fehr, 2011). Overlapping land claims by communities and the government contribute to the vulnerability of local communities (Chaturvedi et al., 2018). In Madhya Pradesh as a whole, communities have secured 'Individual Forest Rights' (IFR) titles (pattas) to only 766,938 acres of forest fringe areas, or 13 percent of the area with 'titling potential' (CFR-LA, 2016). Interviews conducted in the present study show that Hindu and Gond communities have land titles over small agricultural plots, whereas more forest-dependent communities (Baiga, lower sub-caste Gond, and other STs) lack secure titles to land and forests. Villagers living in the forest fringe have nistari or domestic use rights to forest products, but these do not grant titles. Moreover, unclear boundaries and lack of knowledge of rights by the Forest Department and communities contribute their denial (Winrock International India, 2005)."},{"index":10,"size":68,"text":"Many people in Mandla district have a secondary occupation, working as hired labourers and seeking (off-farm) employment opportunities, such as those offered by the Mahatma Gandhi National Rural Employment Guarantee Act (2005) (MGNREGA) -although study participants considered these jobs difficult to obtain. Increased tourism, population growth and poverty levels as well as restrictions on forest access, management and use, pose significant challenges for local forest-dependent communities (GoI, 2011)."},{"index":11,"size":103,"text":"Hindu and Gond communities are the wealthiest in Mandla and dominate agricultural production. The Panka are the predominant Hindu group in the study site and often fulfil important community roles, for example, as blacksmiths. The Gond have diverse cultural and social practices and hold a historically important role in the region as powerful landowners and political figureheads under colonial rule. They are both agro-foresters and pastoralists. In the study site, they are colloquially referred to as 'the farmers', and are regarded as relatively powerful; although in a complex system of tribal hierarchies and subtribes, their socioeconomic and landholding status varies widely (Patel, 1998)."},{"index":12,"size":161,"text":"Of note in Mandla is the presence of the Baiga, who are categorised as one of three Particularly Vulnerable Tribal Groups (PVTG) in Madhya Pradesh. 6 The highest concentration of Baiga in Madhya Pradesh and India is spread across Mandla (at 3% of the district's population) and surrounding districts (GoI, 2011). The Baiga are often entirely forest dependent and highly marginalised. They practice a system of shifting cultivation on forest slopes under rainfed conditions, and plough cultivation when they can avail arable land (Patel, 1998). In two of the five study villages, the Baiga own no cultivable land and are fully reliant on the forest and on sharecropping for food. They mostly live in 'encroached' forest fringes, 7 and harvest bamboo for use and sale in local markets (Chakma et al., 2014) as well as other high value NTFPs. They worship the forest and its spirits and have a plethora of forestrelated songs, myths, dances, and medicines (Soni and Pradhan, 2015)."},{"index":13,"size":120,"text":"The Baiga have a centuries-long history of inhabitation in Madhya Pradesh and neighbouring Chhattisgarh. The Baiga, like other forest tribes, have had conflictual relations with the state dating back to colonial times (McEldowney, 1980). 8 Considered the 'wildest and most isolated tribal people' of the area, the British sought to transform their way of life from nomadic forest cultivators to 'civilized' settled farmers (McEldowney, 1980, p. 416). Given the high value of the (sal and teak) forest they inhabit, the state attempted to capture these lands for colonization and state revenue (McEldowney, 1980). Continuities in postindependence state policies and pejorative attitudes towards forest tribes maintain discrimination and tensions in relations between the Baiga and the state (Sarin et al., 2003)."},{"index":14,"size":97,"text":"As in Uttara Kannada, interviews in Mandla show that tribal women in the district are primary collectors of forest products for household consumption and sale. Patrilineal land tenure systems in Mandla give men customary inheritance rights to land and livestock (FAO n.d.). Limitations on women's mobility do not apply as they do among upper caste, wealthier Hindu women, and tribal cultures generally have more liberal norms regarding marriage. Like lower caste women, tribal women have greater independence to pursue economic activities, and educated tribal women are increasingly gaining respect and leadership roles within their communities (FAO n.d.)."}]},{"head":"Data collection and analysis","index":8,"paragraphs":[{"index":1,"size":88,"text":"Data were collected through in-depth interviews carried out in Uttara Kannada and Mandla districts between August and December 2015. Interviews with 45 participants were conducted in six villages in Uttara Kannada District, and with 41 participants in five villages of Mandla District. In each district, villages were randomly selected among a set of 25 villages that were retained for high levels of forest cover, high dependency on the forest among low income communities, low economic indices, high threats to the forest, and presence of a VFC or JFMC."},{"index":2,"size":272,"text":"Interviewees included farmers from different ethnic, socio-economic and age groups, presidents and representatives from the Executive Committee (EC) of the VFCs/JFMCs, and members of the local administrative council (Panchayat) and of women's self-help groups. Adults in all households of the study villages-and thus all research participants-were members of the general assembly of their VFC/JFMCs, which were formed in the late 1990s and early 2000s. In Uttara Kannada, participants included 22 women and 23 men aged 27 to 70. Of these participants, 15 were Havik Brahmins, 19 belonged to the lower castes, and five to STs. Additionally, three Forest Officers (range and division level, all men) and three conservation NGO workers (one woman and two men) were interviewed. In Mandla, 20 women and 19 men 25 to 75 years of age were interviewed; 19 were Gond (ST), 10 Baiga (PVTG), and 8 Panka and sub-castes, 1 Ahir, and one person selfidentified as Muslim. In addition, two male Forest Department Officers (District Officers) and one female conservation NGO worker -all Brahmin Hindu -were interviewed. Interviewees were identified through snowball sampling. A gender balance was sought but was not possible among SFD officials in both districts or among VFC presidents interviewed in Uttara Kannada, who were all men. Interviews were conducted in Kannada in Uttara Kannada and in Hindi in Mandla, with translation to local dialect taking place when needed in Mandla. Questions focused on the participation of women and lower caste or tribal groups in two formal decision-making spaces: general assembly meetings of the VFC/JFMC, to which all members are invited, and the more frequent meetings of the EC, which only elected representatives attend."},{"index":3,"size":142,"text":"Data were coded using NVivo 10 and analyzed for recurring themes based on a mixed deductive and inductive approaches. Quotes were selected to illustrate perceptions that found recurrent expression among participants with shared social positions linked to gender, caste or ethnicity, and other social identities. The qualitative methodology adopted, which privileges an in-depth and situated exploration of the experiences of socially differentiated groups, precludes the ability to claim the representativeness or generalizability of the data gathered. Yet, it allows for a rich analysis of processes of exclusion in JFM in relation to collective identification, or 'the claims and attributions that individuals make about their position in the social order of things, their views of where and to what they belong as well as an understanding of the broader social relations that constitute and are constituted in this process' (Anthias, 2008, p. 491)."}]},{"head":"Results and discussion: unpacking gender in JFM","index":9,"paragraphs":[]},{"head":"Approaching JFM through a place-based lens","index":10,"paragraphs":[{"index":1,"size":324,"text":"In Uttara Kannada, place-specific, spatial factors pose barriers to attending VFC and EC meetings. Households are geographically dispersed within the study villages and scattered within the forest. The village centre, when there is one, is located several kilometres away from some houses, which are connected across hills only via foot or motorbike paths. Although some better resourced men have a motorbike, others -men and women -must walk multiple kilometres to attend meetings. For the labour community, this can add to long distances travelled daily by foot to reach the fields of their employers. 6 PVTGs are a sub-group of the STs who have particularly low development (poverty, literacy, nutrition, etc.)  Older people or those who are unwell cannot travel these distances, which also adds considerably to the time commitment of attending meetings. A related problem is the inadequacy of communication channels and limited circulation of information, particularly among those who do not have mobile phones. This means that to inform some residents about meetings, the forest guard or VFC executive members must visit their house when they are home. These spatial particularities are not reproduced in Mandla District, which is relatively flat and where houses are physically grouped together. Yet, despite these conditions, Uttara Kannada is considered an example of successful JFM due to relatively favourable relations between the SFD and local communities. An NGO staff explains that this was not always the case: building relatively congenial relations between communities and the FD took time and involved active struggle: You know, here in the area of Sirsi we are very lucky. We managed to build good relationships with the Forest Department, which is very different from other areas in India. It took us about 20 years to reach there, where we are now, and many fights. The Appiko movement was very important for showing to the Forest Department that the people are there and that they care about what is happening to the forests."},{"index":2,"size":53,"text":"The Appiko movement recurs in local people's -especially men'snarratives of forest management. An increase in awareness about the importance of conserving the forest is reported to have caused palpable changes in forest management. An elder Khare Vokkaliga man from Haldur village 9 , among others, considers that several factors contributed to this awareness:"},{"index":3,"size":71,"text":"The establishment of the VFC was one of the most important events. We also had some good leaders in the village that helped to create awareness. We were also in the centre of the Appiko movement, which was definitely important. Two representatives from the movement were invited once here to the village for a meeting. I remember they gave a great speech about the importance of the forests for the people."},{"index":4,"size":100,"text":"Participants provided several examples of collaboration between the SFD and the VFC and/or local people, citing the beneficial role of particular individuals, such as an influential District Forest Officer who stood up for local people's rights. An SFD official describes the role of NGOs in bridging differences between the SFD and communities, and in changing the mindset of SFD officers. Today, he states, they [SFD] have to share some information and 'Local people are informed about the issues and their rights. The conflict is not about fights anymore but more about discussion and negotiation to achieve the best possible solution.'"},{"index":5,"size":83,"text":"Alternative sources of income in the area stemming from betel nut sales allow residents to more sustainably manage their forest extraction activities. Moreover, an NGO staff and an SFD officer explain that higher overall levels of education in Uttara Kannada District (relative to other parts of the state) allow many government and NGO programs to be successfully implemented. Economic and educational aspects also lessen power differentials between the SFD and educated, more resourced members of local communities, favouring more harmonious relations among them."},{"index":6,"size":95,"text":"These conditions are not found in Mandla, where interviewees describe a dysfunctional JFM system. Both women and men convey a severe lack of livelihood options, high reliance on the forest to survive, and a sense of helplessness with respect to their forest's degradation. They cite few, if any benefits from JFM, and very few regard the forest as being in better condition or better managed due to JFM. On the whole, community members lack knowledge about JFM, and unlike in Uttara Kannada, a lack of interest to participate is manifest across ethnic and gender groups."},{"index":7,"size":49,"text":"Historically conflictual relations between the Madhya Pradesh SFD and local villagers, embedded in ethnic, socio-economic and educational differences that accentuate highly skewed power relations, are at the heart of the matter. As an SFD official explains, the FD does not see local people as viable partners in forest management:"},{"index":8,"size":69,"text":"There are insufficient funds to provide employment to the communities. The only option is to take action against people, and fullfledged government support to take over the forests. […] No. I refuse to think that [the SFD and villagers working together] is an answer. They have no thought to protect the forest. The villagers do not understand the cause of why people like us want to protect the forest."},{"index":9,"size":53,"text":"In turn, local women and men perceive the SFD as a policing force against which they must manoeuvre for basic subsistence. The conflict between the SFD and villagers results in and reinforces local people's low sense of ownership over their forests, as this quote by an impoverished Gond woman from Sumreri village illustrates:"},{"index":10,"size":104,"text":"There is a really big jungle. It's the government's jungle. The government has captured the forest. If you go to the forest with an axe, they don't let us. The government cuts the forests. The forest guards take the logs away with them. If we quarrel with them, they don't give us the permit to get inside, not even to get fuelwood. […] Even if we collect firewood, they won't let us take it out of the forest. We are now going here close by to get fuelwood. How are we going to live? They scare us. They also do this with the men."},{"index":11,"size":145,"text":"In fact, participants lack knowledge about their rights, including the rights of traditional forest dwellers (SCs and STs) to claim for individual and community land ownership in the form of pattas (land titles) through the FRA. Hence, a middle-aged Gond man from Bandholi village explains that people 'are under pressure. […] the Deputy Ranger tells us that \"the jungle is not your land and so you have to do what we say or else we will kick you out.\"' This lack of knowledge-and lack of formal rights to land-makes people reticent to engage and express dissent through JFM. Given the lack of incentives or sense of ownership over the forest and its management, several participants believe they should be paid to participate in JFM or to serve on the JFMC's EC, as 'no one is going to work for free' (male Gond farmer, Karki village)."},{"index":12,"size":35,"text":"Hence, villagers report that their JFMCs are not very active, if at all, and that if or when JFMCs carry out meetings, many village residents are not aware of them. There is a sentiment that:"},{"index":13,"size":46,"text":"The meetings are basically just for the people of the committee, they are just a formality. The Forest Department does all of the administrative stuff. Sometimes some of the village people say something, but the Forest Department doesn't really listen to them (elder Gond man, Bandholi)."},{"index":14,"size":40,"text":"Participants-male and female-further indicate that they have too many other problems to cope with, such as a water shortages and unemployment, and that people who do attend meetings make requests but 'No one comes here to help' (Gond woman, Bandholi)."},{"index":15,"size":97,"text":"JFM is thus received differently across the two study states, based on distinct political economic and historical conditions. In the Mandla case, social exclusions relate first and foremost to an incomplete and inadequate devolution of rights and responsibilities, including autonomy in decision-making, to all community members. They reflect the lower levels of agency, dating back to colonial times, among impoverished tribes in Mandla than among upper caste betel nut farmers in Uttara Kannada in relation to the state. Yet, in both sites, exclusions are accentuated by uneven power relations within communities across several axes of social differentiation."}]},{"head":"Approaching JFM with a gender lens","index":11,"paragraphs":[{"index":1,"size":98,"text":"Perceptions about women's participation in JFM in Uttara Kannada are mixed. Most participants in Uttara Kannada indicate that usually father and/or son attend annual general VFC assemblies, but some (e.g. female Havik Brahmin VFC board member, Navalgi village) suggest that 20 to 30% of participants can be women, mostly EC members. In the study villages, Havik Brahmin women are occupying the (at least two) VFC seats reserved for them in the EC and SC or ST women occupy seats reserved for women of their particular caste or ethnic group, but women are not nominated to fill non-reserved seats."},{"index":2,"size":78,"text":"Yet, the number of seats women occupy tell a limited part of the story. In several villages, few, if any, women VFC members reportedly attend EC meetings or general assemblies. According to an NGO staff from Uttara Kannada, participation 'depends on the issue. This is not only for the participation of women but also more in general. Some issues are more important for villagers. For example, when it comes to the sharing of revenues, then everyone will come'."},{"index":3,"size":86,"text":"Most participants report low levels of women's participation at meetings due to several barriers. First, in the two study sites, participants refer to women's labour constraints: 'See, we have family. We have lots of work to do. We go to the market. We have our limits' (Gond female JFMC president, Bandholi). Domestic responsibilities are especially heavy for women living in nuclear (versus traditional extended) families, which are increasingly prevalent and in which several women cannot support each other in accomplishing household responsibilities (Havik Brahmin woman, Jagadal)."},{"index":4,"size":160,"text":"Second, women's engagement in forest activities, and related knowledge, is low for certain caste groups. In Mandla, women from all resident ethnic groups are highly involved in forest-related activities. In fact, conflicts with the SFD, particularly over fuelwood, often involve women collectors. Several women describe standing up to the forest guards to retain the fuelwood they need to cook for their family and describe conflicts with the FD with such statements as: 'We heard someone killed the forest guard -good!' (elder Baiga widow, Deolond). In Uttara Kannada, however, Havik Brahmin women reportedly rarely frequent the forest. This is particularly the case when forests are located some distance from the homestead, as women don't ride motorbikes or drive cars and report safety concerns when travelling alone. Frequent references were also made to the normative undesirability of Havik Brahmin women leaving their house. Moreover, for more resourced Havik Brahmin households, betta lands rather than forests serve as a source of forest products."},{"index":5,"size":121,"text":"Third, and closely related, there is a sense that women who are not involved in forest related activities (i.e. Havik Brahmin women in Uttara Kannada) lack interest in forest management. As the male Havik Brahmin VFC president of Haldur village indicates, 'To be a member of the VFC EC and to attend the meetings is a service to the community. There are no benefits from it. It is not a job. We invest our free time and sometimes our own money to be there'. Hence, one must be motivated by the cause. In line with this, in Uttara Kannada, the few women who regularly attend meetings are reportedly mainly from non-Havik Brahmin communities, whose livelihoods are intimately tied to forest use."},{"index":6,"size":108,"text":"Barriers posed by the manner in which meetings are organized further impede women's participation. Meetings are often held at inconvenient times for them, such as in the evenings, when they are busiest with childcare, dinner preparations and milking cows. Although they might attend meetings if these were scheduled earlier, a Havik Brahmin woman from Haldur believes that, 'it doesn't make sense to have the meetings then. It would not be possible for the men to participate because in the afternoons they are working as labour or in the forests.' In both sites, women's mobility also poses challenges; with particular limitations applying to Havik Brahmin women, as noted above."},{"index":7,"size":57,"text":"Importantly, women's lack of participation in JFM is also a function of cultural norms that give men more voice and responsibility in the public domain. In both sites, participants stress that public affairs are relegated to men, and that it is men's role to attend VFC/JFMC meetings. Hence, a male NGO staff from Uttara Kannada indicates that:"},{"index":8,"size":11,"text":"Women are mostly [at VFC EC meetings] to sign the records."},{"index":9,"size":41,"text":"[…] It is a male dominated society. The main responsibility of women is to take care of the family, do the cooking and all the other housekeeping activities inside the house. This is what many believe women can and should do."},{"index":10,"size":90,"text":"As a result, women are largely silent, and silenced, in formal JFMC processes. As an older Baiga woman from Deolond village states, 'No woman speaks about the forest. I don't speak, my daughter doesn't speak, my grand-daughter doesn't speak. It is like that. No one tells us not to speak-we just don't speak.' A woman NGO staff from Uttara Kannada adds that, 'Women feel like they are in the wrong place in a VFC meeting. If problems are there, then women trust that men will come up with some solutions.'"},{"index":11,"size":225,"text":"Norms favouring men in public life were even more strongly articulated in Mandla, where female participants largely reported that, 'when the women speak, the men tell the women \"Shut up, you don't know what you are talking about\", and they say \"don't speak in front of everyone\"' (Panka woman, Deolond). Speaking out at meetings can be perceived as a sign of disrespect for their male counterparts, and meeting attendance in itself can be a sign of disobedience towards a woman's husband. According to a male farmer from Bandholi, 'I feel like: there is our great-grandfather and there is our grandfather. That is why they [women] shouldn't and don't speak. They are respecting the elder men. They are taught to be like that'. There is also a perception that women do not to have important ideas to contribute. A Gond female JFMC president from Sumreri states that, 'my husband tells me 'you don't utter a word.' […] They say the women know less and the men know more. The men are physically stronger and are smarter than the women.' Restrictive gender norms are reinforced by the SFD. For instance, a male participant from Mandla reports that although his wife is the one who sits on the JFMC EC, when there is a meeting, the SFD invites him to attend in her place (Gond community leader, Bandholi)."},{"index":12,"size":103,"text":"Low levels of formal education, which are particularly prevalent among women, further discourage women's participation in JFM. Illiterate women and men are dismissed, and often write themselves off, as being ignorant. A common sentiment among women and men in both study sites is that educated women (and men) are more likely to attend and participate in meetings. In Uttara Kannada, several participants elucidated a link between education and awareness and interest in conserving the forest, self-confidence, and capacity to participate in public fora and decision-making processes. Educated women are thus considered more active not only in VFCs, but in public life more generally."},{"index":13,"size":102,"text":"Lack of knowledge and awareness about JFM are both a cause and consequence of women's lack of participation. Many women interviewed in Uttara Kannada did not know about the VFC and its functions. Others did not know whether their household was part of the VFC and were not informed about when meetings are held. In Mandla, even the two women VFC presidents lacked an understanding of their JFMC and their role within it, and were unaware that they had been nominated as president during the elections. This lends weight to the allegation that women's participation in JFM is still for name's sake."},{"index":14,"size":170,"text":"Nonetheless, participants note exceptions to these patterns. In Mandla, some report that while women who attend general assembly meetings apparently do not speak up, they listen carefully, and participation essentially depends on the individual (Gond man, Antri). A middle-aged Panka woman from Karki believes that times are changing, and 'Earlier the women were confined, but now the women are smarter and they are speaking more'. Other interviewees in Mandla recognize Baiga women's extensive knowledge of the forest and of forest products, and their stake in forest management. In Uttara Kannada, Jagadal's (male) VFC president apparently encourages women's participation by asking women EC members to express their opinion before men; and a female Havik Brahmin EC member from Tungal feels that, 'I have the ability to influence the decisions taken by the VFC to assign some money from the revolving funds to the women's self-help groups.' Others believe that although few women attend general assembly meetings, 'when they go to such meetings, they tend to be engaged' (young Siddhi woman, Chimmad)."},{"index":15,"size":44,"text":"These examples show that some women and supportive men are able to open up spaces for women within JFM despite the structural barriers that hinder their participation. Just as the general climate for JFM has improved in Uttara Kannada, an NGO worker believes that:"},{"index":16,"size":75,"text":"[T]hings have improved a lot […] The condition of the forest and in general of the environment have changed, the Panchayat system has changed too so there are different and more opportunities for women to participate. A big contribution also comes from the women's self-help groups that have been established in many villages. Those help women follow some income generating activities and take their own decisions about what they want to do and to learn."}]},{"head":"Approaching JFM with a caste or ethnic lens","index":12,"paragraphs":[{"index":1,"size":47,"text":"Aside from and intersecting with gender, caste or ethnic affiliation strongly shape participation in JFM. As is the case for women, in terms of representation, there are seats reserved for marginalized communities in the VFC or JFMC, some of which are reserved for women from those communities."},{"index":2,"size":175,"text":"In Uttara Kannada, representatives of ST/SC and OBC communities (none of whom hold office bearing roles) mainly expressed that they do participate and are heard in matters of forest management. As an older Khare Vokkaliga man from Jagadal states, 'if we [Khare Vokkaliga] come up with our opinions during general meetings, most will think that we have a good point. Our feelings are also valued.' Members of the Havik Brahmin community, including many VFC EC members and presidents, also consider that ST/SC and OBC members participate well in JFM, especially as they have the largest vested interest in maintaining and generating income from the forest. According to the elder Havik Brahmin president of Chimmad VFC, The dependency on the forest influences the level of active participation of villagers in the VFC meeting. The landless, and people belonging to the Knights and Marathis use the forests especially for [non-timber] forest products and so are very interested in participating in the meetings. They attend because they need the permits to harvest the forest products from the VFC."},{"index":3,"size":49,"text":"Members of marginalized groups attend general assembly meetings in large numbers especially when NTFP extraction permits and rules of NTFP collection are discussed. In some villages, to promote inclusiveness, VFC decisions may be taken only upon consultation with all communities in the village (male Havik Brahmin VFC president, Tungal)."},{"index":4,"size":38,"text":"Yet, a general climate of inequality within the villages permeates JFM. Power is concentrated in the hands of the Havik Brahmin community, and particularly of its male members, as is village-level decision-making authority. An SFD official believes that:"},{"index":5,"size":69,"text":"[VFC] failures are more common when there is no homogeneity in the community. In that case, it is the majority that takes over. Particular set ups in the politics inside the communities also have an influence. Big differences in economic and social status, as we can see them in India in particular, and in education make the implementation more difficult. Power relations inside the villages should not be forgotten."},{"index":6,"size":32,"text":"Several Havik Brahmin responses insinuate the perception that 'they' (the ST/SC community) are to blame for cutting down the forest and that 'they' lack education and awareness to meaningfully participate in JFM."},{"index":7,"size":124,"text":"On a practical level, OBCs and ST/SCs face other barriers in participating in the VFC EC and general assembly meetings and decisions. A main barrier is competing work schedules, as members of these communities are land-poor or landless and work for daily wages. In some cases, meetings are held in the evenings to facilitate the participation of (male) waged labourers (which is prioritized over women's participation, as noted earlier), but time poverty complicates their participation (NGO staff, Uttara Kannada). Another barrier is the lack of formal education, which is pronounced among marginalized communities in both study sites. As mentioned above, in Uttara Kannada, physical isolation and communication barriers can also be particularly challenging for landless families that live in remote areas of the forest."},{"index":8,"size":60,"text":"In Mandla, exclusions occur instead among different groups of STs and SCs, and particularly affect the Baiga, who experience high levels of discrimination. Participants from all groups state that there are no conflicts related to ethnicity or caste in their village and that all live in harmony. Yet, discomfort around the issue and pejorative language are evident in their responses."},{"index":9,"size":84,"text":"Participants from different resident groups and the SFD agree that the Baiga are the most dependent on the forest, which is coherent with self-identification by Baiga interviewees. Many blame the Baiga for the current state of the forests, although both the Gond and Baiga are named as the communities that are gathering the majority of green/live wood, cutting full branches for timber and firewood, and unsustainably harvesting NTFPs. A female Baiga JFMC president from Antri believes that the Baiga are unfairly blamed, however, as:"},{"index":10,"size":53,"text":"[E]veryone says that the Baiga are destroying the forest -but everyone is destroying the forest. Everyone is doing these things. People here are poor. Baiga are more poor so people blame things on us. […] Baiga women were vocal about conflicts with the SFD and noted that there were no Baiga forest guards."},{"index":11,"size":140,"text":"A number of interviewees indicated that the Adivasis (Baigas and Gonds) are well represented in the JFMCs. Yet, in at least two villages, their participation at meetings is low compared with the Panka, who tend to have more formal education. As a Baiga man from Antri notes, 'The Panka speak the most. Baiga, we don't know why, we don't speak. We are lower caste people, we are jungle people. We are considered the lowest caste.' Similar social and participation hierarchies (e.g. Ahir followed by Panka, Gond, and Baiga) are described in other villages. A lack of formal education and illiteracy are cited as principal reasons why the Baiga and the Gond do not participate actively in JFMC meetings. In one village, however, a Gond participant indicates that the Gond dominate JFMC meetings, again indicating that inter-ethnic dynamics are case-(village-) specific."}]},{"head":"Where gender meets ethnicity","index":13,"paragraphs":[{"index":1,"size":115,"text":"The aforementioned gender and caste or ethnic relations do not operate independently, but rather intersect to shape exclusions in JFM. For example, in Uttara Kannada, a Siddhi woman from Chimmad confirms that, 'There is one woman that I know [in the VFC EC]. Her name is Yenki. 10 She belongs to the Siddhis too. That's why I know her. The others I don't know, they are from another caste.' Village-level social relations are structured by ethnicity, within which gender plays the core structuring role. There is little inter-mingling of women across ethnic groups, whose forest dependency, responsibilities and livelihood activities-and thus interests in JFM-both overlap and differ; substantiating the difficulty of separating gender from ethnicity."},{"index":2,"size":11,"text":"In Uttara Kannada, the experience of Havik Brahmin women 10 Pseudonym."},{"index":3,"size":179,"text":"M. Elias, et al. Geoforum 111 (2020) 218-228 particularly contrasts with that of women from other ethnic communities, who are more involved in forest-related activities and reportedly in JFM, despite facing important barriers. As noted above, some SC and ST women are reportedly very active and participating in the general assembly and VFC EC given the relevance of the forest to their livelihoods. In contrast, interest in JFM is low for Havik Brahmin women, who fill VFC seats reserved for women of the 'General Category'. 11 Stephen (2012) elucidates that powerful upper caste men have fielded their own women (wives, daughters, daughters-in-law) in reserved seats to maintain a hold over governance instances in India. The case of a Gond EC member's husband being invited to attend meetings in her stead illustrates similar occurrences among other ethnic groups. Rather than disrupting prevailing power relations between women and men and among women, these quotas may thus consolidate the dominance of men in rural social structure; and of upper caste men when those seats are reserved for women of the General Category."},{"index":4,"size":172,"text":"In Mandla, there are inequalities in participation across ST and SC communities in the general assembly and the EC. The Baiga in general are the most readily blamed for forest degradation and least vocal in JFM. When asked about women's participation in her village's (Antri's) JFMC, the Baiga JFMC president replied that, 'We are taught from the beginning to shut up, so since the beginning of time we don't talk. It's ok if the ladies talk less. […] The Baiga, we speak less, and the other people speak up.' In this comment, which juxtaposes gender and ethnicity, she points to women's exclusion not only because they are women, but because they are Baiga women-subject to norms and other structures that discriminate against them on the basis of both ethnicity and gender. Grouping marginalized groups into homogeneous categories (e.g. as STs or SCs), as is the case in Indian laws addressing tribal issues, deters focus from the inequalities that occur among these groups, and from their relevance in shaping local experiences (Rao, 2018)."},{"index":5,"size":279,"text":"In some cases, reserved seat policies for SCs as heads of village councils have been successful in causing psychic and behavioural changes in India (Chauchard, 2017); and in India and Nepal, having a critical mass of women with implicitly shared interests in community forestry institutions has improved outcomes for the disadvantaged (Agarwal, 2015). Yet, Tyagi and Das (2018) argue that by overlooking socio-economic and cultural differences among women and the structural causes of social exclusions, provisions for 'women' in India's forest policies have done little advance their inclusion in forestry. Indeed, the 33% quota for women loses some of its potency in light of the significant heterogeneities that exist within the group. This is not to negate the contribution quotas can make in opening up space for participation, but to underscore that numbers alone can divert attention from other critical issues related to participation and representation (Locke, 1999;Agarwal, 2010). Purkayastha et al. (2003, p. 505) state that: 'women qua women make up an empty theoretical category'. Given social inequalities and differences in their everyday experiences, as well as limited interactions among members of different caste groups, can Havik Brahmin women appropriately advance and defend the interests of Siddhi women? The intersectionality of gender and caste or tribal belonging raises questions about who is entitled to speak for whom (Spivak, 1988) and problematizes assumptions of shared 'women's' interests. It highlights instead the need to consider how 'women from different groups interact, strategise and ally in the political project of representing interests that are at times common to them as women and at times contradictory in the context of the differences of caste and class amongst them' (Haritas, 2016, p. 35)."},{"index":6,"size":193,"text":"Participation in JFM must also be contextualized within the places that embed these social relations of marginalization. This is evident when comparing the narratives of women and men in Uttara Kannada and Mandla, which present drastically different experiences with JFM due to the regions' distinct political economic histories and agro-ecological systems. Dependency on the forest is inversely related to the alternative sources of livelihoods available to local residents, which are more prevalent in Uttara Kannada than in Mandla. The Appiko movement instilled an awareness and ethic of conservation in Uttara Kannada and promoted favourable relations between communities and the SFD. In contrast, in Mandla, deep-rooted, highly conflictual relations between communities and the SFD, a lack of local knowledge about forest rights and a low sense of ownership over the forest, as well as a sense of powerlessness within JFM deter nearly all local men and women interviewed from wanting to participate in JFM. Emphasis on enhancing the participation of women or of specific ethnic groups will be in vain without addressing the profound sentiment of distrust and lack of faith and interest in the system on behalf of the FD and local communities."}]},{"head":"Conclusion: Beyond gender in JFM","index":14,"paragraphs":[{"index":1,"size":171,"text":"We have argued that although participation in JFM is a highly gendered process, the role of gender in shaping exclusions in JFM must be understood in relation to caste or ethnicity, which are associated with other factors such as landholdings, education, or class. The ways intersecting axes of social differentiation and marginalization position women in relation to the forest, the state, different groups of men, and each other, have implications for achieving inclusive forest governance. For example, unless JFM offers opportunities to address Havik Brahmin women's interests, the extent to which they will feel motivated to be actively involved-and indeed the relevance their participation, which entails opportunity costs-is questionable. In contrast, Baiga women's lack of participation is motivated by ethnic-based discrimination and lack of faith in the system, as well as low self-confidence related to a lack of formal education. In both cases, norms that relegate public affairs and representation to men, as well as other structures that discriminate against women in the public arena, underpin exclusions and must be addressed."},{"index":2,"size":171,"text":"Rethinking the appropriateness of the JFM model and its modalities, its capacity to serve the interests of the poor, and the constraints that hinder the active participation of the community as a whole is pressing. The case of Uttara Kannada demonstrates that change is possible, and that of Mandla urgently calls for change to protect both the communities and the forests. Rather than encouraging local forest users to participate in a top-down system that does not serve their interests, such change will require meaningfully and equitably engaging them in envisioning a system that does. As Sarin et al. (2003, p. 61) note, 'Meaningful devolution requires nurturing democratic, self-governing [community forest management] institutions with clear communal property rights and empowerment of forest-dependent women and men to make real choices for enhancing sustainable livelihoods in accordance with their own priorities.' In Mandla and Madhya Pradesh, the implementation of the FRA offers provisions to recognize the rights of traditional forest users to their resources and can make important strides in that direction (CFR-LA, 2016)."},{"index":3,"size":96,"text":"Place-based environmental and political economic histories matter and must shape the strategies adopted to enhance equitable participation in (any model of) forest management. In Uttara Kannada, certain measures at the VFC-level have shown progress in terms of the engaging women and lower-caste members in JFM deliberations and decisionmaking. These measures can be replicated to foster greater equity in other villages, states, or governance instances. Inclusive local forest governance can foster sharing of knowledge and opinions, and negotiations towards common visions among different resident communities. By challenging some culturally-imposed divisions, such processes can engender wider social transformations."}]}],"figures":[{"text":" indices. They are eligible for specific state benefit schemes and programs. M. Elias, et al. Geoforum 111 (2020) 218-228 M. Elias, et al.Geoforum 111 (2020) 218-228  "}],"sieverID":"6665d1de-46cf-476b-b791-583904acd2ee","abstract":"Gender inequalities and social exclusions in community-based forest management have garnered attention, particularly in South Asia. Yet, framings that homogenize women and marginalized groups fail to capture the nuanced processes by which such exclusions occur. Despite provisions for women in local community management institutions, numerous constraints hinder their active participation in forest governance. Understanding participation in JFM requires attention not only to gender, but also to the diversified interests and experiences women hold and the unequal power relations in which they are enmeshed. Based on 85 semi-structured interviews with women and men farmers, JFM committee members, local authorities, NGO staff and Forest Department officials, we explore emic perspectives of how social differentiation shapes participation in JFM. We compare the situation in Karnataka, a wealthier Indian state that is considered exemplary for JFM, with that in Madhya Pradesh, a poorer Indian state inhabited by tribal populations, where JFM is poorly functional. We show that exclusions in Uttara Kannada occur along gender and caste lines, whereas among tribal groups in Mandla, women of certain ethnicities are particularly disadvantaged in JFM despite their extensive forest use. Grouping marginalized groups into homogeneous categories (e.g. as Scheduled Tribes or Scheduled Castes), as do Indian laws addressing tribal issues, deters focus from the inequalities that occur among groups, and from their relevance in shaping local experiences. Place-based environmental and political economic histories further shape local interests and participation in JFM. We argue that a focus on gender is necessary but not sufficient to understand social exclusions in JFM, and that gender must be understood in relation to other factors of social differentiation."}

data/part_1/01638553294ba6316eae5593275c2f48.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01638553294ba6316eae5593275c2f48","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ba931721-904f-4d0d-8149-8a1992ec7703/retrieve"},"pageCount":22,"title":"","keywords":[],"chapters":[{"head":"LIST OF TABLES","index":1,"paragraphs":[]},{"head":"LIST OF FIGURES","index":2,"paragraphs":[{"index":1,"size":21,"text":"Figure 4.1 Method for identifying the best applicable economic analysis tool for prioritization and selection of various strategies (UNDP 2004). ......... "}]},{"head":"LIST OF ACRONYMS","index":3,"paragraphs":[]},{"head":"EXECUTIVE SUMMARY","index":4,"paragraphs":[{"index":1,"size":81,"text":"This report, entitled the DSTs and Modeling Tools, is prepared for, and at the inception phase of the project, \"Fostering evidence-based IWRM in the Stung Pursat Catchment (Tonle Sap Great Lake), Cambodia\" (also known as MK16). The MK16 project aims to improve water management practices in Cambodia through greater cross-sectoral collaboration and use of data and modeling techniques to inform decisions around water governance. The project is carried-out in Stung Pursat, a sub-catchment of the Tonle Sap basin in western Cambodia."},{"index":2,"size":39,"text":"This report presents various decision support tools (DSTs) and modeling techniques for facilitating decision-making around water resource management. The objective here is to assess currently available and relevant DSTs, and to highlight the method of selecting most appropriate tool."},{"index":3,"size":55,"text":"In Cambodia, MRC-supported projects and programmes have provided much support in using various modeling tools and other DSTs, like rainfall-runoff models based on SWAT; reservoir operation and hydrological routing models based on IQQM; hydrodynamic model for the Mekong Delta based upon ISIS; and flood forecasting of Mekong River and its tributaries based on URBS model."},{"index":4,"size":140,"text":"The most common methods used in Cambodia are economic analyses, namely Cost-Benefit Analysis (CBA), Cost Effectiveness Analysis (CEA), Multi-Criteria Analysis (MCA) and expert judgment. CBA calculates and compares costs and benefits, expressed in monetary terms, of different options. CEA is similar to the CBA, and computes the least costly option for meeting a pre-defined objective. Finally the MCA is used when a single-criterion approach, such as CBA falls short, and when the costs of environmental and social components cannot be expressed as dollar values. There are other useful economic analysis tools, like the Adaptation Decision Matrix (ADM) -which uses a decision matrix and MCA techniques to evaluate the relative cost-effectiveness of options for better water management -and the Livelihood Sensitivity Exercise -which is a sensitivity mapping exercise that allows for integration of existing knowledge about water insecurity with livelihood analysis."},{"index":5,"size":58,"text":"When selecting the appropriate DST, the focus should be first on defining the \"problem\", and then on how one or more of the DSTs may help in tacking that problem. A number of considerations exist, for example relevant physical processes, availability and quality of data, ability of the model to generate good results under extrapolated conditions, and gender."},{"index":6,"size":13,"text":"Hatfield Given these overall objectives, the Project will comprise of three components, namely:"}]},{"head":"INTRODUCTION","index":5,"paragraphs":[{"index":1,"size":7,"text":"Component 1: Data Review and Stakeholder Analysis"},{"index":2,"size":38,"text":"This will be done to assess whether existing data sets will enable the project to answer its research questions. Furthermore, data review and stakeholder analysis will reveal data gaps, which will determine the research direction for this project."},{"index":3,"size":9,"text":"Component 2: The Stung Pursat IWRM Multi-Stakeholder Platform (MSP)"},{"index":4,"size":22,"text":"The intent of MSP is to define what actions need to occur in order to resolve identified problems related to water management."}]},{"head":"Component 3: The Research Component","index":6,"paragraphs":[{"index":1,"size":19,"text":"This component will determine water availability, appropriate decision support tools, and approaches for achieving level \"playing field\" in MSP."},{"index":2,"size":38,"text":"In line with Component 3 above, this report presents current knowledge about the available and suitable tools for facilitating decision-making around key water issues in Cambodia. Furthermore, this report also provides criteria for evaluating and selecting these tools."}]},{"head":"DECISION SUPPORT TOOLS (DST)","index":7,"paragraphs":[{"index":1,"size":69,"text":"Decision Support Tools (DSTs) have been developed by various organisations (government agencies, international organizations, NGOs, universities, consultancy companies and think tanks) to facilitate decision making around a number of issues, including water governance and management. There are a range of DSTs, distinguished by their function, quality of services (accuracy and precision), ease of use, time of application (project planning, implementation, monitoring, etc.), data requirements, data generated and other factors."},{"index":2,"size":27,"text":"The main objective of this analysis is to assess currently available and relevant decision support tools (DSTs), and to highlight the method of selecting most appropriate tool."},{"index":3,"size":46,"text":"To develop and maintain Cambodian modeling capacity, the most sustainable way is to have both universities and line agencies involved and working together. Furthermore, introduction and sensitization of national and subnational level planning agencies to DSTs can help in enhancing accountability and transparency in decision-making processes."},{"index":4,"size":61,"text":"When selecting the appropriate DST, the focus should be first on defining the \"problem\", and then on how one or more of the DSTs may help in tacking that problem. Furthermore, it is also useful to assess the complexity of the tool and capacity of its users. Simpler tools may be a strategy to decrease learning curves and improve application times. "}]},{"head":"SELECTING APPROPRIATE DSTS","index":8,"paragraphs":[{"index":1,"size":82,"text":"A step-wise identification and selection approach can be used to pick the most applicable modeling and water management and risk screening DSTs for Pursat MSP. First, all currently available DSTs can be compiled and sorted by type and theme. Second, the list of DSTs can be narrowed by a process of elimination, leaving only those classified as modeling tools and risk screening and decision support tools. A second level of elimination will remove those DSTs considered by expert judgment to be irrelevant."},{"index":2,"size":140,"text":"It should be noted that many of the tools discussed above have direct implications for gender. In its use of the term \"IWRM\", the project recognises that the \"betweenness\" of things are typically where the greatest sources of tension reside in the Stung Pursat catchment's IWRM, and that the relations between male and female water users is of distinct relevance here. Hence, in all of its social (and political) surveys, the MK16 Project will explore ways in which gender affects access to water resources for households. In addition, gender inequality will be highlighted to the MSP as a key constraint in developmental processes within the catchment, and which has direct implications for economy, household well-being, and differential water use. As a cross cutting issue, gender analysis will not be a stand-alone output, but incorporated into all of the project's outputs. "}]},{"head":"Level of integrated and holistic approach","index":9,"paragraphs":[{"index":1,"size":91,"text":"In Project MK16, members of the MSP, with advice and guidance from project partners, will select both water allocation scenarios and the multi-criteria analysis (MCA) -a tool used when a single cost-benefit assessment tool is insufficient. This will allow for participatory weighting of the MCA criteria for the different water allocation options. The environmental, social and economic impacts resulting from the evaluation will be deliberated and discussed within the MSP. Through a repeated process of problem and option framing, stakeholders will be provided with opportunities to re-weigh and assess the evaluation."}]},{"head":"MODELING TOOLS","index":10,"paragraphs":[{"index":1,"size":50,"text":"Application of modeling tools can be divided into two broad categories: (i) integrated environmental and water resources management; and (ii) specific applications for design, planning, impact assessment, or forecasting. Integrated modeling tools are of direct benefit when it comes to developing strategies and options for improved water governance and management."},{"index":2,"size":1,"text":"Hatfield"}]},{"head":"AVAILABLE MATHEMATICAL MODELS WITHIN THE DHRW","index":11,"paragraphs":[{"index":1,"size":134,"text":"The water balance study of the Pursat River basin requires an inventory of computational methods and mathematical models readily available in the DHRW. Over the last decade, much progress has been made in developing such tools at DHRW with the support of the MRC. The MRC WUP-A programme has led to the development of the Decision Support Framework (DSF), consisting of the rainfall-runoff models based on SWAT, the reservoir operation and hydrological routing models based on IQQM (covering water resources including irrigation and hydropower), and the hydro-dynamic model for the Mekong Delta based upon ISIS (1D hydrodynamics, channel sediment processes). In addition, the MRC FMMP programme has led to the modeling of flood forecast of the main Mekong River and its tributaries, based upon the URBS model. Some of these tools are discussed below."},{"index":2,"size":6,"text":"Table 3.1 Assessment of MRC Toolbox."}]},{"head":"MRC Toolbox","index":12,"paragraphs":[]},{"head":"Corresponds to Cambodian needs and concerns","index":13,"paragraphs":[{"index":1,"size":9,"text":"Yes (floods, upstream impacts on flows, hydropower development etc.)"}]},{"head":"Data needs and applicability with limited available data","index":14,"paragraphs":[{"index":1,"size":13,"text":"Has proven to work with available data; utilisation of data gap filling tools"}]},{"head":"Ease of use","index":15,"paragraphs":[{"index":1,"size":16,"text":"Varies depending on the model; need to learn multiple models and interfaces (contrast to integrated models)"}]},{"head":"Balanced learning curve","index":16,"paragraphs":[{"index":1,"size":14,"text":"Yes, compared to nature of each model. Certain technical background and training are needed."}]},{"head":"Level of regional application","index":17,"paragraphs":[{"index":1,"size":7,"text":"High, designed and developed for Mekong conditions"}]},{"head":"Accessibility including software and training costs","index":18,"paragraphs":[{"index":1,"size":31,"text":"Free of charge (except ISISI); training by the MRC. Few modelers trained by MRC are either working in MOWRAM or MPWT. But some of them have moved up or moved out."}]},{"head":"Level of integrated and holistic approach","index":19,"paragraphs":[{"index":1,"size":15,"text":"Average, depends on what tools are utilised. Attention is being paid to improving its integration."}]},{"head":"Quantified, accurate and relevant outputs","index":20,"paragraphs":[{"index":1,"size":13,"text":"Yes; has been verified in large number of applications for some models only."}]},{"head":"Ability to represent natural systems and human impact on them","index":21,"paragraphs":[{"index":1,"size":22,"text":"Yes and no. Limitations for some models (for instance IQQM represents systems schematically, floodplain flows are not accurately represented by 1D models)"},{"index":2,"size":9,"text":"Level of existing applications and applicability in water management."},{"index":3,"size":10,"text":"Some (Mekong flows and flooding; IWRM and 3D not considered)"},{"index":4,"size":39,"text":"SWAT (Soil and Water Assessment Tool) is a rainfall-runoff modeling system developed by the US Environment Protection Agency (EPA). Within each SWAT catchment, refinements can be introduced by defining sub-catchments with their own characteristics derived from GIS data bases."},{"index":5,"size":63,"text":"Our partners in DHRW are also capable of applying URBS (Unified River Basin Simulation) modeling system for describing catchment rainfall-runoff processes that were introduced in 2007 at the MRC RFMMC. URBS combines the rainfall-runoff and runoff-routing components of the modeling process, and allows users to configure the model to match the characteristics of individual catchments with the use of the GIS package, CatchmentSIM."},{"index":6,"size":30,"text":"IQQM (Integrated Quantity-Quality river basin simulation Model) simulates all the processes and rules associated with the simplified description of movement of water through a river system. The major processes include:"},{"index":7,"size":5,"text":"System inflows and flow routing;"},{"index":8,"size":4,"text":"On-and off-river reservoir modeling;"},{"index":9,"size":19,"text":"Harmony rules for reservoir operation (operational management of multiple reservoirs, i.e., what and when to release from which reservoir);"},{"index":10,"size":6,"text":"Crop water demands, orders and diversions;"},{"index":11,"size":5,"text":"Town water and other demands;"},{"index":12,"size":2,"text":"Hydropower modeling;"},{"index":13,"size":5,"text":"Effluent outflow and irrigation channels;"},{"index":14,"size":5,"text":"Wetland demands and storage characteristics;"},{"index":15,"size":11,"text":"Water sharing rules for both regulated and unregulated river systems; and"},{"index":16,"size":10,"text":"Resource assessment and water accounting; and interstate water sharing agreements."},{"index":17,"size":38,"text":"IQQM can be configured for systems, which are operating a single, or multiple reservoirs functioning in series or parallel to one another. The model applies hydrologic flow routing for the simulation of the different ranges of flow conditions."},{"index":18,"size":61,"text":"Simplified EXCEL Spreadsheet for water balance computation has been used by the DHRW staff to deal with water balance computation in the river basin, taking irrigation systems into account. These spreadsheets are very useful in computing Evapotranspiration (ETo), crop water requirement, and for confirming security of river basin water resources and proposing areas for new irrigation development projects, and so on."}]},{"head":"MODEL SELECTION","index":22,"paragraphs":[{"index":1,"size":37,"text":"A large number of specific models for hydrological, hydrodynamic, and water quality assessment are very important. For example, they can be used to plan for required storage capacity, flood protection, road embankment heights, and ecological impact assessment."},{"index":2,"size":63,"text":"However, there are greater learning requirements for more versatile and powerful tools. For the easy-to-use tools, the learning involves understanding natural processes and human interventions, as well as obtaining, processing, analysing and presenting model outputs for decision making, planning and forecasting. The\"modeling tools\" will be assessed based on the following criteria: For the appropriate choice of a model the following aspects are important:"},{"index":3,"size":50,"text":"The physical processes taking place, e.g., flash floods, backwaters, tidal flooding, etc. The nature of the flood processes determines what kind of model can be used. For example, hydrological routing models cannot be used for areas under strong backwater and flow reversal regimes, such as those of the Tonle Sap;"},{"index":4,"size":53,"text":"The availability and quality of data. A well-known saying in relation to mathematical models is: \"garbage in -garbage out\". For example, the outputs of many flood models are constrained by the availability and quality of topographical data. Although, a good analysis of available data may reduce garbage content to a certain extent; and"},{"index":5,"size":97,"text":"Ability of the model to generate results with a good degree of certainty under extrapolated conditions. Some models are unable to do so, even when good sets of data are available to calibrate them. This condition particularly relevant for flood models. Usually, one is interested in a range of events that rarely occur, and for which observations are usually not available. In these cases, a model that has been calibrated for more frequently-occurring events can also be applied for extreme events. As a rule, extrapolations are more reliable when using a model with more sound input data."},{"index":6,"size":16,"text":"The following model types can be distinguished for water balance computation in the Pursat river basin:"},{"index":7,"size":3,"text":"Rainfall-runoff models; and"},{"index":8,"size":11,"text":"Hydrological routing models and/or Simplified EXCEL Spreadsheet for water balance computation."},{"index":9,"size":142,"text":"Rainfall-runoff models can be used to provide discharge information. These models transform statistical information on rainfall data into statistical information on river discharges. If possible, the simulation of series of individual events should be replaced by the simulation of long time series. This has been done, for example, in the development of the Decision Support Framework (DSF) for the Lower Mekong Basin. In this project, Halcrow processed rainfall Hatfield data for the period 1985 -2000 to calibrate the SWAT rainfall-runoff models under the DSF. A better alternative could be to use newly developed URBS models, which have been calibrated under the FMMP-C1, particularly for flood conditions. In principle, these URBS models would show better calibrations than the SWAT models, a hypothesis which would have to be checked upon the selection of the appropriate set of models to be used for the study."},{"index":10,"size":55,"text":"Hydrological routing models are used to identify impacts of water resources development, such as irrigation systems and hydropower dams on the flow regime and water balance of the river basin. However, for better understanding of the technical staff on steps and procedures for computing water balance, the Simplified EXCEL Spreadsheet could be the alternative choice."}]},{"head":"ECONOMIC ANALAYSIS TOOLS","index":23,"paragraphs":[{"index":1,"size":88,"text":"Increased efforts to improve water management require that robust and transparent assessment approaches exist to enable decision makers to efficiently allocate scarce financial, technological and human resources. Economic analysis tools provide monetary indications of economic, environmental and social costs and benefits of responses, thereby informing the decision-process (UNDP 2004;MRC 2010). When undertaking such assessments, planners have to first determine the core objectives and targets of their project. For example, objectives can be equitable allocation of water and related resources, or management of water flows, flooding, or other risks."},{"index":2,"size":31,"text":"When assessing costs and benefits of water management strategies, there are three approaches that have been widely used and proven to be effective as DSTs in broader development and planning contexts:"},{"index":3,"size":3,"text":"Cost-Benefit Analysis (CBA);"},{"index":4,"size":4,"text":"Cost-Effectiveness Analysis (CEA); and"},{"index":5,"size":3,"text":"Multi-Criteria Analysis (MCA)."},{"index":6,"size":97,"text":"These methods of prioritization can be most easily applied at the project-level (sectoral or multi-sectoral). For larger cross-sectoral strategies that involve \"soft interventions\" such as institutional and legislative reform, it is more difficult to assess costs and quantify benefits, thereby requiring more informal or qualitative ways to determine attractiveness. UNDP (2004) presents a framework to determine the best economic analysis DSTs to use in the selection and prioritization of measures for better water management. Given the great importance in accuracy of results, this chart may be most applicable at later stages of the decision process (UNDP 2004)."},{"index":7,"size":25,"text":"Each of these approaches is explained in the sections that follow, in terms of their applicability, use, technical requirements and suitability in the Cambodian context."}]},{"head":"COST-BENEFIT ANALYSIS & COST EFFECTIVENESS ANALYSIS Figure Method for identifying the best applicable economic analysis tool for prioritization and selection of various strategies (UNDP 2004).","index":24,"paragraphs":[{"index":1,"size":126,"text":"Cost Benefit Analysis (CBA) uses a conceptual framework to assess various strategies for water management by calculating and comparing costs and benefits, expressed in monetary terms. CBA involves making explicit assumptions that can lead to the derivation of reliable estimates of things that are assigned monetary values in the markets (e.g., costs and benefits of environmental goods and services, cultural aspects, social values, etc.). This entails the possibility of non-market costs and benefits being excluded from the analysis, and results being skewed or misleading (UNFCCC 2011). A comprehensive CBA of water management measures has not been conducted to date in Pursat, Cambodia. This can be attributed to a number of reasons, including absence of necessary human, technical and financial resources to commission such studies (MOE/HCP 2012)."},{"index":2,"size":55,"text":"Expert teams conducting CBA must be knowledgeable and skilled in economics and valuation techniques and bio-physical, engineering, social and institutional aspects relevant to the estimation of costs and benefits. Technical training will be required on estimating monetary values to costs and benefits, and to address uncertainties, methodological issues, and potential biases (UNEP and IVM 1998)."},{"index":3,"size":62,"text":"Cost Effectiveness Analysis (CEA) is a variation of a CBA, which is used to find the least costly option for meeting a pre-defined objective. This method is attractive especially when it is difficult to quantify and monetize benefits. In this method, various strategies are compared based on their cost differences to achieve a given fixed level of effectiveness (UNEP and IVM 1998)."},{"index":4,"size":95,"text":"In a data-and resource-constrained context such as Cambodia, CEA may prove to be a more effective tool to help identify project options at the lowest possible cost. Although CEA is relatively easier and less resource-intensive to undertake, it is often not used as a stand-alone DST, but in combination with other tools, Hatfield due to the fact that benefits are only defined in a single, common metric against which to assess cost-effectiveness. Assessment of other important dimensions, such as gender equity, feasibility, co-benefits, and awareness-raising may be undertaken in parallel to a CEA (UNFCCC 2011)."}]},{"head":"MULTI-CRITERIA ANALYSIS","index":25,"paragraphs":[{"index":1,"size":56,"text":"Multi-Criteria Analysis (MCA) is a DST that is applicable in cases where a single-criterion approach such as CBA falls short, particularly where environmental and social component costs cannot be expressed in monetary terms. As such, MCA allows for comparing and ranking options based on a full range of criteria (e.g., environmental, social, technical, economic, financial, etc)."}]},{"head":"Table 4.1 Assessment of Multi-Criteria Analysis (MCA).","index":26,"paragraphs":[]},{"head":"Corresponds to Cambodian needs and concerns","index":27,"paragraphs":[{"index":1,"size":28,"text":"Assess multiple objective -Cambodian planners may want to use a range of criteria (environmental, social, technical, financial etc. in addition to economic criteria) to assess and rank options."}]},{"head":"Required input data exists and is accessible for Cambodia","index":28,"paragraphs":[{"index":1,"size":29,"text":"Relies on the judgment of the decision-making team to establish a set of objectives and assign relative weights to selected criteria -Accommodates consideration of both qualitative and quantitative information."},{"index":2,"size":31,"text":"Ease of use Depends on reliability of information used and the selection of criteria, relative weights and scores, and the degree to which an agreement is reached by the MCA team."},{"index":3,"size":12,"text":"Various sensitivity analysis techniques exist to test for the robustness (UNFCCC 2011)."}]},{"head":"Short learning curve","index":29,"paragraphs":[{"index":1,"size":24,"text":"Short learning curve -Relatively simple tool to use. Time, cost and training required depend on the specific methodology used. Generally training required is minimal."}]},{"head":"Level of regional and global application","index":30,"paragraphs":[{"index":1,"size":14,"text":"Highly applicable. Framework to integrate different decision criteria in a quantitative analysis for NAPA."},{"index":2,"size":21,"text":"Can also be combined with other assessment approaches such as CBA and CEA to provide a foundation for more informed decision-making"}]},{"head":"Accessibility including software and training costs","index":31,"paragraphs":[{"index":1,"size":4,"text":"Highly accessible (UNFCCC 2011)."}]},{"head":"Level of integrated and holistic approach","index":32,"paragraphs":[{"index":1,"size":21,"text":"Produces economic estimates relatively quickly, yet with an adequate level of precision for decision making (no benefit is quantified or compared)"}]},{"head":"Promotes stakeholder participation","index":33,"paragraphs":[{"index":1,"size":24,"text":"Benefits from representative stakeholder engagement, and allows beneficiaries of strategies to part-take in the selection of those strategies, creating a greater sense of ownership."},{"index":2,"size":32,"text":"The key output is the identification of the single most preferred option, a set of ranked options, short-listing of options for further assessment, or characterization of acceptable and unacceptable options (UNFCCC 2012)."},{"index":3,"size":77,"text":"There are different variations of the MCA approach available. Some existing approaches include: the performance matrix approach; multi-attribute utility theory approach; linear additive models; analytical hierarchy process; outranking methods; and procedures that use qualitative data inputs (see DCLG 2009 for more details). All MCA approaches are generally similar in that they identify different options, assign relative weights to different criteria, and require judgment in weighting and scoring. They only differ in how they combine data (DCLG 2009)."},{"index":4,"size":172,"text":"As previously stated, a key feature of MCA is that it relies on the judgment of the decision-making team to establish a set of objectives and assign relative weights to selected criteria, and therefore, judge the contribution of each criterion to the overall performance of the strategy (MOE/HCP 2012). Using this weighting approach, an overall score for each option is generated, and the Hatfield option with the highest score can be selected. The subjectivity that pervades assigning weights is generally a matter of concern in this approach. Therefore, the robustness of MCA approach depends not only on reliability of information used in the analysis, but also by the selection (inclusion of exclusion) of criteria, relative weights and scores given to selected criteria, and the degree to which an agreement is reached by the MCA team regarding weighting and scoring. Given the difficulties in reaching an agreement among stakeholders regarding criteria and their relative importance, various sensitivity analysis techniques exist to test for the robustness of MCA results to withstand scrutiny (UNFCCC 2011)."},{"index":5,"size":71,"text":"Another limitation in MCA is that it cannot indicate whether or not an option generates greater benefits than costs; and unlike CBA, there is no explicit condition that benefits should exceed costs. Therefore, similar to CEA, in MCA, the selected option may fail to improve welfare. However, MCA can also be combined with other assessment approaches such as CBA and CEA to provide a foundation for more informed decision-making (MOE/HCP 2013)."},{"index":6,"size":85,"text":"Nevertheless, MCA defines a framework to integrate different decision criteria in a quantitative analysis without assigning monetary values to all factors, thereby bringing a structure and transparency to decision-making (DCLG 2009). It accommodates consideration of both qualitative and quantitative information, and helps in the identification of strengths and weakness of each criterion (UNFCCC 2011). Furthermore, this approach benefits from representative stakeholder engagement, and allows beneficiaries of water management options to part-take in the selection of those options, creating a greater sense of ownership (UNFCCC 2011)."},{"index":7,"size":41,"text":"This approach also proves useful for Cambodia, where quantitative data are limited or unreliable, and where consideration of other criteria beyond economic efficiency and cost-effectiveness is crucial, for instance where social and ecological sustainability concerns need to be addressed (MOE/HCP 2012)."},{"index":8,"size":86,"text":"MCA is a relatively simple tool to grasp and use; however, the time, cost, and training required depends on the specific methodology used. Generally training required for MCA is minimal. All available MCA techniques rely on expert judgment to a certain extent. Input data for an MCA exercise depends on the criteria chosen for evaluation, and the indicators and metrics relevant for these criteria. The experience gained in applying this methodology for selection of various strategies will help in future application of this methodology in Cambodia."}]},{"head":"ADAPTATION DECISION MATRIX","index":34,"paragraphs":[{"index":1,"size":90,"text":"The Adaptation Decision Matrix (ADM) approach presents another option. This approach uses a decision matrix and MCA techniques to evaluate the relative cost-effectiveness of options for adaptation to climate change. Since adaptation can entail improving water use, distribution and allocation, ADM can find applicability in supporting water management. Cost measures are expressed as dollar figures, whereas benefits can be measured in a common metric, similar to MCA and CEA (UNEP and IVM 2009). This approach is also useful when important criteria for decision-making cannot be easily expressed in monetary terms."}]},{"head":"Hatfield","index":35,"paragraphs":[{"index":1,"size":25,"text":"Using this approach, the team generally defines criteria that will be used to evaluate adaptation options, and weight the criteria. Scenarios can also be used."},{"index":2,"size":67,"text":"Scoring is carried out to assess how well each selected criterion performs under a particular scenario for each decision option. Scoring can be based on either detailed analysis or expert judgment. Similar to MCA, scores are multiplied by weights and aggregated to determine which options best meet the selected criteria. The aggregated scores of all adaptation options are then compared to assess the relative cost-effectiveness of options. "}]},{"head":"Corresponds to Cambodian needs and concerns","index":36,"paragraphs":[{"index":1,"size":29,"text":"Yes. This approach is useful under the Cambodian context, where quantified/monetized data is not readily available, and consideration of multiple criteria (environmental, social, technical etc.) is important for decision-making."}]},{"head":"Required input data exists and is accessible for Cambodia","index":37,"paragraphs":[{"index":1,"size":41,"text":"Required data depends on adaptation objectives, criteria used, and the level of detail in research and analysis conducted. Detailed research and analysis may be required to provide a basis for evaluation of options against each criterion to reduce subjectivity in scoring."},{"index":2,"size":99,"text":"Ease of use Similar to MCA, this is a relatively easy tool to learn and use. A certain level of expertise is required for developing qualitative and quantitative estimates of how adaptation measures compare with regard to selected criteria, and estimating the cost of each adaptation measure. Comparing the cost-effectiveness of options requires that benefits are expressed in a common metric across all criteria. Developing cost-benefit estimates will require familiarity with results of existing impact assessments, potential changes in socio-economic conditions, current planning/investment plans, as well as relative cost-benefits of measures, implementation barriers, and other adaptation or mitigation policies."}]},{"head":"Short learning curve","index":38,"paragraphs":[{"index":1,"size":33,"text":"A user with an understanding of key policy objectives could learn this methodology within 1 to 2 days; however, additional training may be required to develop skills in estimating costs of adaptation measures."}]},{"head":"Level of regional application","index":39,"paragraphs":[{"index":1,"size":27,"text":"This tool has been applied in some countries in Asia (e.g., Pakistan, Kazakhstan), and remains a promising approach for developing countries, including least-developed countries such as Cambodia."}]},{"head":"Level of global application","index":40,"paragraphs":[{"index":1,"size":27,"text":"This methodology has been widely used by participants in the U.S. Country Studies and UNEP assistance programs (e.g., Kazakhstan, Cameroon, Uruguay, Bolivia, Antigua, Estonia, Pakistan and Barbuda)."}]},{"head":"Accessibility including training cost","index":41,"paragraphs":[{"index":1,"size":29,"text":"There is no cost for obtaining documentation or diskette with template of the decision matrix. Additional training may be required to develop skill in estimating costs of adaptation measures."}]},{"head":"Promotes stakeholder participation","index":42,"paragraphs":[{"index":1,"size":28,"text":"This approach mainly relies on expert judgment, but provides scope for and benefits from the involvements of key stakeholders to define criteria and assign weights and relative scores."}]},{"head":"Level of integrated and holistic approach","index":43,"paragraphs":[{"index":1,"size":18,"text":"ADM allows for consideration of criteria other than simply economic and financial criteria, including social and environmental criteria."},{"index":2,"size":7,"text":"Source: UNEP and IVM 1998; UNFCCC 2012"}]},{"head":"LIVELIHOOD SENSTIVITY EXERCISE","index":44,"paragraphs":[{"index":1,"size":50,"text":"Livelihood sensitivity exercise is a sensitivity mapping exercise which allows for integration of existing knowledge about water insecurity with livelihood analysis (Garg et al. 2007;UNFCCC 2012). The exercise can be initially scoped through a rapid workshop breakout group, and eventually formalized using expert analysis, impact assessment models and historical observations."},{"index":2,"size":91,"text":"The tool by nature promotes stakeholder participation, particularly at the scoping stage. The output of this exercise is a matrix with three blocks of rowsincluding ecosystem services (e.g., soil moisture), livelihood activities (e.g., crop production), and livelihoods themselves. Various development stresses (e.g., floods, droughts, windstorms, etc.) are considered in columns. Users fill out the Hatfield matrix cells, rating the sensitivity of ecosystem services, livelihood activities, and livelihoods to a range of climatic hazards and stresses. Exposure across hazards and impacts across services, activities and livelihoods can be calculated as aggregate indices."},{"index":3,"size":42,"text":"The tool can be more effective if it is accompanied by an estimation of the extent and level of sensitivity and impacts, particularly if it involves, for example, surveys that estimate the number of households sensitive to hazards (Garg et al. 2007)."}]},{"head":"Table 4.3","index":45,"paragraphs":[{"index":1,"size":3,"text":"Livelihood sensitivity exercise."}]},{"head":"Corresponds to Cambodian needs and concerns","index":46,"paragraphs":[{"index":1,"size":22,"text":"Can be a useful tool for Cambodia to identify vulnerable livelihoods, and targeting strategies resiliency of particular livelihood strategies to climate change."},{"index":2,"size":16,"text":"Can be applied at the local/commune level, and for a single sector at any one time."},{"index":3,"size":14,"text":"The output is a ranking of vulnerable livelihoods and an overall livelihood sensitivity index."}]},{"head":"Required input data exists and accessible for Cambodia","index":47,"paragraphs":[{"index":1,"size":37,"text":"Much of input data on climate hazards, exposure, impacts, and livelihoods are available in Cambodia. However, climate change exposure-related data (both current data and future predictions) at the provincial, district, or communal levels are much more limited."},{"index":2,"size":15,"text":"Ease of use This index-based methodology for livelihood sensitivity exercise is relatively simple to use."}]},{"head":"Short learning curve","index":48,"paragraphs":[{"index":1,"size":47,"text":"While rapid workshop breakout groups can define the scope of the analysis, later stages require familiarity with rural livelihoods, expert knowledge elicitation, impact assessments and climate projections, vulnerability indicators etc. Level of regional application NAPA teams used it to identify and scope livelihood impacts of climate change."}]},{"head":"Level of global application","index":49,"paragraphs":[{"index":1,"size":8,"text":"Used in regional training workshops for the NAPA"}]},{"head":"Accessibility including cost","index":50,"paragraphs":[{"index":1,"size":24,"text":"Free to obtain guidance notes and training documents for this exercise (NAPA workshops presentations and sample spreadsheets can be accessed at http://www.unitar.org/ccp/ and http://www.vulnerabilitynet.org.."}]},{"head":"Promotes stakeholder participation","index":51,"paragraphs":[{"index":1,"size":21,"text":"Stakeholders are involved at the initial stage of this exercise to identify sensitivities, but results are later finalized through expert analysis."}]},{"head":"Level of integrated and holistic approach","index":52,"paragraphs":[{"index":1,"size":26,"text":"Can include a range of stakeholders, and combines participatory knowledge with scientific knowledge of impacts models, historical trends etc.. Source: UNFCCC 2012; Garg et al. 2007."}]},{"head":"CONCLUSION","index":53,"paragraphs":[{"index":1,"size":54,"text":"As decided during the 1 st Technical Focus Group Meeting on 22 February, 2013, the following modeling tools and DSTs have been selected for the MK16: the Unified River Basin Simulation (URBS), Simplified EXCEL Spreadsheet or IQQM (with map interface), ISIS -1D Hydrodynamic Model, the Water Evaluation and Planning (WEAP) and Multi-Criteria Analysis (MCA)."},{"index":2,"size":27,"text":"In April-June, 2013, the Project Team will meet to check, calibrate and validate the selected tools and to discuss the priority, needs, interface and synergy among them."},{"index":3,"size":32,"text":"The tools and their results will then be discussed at the 2 nd Technical Focus Group (scheduled for late April), and the 2 nd MSP Meeting (scheduled for late August/early September, 2013)."},{"index":4,"size":1,"text":"Hatfield"}]},{"head":"CLOSURE","index":54,"paragraphs":[{"index":1,"size":24,"text":"This is a work in progress. We trust the above information meets your requirements. If you have any questions or comments, please contact us."}]}],"figures":[{"text":"  "},{"text":"Table 2 . 1 Key Questions in Determining Optimal Strategies For Water Management. .......................................................................................... Table 2.2 Criteria used for Water Management and Risk Screening DSTs. ........... Table 3.1 Assessment of MRC Toolbox. ................................................................. Table 3.2 Criteria Used for Evaluating Modeling Tools. .......................................... Table 4.1 Assessment of Multi-Criteria Analysis (MCA). ........................................ Table 4.2 Assessment of Adaptation Decision Matrix (ADM) approach. .............. Table 4.3 Livelihood sensitivity exercise. ..............................................................  "},{"text":" \"Fostering evidence-based IWRM in the Stung Pursat Catchment (Tonle Sap Great Lake), Cambodia project\" (also known as MK16) is funded by the CGIAR Challenge Program on Water and Food (CPWF) 1 , with a grant from AusAID. It is collaboratively implemented by the Ministry of Water Resources and Meteorology (MOWRAM), Tonle Sap Authority (TSA), Supreme National Meteorology (MOWRAM), Tonle Sap Authority (TSA), Supreme National Economic Council (SNEC), Hatfield Consultants Partnership (HCP), and Culture Economic Council (SNEC), Hatfield Consultants Partnership (HCP), and Culture and Environment Preservation Association (CEPA). and Environment Preservation Association (CEPA). MK16 is implemented in a single sub-catchment of Tonle Sap basin in western MK16 is implemented in a single sub-catchment of Tonle Sap basin in western Cambodia, the Stung Pursat. This project seeks to address and/or improve three Cambodia, the Stung Pursat. This project seeks to address and/or improve three underpinning aspects of water management: (a) cross-sectoral collaboration in underpinning aspects of water management: (a) cross-sectoral collaboration in the management of water resources; (b) use of data or scientific analyses to the management of water resources; (b) use of data or scientific analyses to inform water management in Cambodia; and (c) institutional mechanism for inform water management in Cambodia; and (c) institutional mechanism for inter-sectoral management, or interpretation and use of existing or new scientific inter-sectoral management, or interpretation and use of existing or new scientific data. data.  "},{"text":"Table 2 .1 Key Questions in Determining Optimal Strategies For Water Management.  NO KEY QUESTIONS NOKEY QUESTIONS 1 Why is this resource important? How is it used? Who are the stakeholders to whom it is valuable? 1Why is this resource important? How is it used? Who are the stakeholders to whom it is valuable? 2 What are the key environmental and social variables that influence this resource? 2What are the key environmental and social variables that influence this resource? 3 What is the sensitivity of this resource to changes in key variables, such as climate variations and 3What is the sensitivity of this resource to changes in key variables, such as climate variations and  change on short (e.g., days); medium (e.g., seasons) and long (e.g., multi-decadal) time scales? change on short (e.g., days); medium (e.g., seasons) and long (e.g., multi-decadal) time scales? 4 What changes (thresholds) in these key variables would have to occur to result in a negative (or 4What changes (thresholds) in these key variables would have to occur to result in a negative (or  positive) response to this resource? positive) response to this resource? 5 What are the best estimates of the probabilities for these changes to occur? What tools are available 5What are the best estimates of the probabilities for these changes to occur? What tools are available  to quantify the effect of these changes? Can these changes and effects be accurately predicted? to quantify the effect of these changes? Can these changes and effects be accurately predicted? 6 What actions can be undertaken in order to minimize or eliminate the negative consequences of 6What actions can be undertaken in order to minimize or eliminate the negative consequences of  these changes (or to optimize a positive response)? these changes (or to optimize a positive response)? 7 What specific recommendations for policymakers and other stakeholders can be made? 7What specific recommendations for policymakers and other stakeholders can be made? 2.1 EXPERIENCE WITH DSTS IN CAMBODIA 2.1EXPERIENCE WITH DSTS IN CAMBODIA  Within Cambodia, experience with DSTs has been gathered mainly through Within Cambodia, experience with DSTs has been gathered mainly through  programmes and projects supported by the Mekong River Commission (MRC). programmes and projects supported by the Mekong River Commission (MRC).  A range of modeling tools and DSTs with different strengths and limitations are A range of modeling tools and DSTs with different strengths and limitations are  considered in this report. The most common methods are Cost-Benefit Analysis considered in this report. The most common methods are Cost-Benefit Analysis  (CBA), Cost Effectiveness Analysis (CEA), Multi-Criteria Analysis (MCA) and (CBA), Cost Effectiveness Analysis (CEA), Multi-Criteria Analysis (MCA) and  expert judgment. These methods are most easily applied at the project level. expert judgment. These methods are most easily applied at the project level.  Measures such as institutional and legislative reform require more informal or Measures such as institutional and legislative reform require more informal or  qualitative ways to evaluate attractiveness. qualitative ways to evaluate attractiveness.  "},{"text":"Table 2 .2 Criteria used for Water Management and Risk Screening DSTs. 1. Corresponds to Cambodian needs and concerns 2. Required input data exists and is accessible for Cambodia 3. Ease of use 4. Short learning curve 5. Level of regional application 6. Level of global application 7. Accessibility of tool including training cost 8. Promotes stakeholder participation   "},{"text":"Table 3 .2 Criteria Used for Evaluating Modeling Tools. 1. Corresponds to Cambodian needs and concerns 2. Data needs and applicability with limited available data 3. Ease of use 4. Balanced learning curve 5. Level of regional application 6. Accessibility including software and training costs 7. Level of integrated and holistic approach 8. Quantified, accurate and relevant outputs 9. Ability to represent natural systems and human impact on them 10. Level of existing applications and applicability in water management   "},{"text":"Table 4 .2 Assessment of Adaptation Decision Matrix (ADM) approach.   "}],"sieverID":"8451f6f5-4e5e-4def-a5b8-b289c5fd6ac7","abstract":"Mr. Lay Sokkheang, Senior Researcher, SNEC; and all technical staff from MOWRAM, TSA, and CEPA.Our sincerest thanks go to all our key stakeholders and members of the Pursat Multi-Stakeholder Platform (MSP) from relevant Government Agencies, academics and research organizations, local authorities, community-based organizations, and other individuals for their active contribution to the project."}

data/part_1/0196b980304764cacd2bdee27150947a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0196b980304764cacd2bdee27150947a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dc0121f4-9649-45de-bde8-e231c7abe895/retrieve"},"pageCount":27,"title":"Tools for understanding the agricultural production systems and their socio-economic context in target regions for the introduction of new banana cultivars Baseline intra-household survey Developed for the project \"Improvement of banana for smallholder farmers in the Great Lakes region of Africa\"","keywords":[],"chapters":[{"head":"BACKGROUND","index":1,"paragraphs":[{"index":1,"size":69,"text":"Within the framework of the IITA-led project \"Improvement of banana for smallholder farmers in the Great Lakes region of Africa\" (also known as the \"Breeding Better Bananas\" project, http://breedingbetterbananas.org), Bioversity International and partners conducted baseline research in the target regions of Luweero and Mbarara in Uganda, and Bukoba, Meru, Moshi and Rungwe in Tanzania during 2015-2016, prior to conducting on-station and on-farm evaluations of new NARITA banana cultivars (http://www.promusa.org/NARITA+hybrids)."},{"index":2,"size":48,"text":"Five tools were used to characterise the banana and agricultural production systems, and the socioeconomic context of these systems, in the target regions. The research used a mixed-methods, participatory and sex-disaggregated approach to ensure that the knowledge, experiences and opinions of as many people as possible were obtained."},{"index":3,"size":107,"text":"The understanding gained from the baseline research will:  be fed into the banana breeding pipeline at multiple entry points to assist with breeding banana cultivars that better meet the requirements of the users. Some of these entry points are: setting of breeding targets; selection of parent material; evaluation in regional on-station and on-farm trials; participatory varietal selection taking into account the criteria (or 'trait preferences') that are important to multiple and different users; facilitating access to and adoption of the new cultivars by farmers and other end-users through scaling up the supply of clean planting materials and ensuring equitable distribution of these through the 'seed' systems;"},{"index":4,"size":22,"text":" inform the ongoing adaptive management of the project activities to ensure fair participation and decision-making by people in the affected communities;"},{"index":5,"size":28,"text":" provide the baseline to evaluate, in conjunction with the endline, the impact of adoption of the new cultivars on households, and individuals within, in the target regions."},{"index":6,"size":14,"text":"The five tools developed and/or adapted from existing tools for the baseline research were: "}]},{"head":"The 2009 Uganda Progress out of Poverty Index®","index":2,"paragraphs":[]},{"head":"Material reproduced from www.progressoutofpoverty.org/country/uganda with the permission of Innovations for Poverty Action (IPA)","index":3,"paragraphs":[{"index":1,"size":10,"text":"To be used when in Uganda. Circle the appropriate response."}]},{"head":"D1_UG. How many members does the household have?","index":4,"paragraphs":[{"index":1,"size":1,"text":"A "}]},{"head":"Read to the respondent(s) before they separate and answer the remaining questions from their own perspective:","index":5,"paragraphs":[{"index":1,"size":79,"text":"\"Now we would like to interview the man and the women separately-you will both be asked exactly the same questions but because we understand that different people in the household farm different plots and crops and have different knowledge and experiences, we would like to interview the men and women separately. This will also help us to save time!\" G3. Which respondent are you now interviewing? (Should be the same respondent that you asked for consent to be interviewed)"},{"index":2,"size":1,"text":"   "}]}],"figures":[{"text":"F1 , private, NGO/religious, or boarding)? A = not all attend school B = all attend government schools C = no children ages 6 to 18 D = all attend, and one or more attend a private, NGO/religious, or boarding school is the major construction material of the roof?A = thatch, straw, or other B = iron sheets, or tilesD5_UG. What is the major construction material of the external wall? A = un-burnt bricks, mud and poles, thatch/straw, timber, stone, burnt bricks with mud, other B = burnt bricks with cement, or cement blocks D6_UG. What is the main source of lighting in your dwelling? A = firewood B = tadooba, or other C = paraffin lantern, or electricity (grid, generator, solar) D7_UG. What is the type of toilet that is mainly used in your household? A = bush (none) B = covered pit latrine (private or shared), VIP latrine (private or shared), uncovered pit latrine, flush toilet (private or shared), or other D8_UG. Does any member of your household own electronic equipment (e.g., TV, radio, cassette, etc.every member of the household have at least one pair of shoes? (Shoes in good condition only. Slippers, 'tire' shoes [lugabire], and gumboots are not considered as shoes.) A = no B = yes The 2007 Tanzania Progress out of Poverty Index® Material reproduced from www.progressoutofpoverty.org/country/tanzania with the permission of Innovations for Poverty Action (IPA) To be used when in Tanzania. Circle the appropriate response. all children ages 6 to 17 attend school? A = no B = yes, or no children ages 6 to 17 D3_TZ. Can the female head/spouse read and write? A = no B = yes, but not in Kiswahili nor English C = no female head/spouse D = yes, only in Kiswahili E = yes, in English (regardless of others) D4_TZ. What is the main building material of the floor of the main dwelling? A = earth B = concrete, cement, tiles, timber, or other D5_TZ. What is the main building material of the roof of the main dwelling? A = mud and grass B = grass, leaves, bamboo C = concrete, cement, metal sheets (GCI), asbestos sheets, tiles, or other D6_TZ. How many bicycles, mopeds, motorcycles, tractors, or motor vehicles does your household own? or more SECTION E: HOUSEHOLD SOURCES OF INCOME Include in complete version only, respondents answer together if two are present E1. Select all the sources of household income (cash and in-kind) in the past 12 months. (See code #6, select all that apply) E2. Rank all the sources of household income. (From the first most important to the least important) would you rate the importance of banana to the household income? (Emphasize that this section is asking about the income of the whole household, not only of the respondent)  very important  somewhat important  neither important nor unimportant  somewhat unimportant  very unimportant E4. What percentage of the household income is made from bananas? (Emphasize that this section is asking about the income of the whole household, not only of the respondent) ______________________________________________________________ SECTION F: HOUSEHOLD LIVESTOCK Include in complete version only, respondents answer together if two are present complete & short versions, respondents answer together if two are present G1. How many plots of land does the household own, rent and/or has access to and farms? ____________________________ "},{"text":" SECTION L: IMPORTANCE OF THE DIFFERENT CROPS TO FOOD AND INCOME SECURITYInclude in both complete & short versions, respondents answer separately if two are presentImportance of crops for household food consumption: L1. Across the year, which crops are the most important for your household food consumption? (See code #15, select all that apply) L2. Rank the crops that are most important for your household food consumption. (From the first most important to the least important) the year, which crops are the most important for your household income? (See code #15, select all that apply) L4. Rank the crops that are most important for your household income. (From the first most important to the least important "},{"text":"1. Baseline intra-household survey English   "},{"text":"2. Trait preferences for banana products and varieties focus group discussion  SECTION B: SECTION B: English version; Kiswahili version English version; Kiswahili version 3. Seasonal calendar focus group discussion 3. Seasonal calendar focus group discussion English version; Kiswahili version English version; Kiswahili version 4. Weekly and daily calendar focus group discussion 4. Weekly and daily calendar focus group discussion English version; Kiswahili version English version; Kiswahili version 5. Community wealth ranking focus group discussion 5. Community wealth ranking focus group discussion English version; Kiswahili version English version; Kiswahili version  "},{"text":"RESPONDENT(S) REGISTER Include in both complete & short versions, respondents answer together if two are present B1. Household unique ID (This is one of the codes that have been supplied to you at the beginning of the day, e.g. 001, 002, 003, 004. Make sure you use each code only once for one household.) ____________________________________________________  "},{"text":"Take a GPS reading of the location of the household   "},{"text":"How can we find you again if we wish to follow up on any aspects of this survey-your address, or contact details, or way of  reaching you? __________________________________________________________________________________________ reaching you? __________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ B5. Name of male respondent _______________________________________________________________________________ B5. Name of male respondent _______________________________________________________________________________ B6. Age of B7. Marital B8. B9. Main B10. Level of B11. Can male B12. How B6. Age ofB7. MaritalB8.B9. MainB10. Level ofB11. Can maleB12. How male status of male Relationship of occupation of education of respondent many years malestatus of maleRelationship ofoccupation ofeducation ofrespondentmany years respondent? respondent? male male male read or write? has male respondent?respondent?malemalemaleread or write?has male (Years) (See code #1) respondent to respondent? respondent? (See code #5, respondent (Years)(See code #1)respondent torespondent?respondent?(See code #5,respondent   head of (See code #3) (See code #4) select all that lived in the head of(See code #3)(See code #4)select all thatlived in the   household?   apply) village? household?apply)village?   (See code #2)     (See code #2) B13. Name of female respondent ____________________________________________________________________________ B13. Name of female respondent ____________________________________________________________________________ B14. Age of B15. Marital B16. B17. Main B18. Level of B19. Can of B20 B14. Age ofB15. MaritalB16.B17. MainB18. Level ofB19. Can ofB20 female status of Relationship of occupation of education of female  femalestatus ofRelationship ofoccupation ofeducation offemale respondent? female female female female respondent  respondent?femalefemalefemalefemalerespondent (Years) respondent? respondent to respondent? respondent? read or write?  (Years)respondent?respondent torespondent?respondent?read or write?  (See code #1) head of (See code #3) (See code #4) (See code #5,  (See code #1)head of(See code #3)(See code #4)(See code #5,   household?   select all that  household?select all that   (See code #2)   apply)  (See code #2)apply)  "},{"text":". How many years has female respondent lived in the village? SECTION C: HOUSEHOLD REGISTER Include in complete version only, respondents answer together if two are present Read to the respondent(s): \"The household roster should include all people that \"live together and eat out of the same pot\". Include the following people: someone temporarily gone for less than six months, students studying away from home, workers who have stayed in the house for at least six months, and someone that lives away from home but is VERY involved in household management decisions. Family members that live somewhere else and only come to visit and bring or send money are not household members.\"  "},{"text":"C1. Including the respondent(s), how many people currently reside in the household? _________________________________ C2. Not including the respondent(s), how many people currently reside in the household? ______________________________ Ask the following questions about each member of the household but do not include the respondents as they have already provided their details! List the household members in order of the children of the female respondent, the next wife and her children, other adult family members and their children, and finally other children without parents in the household. C3. Sex of household member   C4. Age of C5. Marital C6. Relationship C7. Level of C8. Can C4. Age ofC5. MaritalC6. RelationshipC7. Level ofC8. Can  household status of of household education of household householdstatus ofof householdeducation ofhousehold ? member? (Years) household member to head household member read or ?member? (Years)householdmember to headhouseholdmember read or (M for male, F for  member? of household? member? write? (M for male, F formember?of household?member?write? female)  (See code #1) (See code #2) (See code #4) (See code #5, female)(See code #1)(See code #2)(See code #4)(See code #5,      select all that select all that      apply) apply) 1      1 2      2 3      3 4      4 5      5 6      6 7      7 8      8 9      9 11      11 12      12 Breeding      Breeding  "},{"text":"Better Bananas, Intra-household survey, 2015 SECTION D: PROGRESS OUT OF POVERTY INDEX (PPI) INDICATORS Include in complete version only, respondents answer together if two are present   "},{"text":"2015 SECTION H: BANANA VARIETIES GROWN Include in both complete & short versions, respondents answer separately if two are present Ask the following questions for each banana variety grown by the household.  H1. Banana variety H2. Type H3. Local H4. Is this H5. What H6. How H7. What do you like best about H8. What do you like least about H1. Banana varietyH2. TypeH3. LocalH4. Is thisH5. WhatH6. HowH7. What do you like best aboutH8. What do you like least about name of or variety for products are happy are this variety? this variety? nameoforvariety forproducts arehappy arethis variety?this variety?  banana? introduced home made with this you with   banana?introducedhomemade with thisyou with  (See code ? (See consumption, variety? (See this   (See code? (Seeconsumption,variety? (Seethis  #8) codes #9) for sale? (See code #11, variety?   #8)codes #9)for sale? (Seecode #11,variety? H1. Banana variety name H2. Type of H3. Local or H4. Is this variety for code #10, select all that apply) H5. What products are select all that apply) H6. How happy are (See code #12) H7. What do you like best about this variety? H8. What do you like least about this variety? H1. Banana variety nameH2. Type ofH3. Local orH4. Is this variety for code #10, select all that apply)H5. What products are select all that apply)H6. How happy are (See code #12)H7. What do you like best about this variety?H8. What do you like least about this variety? 12 banana? introduced home made with this you with   12banana?introducedhomemade with thisyou with  (See code ? (See consumption, variety? (See this   (See code? (Seeconsumption,variety? (Seethis 13 #8) codes #9) for sale? (See code #11, variety?   13#8)codes #9)for sale? (Seecode #11,variety?    code #10, select select all that (See code   code #10, selectselect all that(See code 14   all that apply) apply) #12)   14all that apply)apply)#12) 1 15        1 15 2 16        2 16 3 17        3 17 4 18        4 18 5 19        5 19 6 20        6 20 7        7 8        8 9        9 10        10 11        11 Breeding Better Bananas, Intra-household survey, 2015      Breeding Better Bananas, Intra-household survey, 2015 Breeding Better Bananas        Breeding Better Bananas  "},{"text":", Intra-household survey, 2015 H9. Do you personally earn income from selling any of the banana types ? (Select all that apply, and emphasize that this section is asking about the personal income of only the respondent, rather than of the whole household) If yes,    If yes,  no income earned    no income earned  cooking banana     cooking banana  roasting banana     roasting banana  dessert banana     dessert banana  beverage banana    beverage banana  don't know     don't know  other, please specify    other, please specify H10. Please specify 'other' __________________________________________________________________________________ H10. Please specify 'other' __________________________________________________________________________________ If yes, please answer the following questions:   If yes, please answer the following questions: Months H11. Which months are the H12. Which months are the H13. Which months are the MonthsH11. Which months are theH12. Which months are theH13. Which months are the  peak season for producing off-peak season for producing moderate season for producing peak season for producingoff-peak season for producingmoderate season for producing  bananas? bananas (very little bananas (in between the bananas?bananas (very littlebananas (in between the   production)? extremes of the peak and the production)?extremes of the peak and the    off-peak seasons)? (Select all off-peak seasons)? (Select all    the remaining months that the remaining months that    were not identified as being were not identified as being    part of the peak nor the off- part of the peak nor the off-    peak season, but ask the peak season, but ask the    respondent first if that is respondent first if that is    correct) correct) January    January February    February March    March April    April May    May June    June July    July August    August September    September October    October November    November December    December  "},{"text":"please answer the following questions: Types of banana H14. How much income do you earn from selling the banana type(s) in a typical month during the peak banana production   H15. How much income do you H16. How much income do you H15. How much income do youH16. How much income do you  earn from selling the banana earn from selling the banana earn from selling the bananaearn from selling the banana  type(s) in a typical month type(s) in a typical month type(s) in a typical monthtype(s) in a typical month  during the off-peak banana during the moderate banana during the off-peak bananaduring the moderate banana season? (Local production season? (Local production season? (Local season? (Localproduction season? (Localproduction season? (Local currency) currency) currency) currency)currency)currency) Cooking banana   Cooking banana Roasting banana   Roasting banana Dessert banana   Dessert banana Beverage banana   Beverage banana Other, if specified in   Other, if specified in H10   H10 H17.   H17.  "},{"text":"What planting material do you use when you plant banana  H23.     H23. Source of planting H19. Suckers H20. Tissue-culture H21. Macro- H22. Other, as Source of plantingH19. SuckersH20. Tissue-cultureH21. Macro-H22. Other, as material  plantlets propagated plantlets specified materialplantletspropagated plantletsspecified Own household     Own household Community     Community Agricultural extension     Agricultural extension service     service NGO     NGO Research station     Research station Private business     Private business Don't know     Don't know Other, please specify     Other, please specify  "},{"text":"Do you experience any of these constraints to banana production? ( Select all that apply)  sun  sun  drought  drought  too much water  too much water  wind  wind  weevil  weevil  weevil bugs on the leaves  weevil bugs on the leaves  Bacterial wilt (BXW)  Bacterial wilt (BXW)  Fusarium wilt (Panama)  Fusarium wilt (Panama)  Sigatoka  Sigatoka  Bunchy top (BBTD)  Bunchy top (BBTD)  nematodes  nematodes  pests and diseases (general)  pests and diseases (general)  poor soil fertility  poor soil fertility  none  none  don't know  don't know  other, please specify  other, please specify H24. H24.  "},{"text":"Please specify 'other' __________________________________________________________________________________ _________________________________________________________________________________________________________ Breeding Better Bananas, Intra-household survey, 2015 If bananas are grown, collect the following information for each plot they are grown on. I22. Plot name_____________________________________________________________________________________________  Banana variety number: 1 2 3 4 Banana variety number:1234 I23. Variety name?    I23. Variety name? I24. Extent of area under cultivation,    I24. Extent of area under cultivation, answer one of the following -    answer one of the following - - acres    -acres - % of plot    -% of plot - number of mats    -number of mats I22. Plot name (fill in as required) ___________________________________________________________________________ I22. Plot name (fill in as required) ___________________________________________________________________________ Banana variety number: (fill in as required) (fill in as required) (fill in as required) (fill in as required) Banana variety number:(fill in as required)(fill in as required)(fill in as required)(fill in as required) I23. Variety name?    I23. Variety name? I24. Extent of area under cultivation,    I24. Extent of area under cultivation, answer one of the following -    answer one of the following - - acres    -acres - % of plot    -% of plot - number of mats    -number of mats I22. Plot name (fill in as required) ___________________________________________________________________________ I22. Plot name (fill in as required) ___________________________________________________________________________ Banana variety number: (fill in as required) (fill in as required) (fill in as required) (fill in as required) Banana variety number:(fill in as required)(fill in as required)(fill in as required)(fill in as required)  "},{"text":"I23. Variety name? I24. Extent of area under cultivation, answer one of the following -  SECTION K: SECTION K: - acres -acres - % of plot -% of plot - number of mats -number of mats  "},{"text":"FOOD SECURITY Include in both complete & short versions, respondents answer separately if two are present K1. Were there any months, in the past 12 months, in which you did not have enough food to meet your family's needs?   yes  yes  no  no  don't know  don't know K2. If K2. If  "},{"text":"yes, in which months did the family not have enough food to meet their needs   "},{"text":"January February March April May June July August September October November December K3. If yes, what are the main reasons for there not being enough food  ? (Select all that apply) ? (Select all that apply)  floods  floods  drought  drought  irregular rains  irregular rains  crop seasonality  crop seasonality  crop pests and diseases  crop pests and diseases  livestock pests and diseases  livestock pests and diseases  high food prices  high food prices  high costs of agricultural inputs  high costs of agricultural inputs  lost employment  lost employment  allocation of more land to cash crops  allocation of more land to cash crops  death of household member  death of household member  theft of productive assets  theft of productive assets  erosion/landslides  erosion/landslides  don't know  don't know  other, please specify  other, please specify K4. K4.  "},{"text":"Please specify 'other' ___________________________________________________________________________________ _________________________________________________________________________________________________________ Household member K5. If yes, how many meals a day did these household members eat when there was NOT enough food to eat? K6. How many meals a day did these household members eat when there was enough food to eat  ? (Answer this question ? (Answer this question irrespective of the answer to question K1) irrespective of the answer to question K1) Household head Household head Spouse Spouse Other adult males Other adult males Other adult females Other adult females Boys Boys Girls Girls Breeding Better Bananas Breeding Better Bananas  "},{"text":", Intra-household survey, 2015   "},{"text":"Include in both complete & short versions, respondents answer separately if two are present N1. Have you participated in any agricultural extension activities in the past three years?   yes  yes  no  no  don't know  don't know N2. If yes, please describe ___________________________________________________________________________________ N2. If yes, please describe ___________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ N3. If yes, where have you participated in agricultural extension activities? N3. If yes, where have you participated in agricultural extension activities?  research station  research station  farmer's demonstration plot  farmer's demonstration plot  training center  training center  exhibition  exhibition  own plot  own plot  don't know  don't know  other, please specify  other, please specify N4. Please specify 'other' ___________________________________________________________________________________ N4. Please specify 'other' ___________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ N5. N5.  "},{"text":"If there were an opportunity to learn about new improved banana hybrids, would you be interested in participating?   yes  yes  no  no  don't know  don't know N6. Please provide a reason for the above answer _______________________________________________________________ N6. Please provide a reason for the above answer _______________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ N7. N7.  "},{"text":"If there were an opportunity to test new banana hybrids in one of your plots, would you be interested in participating?   yes  yes  no  no  don't know  don't know  "},{"text":"N8. Please provide a reason for the above answer _______________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ N9. If yes, in which plot(s) do you think the new banana hybrids would be tested in? __________________________________ _________________________________________________________________________________________________________ N10. Please provide a reason(s) for the above answer ____________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ N11. We are at the end of the survey but before we finish, do you have any questions or comments for the organisers of this project   "},{"text":"2015 SECTION O: ENUMERATOR IMPRESSIONS Include in both complete & short versions Enumerator -please answer the following questions privately, immediately after the interview: O1. In your opinion, how did you establish rapport with this respondent?   with ease  with ease  with some persuasion  with some persuasion  with difficulty  with difficulty  it was impossible  it was impossible O2. Overall, how did the respondent give answers to your questions? O2. Overall, how did the respondent give answers to your questions?  willingly  willingly  reluctantly  reluctantly  with persuasion  with persuasion  it was hard to get answers  it was hard to get answers O3. How often do you think the respondent was telling the truth? O3. How often do you think the respondent was telling the truth?  all of the time  all of the time  most of the time  most of the time  sometimes  sometimes  rarely  rarely O4. Please write any other notes, comments, observations, etc. ___________________________________________________ O4. Please write any other notes, comments, observations, etc. ___________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________ _________________________________________________________________________________________________________  "}],"sieverID":"0ef55263-3a32-4f37-874c-76746a1cab9f","abstract":"Tools for understanding the agricultural production systems and their socio-economic context in target regions for the introduction of new banana cultivars -Baseline intra-household survey. Bioversity International,"}

data/part_1/01e033c0385a9b2b181a9685b8079890.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01e033c0385a9b2b181a9685b8079890","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/546e4547-3dab-42ab-b2e0-c6786e25399a/retrieve"},"pageCount":2,"title":"Development of Strategic Partnership to Improve Smallholder Access to Feed and Fodder in South Asia and Sub-Saharan Africa Project Type: Research Proposal Development /Seed Grant/ Lead Center: ILRI Lead Principal Investigator: Dr","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[],"sieverID":"d8ea8872-84ce-4d10-9371-cb6223e25719","abstract":""}

data/part_1/01e74abd6797bfd9dce74700da2ad716.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01e74abd6797bfd9dce74700da2ad716","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/51193394-6542-4b35-9970-38cc1719f43b/retrieve"},"pageCount":6,"title":"M&E and Knowledge Management division, National Programme Coordination Unit of the International Fund for Agricultural Development","keywords":["Finance institutions","savings and credit","community banks"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":57,"text":"Working to eradicate rural poverty and promote economic growth, the Government of Sierra Leone, with financial support from the International Fund for Agricultural Development, has established 17 rural finance institutions across the country. With the widest financial network in the country, community banks are providing access to saving and loan facilities for increasing numbers of rural people."},{"index":2,"size":72,"text":"regulating the country's financial sector. Eight rural banks were established in 1985, but these were eroded due to the civil war, poor monitoring and supervision from the BoSL, and weak management systems. As the war ended in 2002, the concept was revamped and six CBs were created. To operationalise CBs, an Act of Parliament (Other Financial Services Act 2001) was enacted, and with the assistance of RFCIP, there are now 17 CBs."},{"index":3,"size":68,"text":"Crucial to the establishment of CBs was the creation in 2008 of the National Steering Committee to coordinate, oversee and monitor the project: Members include the Ministry of Finance and Economic Development (MoFED), the Ministry of Agriculture Forestry and Food Security (MAFFS), IFAD, BoSL, the Parliamentary Committees on finance, agriculture, housing and infrastructure, and the National Federation of Farmers in Sierra Leone as representatives of the farming community."},{"index":4,"size":54,"text":"A feasibility study, conducted in June 2010, was used to select the strategic location of CBs. Key things taken into consideration included market size, population and the general economic activities in each area. Out of 149 chiefdoms, 17 were identified to establish CBs. Various government, donors and beneficiary level stakeholders were informed and sensitised."},{"index":5,"size":96,"text":"Since the concept of CBs is geared towards community ownership, the sale shares (a unit of T o realise the immense potential of rural finance institutions as a platform for accelerated economic, agricultural, social and rural transformation, the Government of Sierra Leone, with financial support from the International Fund for Agricultural Development (IFAD), began implementing the Rural Finance and Community Improvement Programme in 2008 (RFCIP). Its principal goal is to reduce rural poverty and household food insecurity on a sustainable basis, by improving access to rural financial services and enabling the development of the agricultural sector."},{"index":6,"size":86,"text":"The programme, which is being implemented in the 12 districts where over 70% of the population lives, has established 17 community banks (CBs), 59 financial service associations and an Apex Bank to provide rural communities with access to financial services. The primary target groups for CBs are smallholder farming groups, and micro and small-scale entrepreneurs, including women and youths. The aim of CBs are to tackle the high interest rates charged by unscrupulous middlemen, and a lack of secure saving facilities, affordable loan schemes and remittances."}]},{"head":"Making finance work","index":2,"paragraphs":[{"index":1,"size":18,"text":"CBs were first established by the Bank of Sierra Leone (BoSL), which is the regulatory body responsible for"}]},{"head":"Cover The Taiama Community Bank advertises its services","index":3,"paragraphs":[{"index":1,"size":67,"text":"After a procurement process, construction of CBs was supervised by engineers employed by the project. So far, 11 CBs, 11 managers' quarters and 34 staff quarters have been constructed, and six existing CBs have been renovated. However, land disputes, construction delays, inadequate supervision from some engineers, and inadequate local skilled labour caused delays. Poor supervision by project staff and contractors also resulted in some CBs being substandard."},{"index":2,"size":166,"text":"After construction, each CB submits an application to the BoSL which carries out an inspection to ensure that certain requirements (such as having enough capital and skilled staff) are met before issuing a license enabling the bank to commence banking activities. At the moment, 17 CBs across the country have been issued with a license. Each bank is then ownership in the CB expressed in monetary terms, where one share is worth 10,000 leone, or €1.10) is then launched. This plays an integral role in mobilising funds, ascertaining the willingness of communities to use the CB and also raising awareness of banking among the intended beneficiaries and would-be shareholders. During this process, members of the selected communities are identified and trained to sell shares, kick-starting the banking process. In some cases, however, whilst the number of shareholders was relatively high, resources mobilised through the sale of shares did not meet the required amount set out by the BoSL (one billion leone, or €112,730, paid up capital)."},{"index":3,"size":58,"text":"Monitoring of the sales of shares is carried out by the Apex Bank, ensuring accountability and transparency. Nonetheless, negative attitudes of some share promoters (like dishonesty, ineffectiveness and inefficiency) led to a poor accounting of the capital mobilised. Going forward, the Apex Bank has adopted a strategy of early staff recruitment for CBs to prevent this happening again."},{"index":4,"size":111,"text":"Convening of a general assembly is another crucial step in establishing CBs. This is characterised by identifying, electing/selecting board members and then the chairman. Poor commitment from some board members, as well as an increasing demand for high sitting fees, were the main challenges. CB staff also began to be recruited, providing job opportunities for young people with the right skills and knowledge. Inadequate staff numbers and loss of staff due to the remote locations of CBs did cause some problems. However, the Apex Bank now has a pool of standby personnel to be deployed in case of a staff leaving without prior notice, and modern staff quarters have been constructed."},{"index":5,"size":73,"text":"Convening of a general assembly is a crucial step in establishing community banks. Despite these successes, some Apex Bank weaknesses that have been identified include a lack of resident internal auditors, weak board governance and inadequate resources leading to defaults in loan repayments of the RFF. In response, the Apex Bank has increased its field presence by bringing in inspection assistants that constantly monitor CBs on a weekly basis to resolve problems promptly."}]},{"head":"What can we see?","index":4,"paragraphs":[{"index":1,"size":146,"text":"CBs have been established in 12 out of 14 districts in Sierra Leone, providing the widest financial network in the country. This is showing results at different levels: The factors responsible for achieving this are the willingness shown by many communities to provide land for construction; the timely award of contracts to contractors; adherence to the feasibility study; constant monitoring and supervision by the Apex Bank; the desire by all stakeholders to provide rural financial services at national level; the availability of the Apex Bank HR department for recruitment; and the execution of an annual training plan. Lessons learned are that there is need for continuous capacity building of CB staff and board members. Overdependence on one service provider to provide banking software service was a challenge, however software has not been procured to link the CBs to the Apex Bank to ensure real time monitoring."},{"index":2,"size":73,"text":"(b) Access to finance: By December 2016, 17 CBs had a total of 24,016 shareholders with a share capital of 2,770,726,000 leone (€306,722). Depositors/savers totalled 68,590, with a deposit value of 26,952,605,000 leone (€2,985,500). The number of loan clients surged to 20,170 and the loan portfolio was 31,741,739,000 leone (€5,515,800). The total number of clients accessing remittance services was 19,303 with a remittance value of 18,279,162,000 leone (or more than 2 million euro)."},{"index":3,"size":77,"text":"The reasons behind these high numbers include the community sensitisation efforts (via radio programmes, jingles, road side shows), stakeholder participation at every stage, and a positive enabling environment (government providing the necessary business rules and regulations to conduct successful business). It has also been mentioned that affordable products and services, and the introduction of a Gender Action Learning System (GALS), helped encourage women to join the bank, just as having products tailored towards the needs of women."}]},{"head":"Above Community banks have been established in 12 out of 14 districts in the country","index":5,"paragraphs":[{"index":1,"size":72,"text":"On the other hand, the difficult geographical terrain, staff turnover, limited financial literacy, poor telecommunications, disperse location of customers and lack of crop insurance did deter some people from making the most of CB facilities. One lesson learnt was the importance of financial literacy education to prevent fraud. The need for a credit reference bureau to prevent concurrent borrowing from different CBs, and crop insurance and agricultural production loans, was also identified."}]},{"head":"(c) Gender equality and youth empowerment:","index":6,"paragraphs":[{"index":1,"size":91,"text":"Empowering the disempowered has been the hallmark of the establishment of the CBs. The percentage of youth participation in the area of savings is 37%, and women participation is 42%. In terms of access to loans, 40% are women whilst 42% are youths. An Okada (motor bike) loan scheme was developed exclusively to benefit youths, and of those employed by the CB network 25% were women. To improve these statistics further, GALS is being initiated when a new CB is created to ensure that women are catered to from the start."}]},{"head":"(d) Stakeholder participation and ownership:","index":7,"paragraphs":[{"index":1,"size":124,"text":"There has been a growth in share capital mobilisation at community level, and the level of participation from different stakeholders is improving. All 17 CBs have functioning boards made up of community members, and there is a National Steering Committee that meets to strategically discuss implementation and the challenges faced by CBs. There is also an Annual General Meetings for shareholders. A key lesson learnt is that the demand for loans exceeds the savings culture of the rural poor. The project is therefore operating a RFF to provide credit lines to CBs to at least reduce the gap between the demand for loans and what is actually available in CBs. Establishing CBs in rural communities is pivotal in the socio-economic development of a country."}]},{"head":"S/N CB indicators (December","index":8,"paragraphs":[{"index":1,"size":59,"text":"(e) Sustainability: The network's average operational self-sufficiency (OSS), which is a measure of how well the network is able to generate resources (income) in excess of expenses, stood at 129%, which is well above the Microfinance Information Exchange market benchmark of 112% for microfinance institutions. Financial self-sufficiency (FSS), upon adjusting for operational cost subsidy, averaged 102% (2% above benchmark)."}]},{"head":"A booming business","index":9,"paragraphs":[{"index":1,"size":55,"text":"Martha George, a single mother of five children, was a small trader in Taiama, but since receiving a loan from Taimama CB she is among the top businesses in Taiama and owns two shops. With the profit she has made George has been able to construct a house and pay school fees for her children."},{"index":2,"size":40,"text":"George has plans to increase her loan amount so that she can travel to China in order to expand her shop. \"By God's grace I want to have the biggest shop in Taiama in the next 2 years,\" she explains."},{"index":3,"size":118,"text":"Local (domestic money transfers, electronic cash transfers) and international (Western Union through sub-agency arrangements with established commercial banks) remittances have improved significantly. Access to finance has been on the increase as both savings and loans are growing, as well as the number of people accessing those services. However, despite the steady growth rate, the consolidated share capital of 2.77 billion leone (€306,722) falls below the regulatory paid up capital requirement of 17 billion leone. The network and its supervising body, Apex Bank, are therefore scaling share mobilisation strategies being employed and trying to better capitalise CBs from the outset rather than provide them with operational costs to ensure they are able to meet the growing demand for loans."}]},{"head":"Key ingredients","index":10,"paragraphs":[{"index":1,"size":34,"text":"Establishing CBs in rural communities is pivotal in the socio-economic development of a country. Our experience so far has shown that this can be a profitable business. Similar initiatives need to consider:  E-mail: [email protected] "}]}],"figures":[{"text":" Above Construction was supervised by engineers employed by the project opened officially to the public, and share mobilisation continues.Monitoring, supervision and training of CB staff is done by the Inspections and CBs Operations Units of the Apex Bank on a daily, weekly and monthly basis as need arise. Their strategic role is to identify and resolve critical operational lapses; ensure CB control measures and checks and balances are strictly adhered to; and provide training to banking staff to meet demands of clients and detect frauds. The Apex Bank also provides IT support, HR support, training/ capacity building, and a refinance facility fund (RFF). As a result, all CBs are fully equipped with Management Information Systems (MIS), and swift movement of cash between CBs is ensured. "},{"text":" (a) Institutional building: The recruitment and training of 102 CB staff on banking operations, and 51 Board members in corporate governance and financial literacy are pointers of success. "},{"text":"1. The conduct of a professional feasibility study: this must be done without fear or favour and should be devoid of political interference 2. Capitalisation: banks cannot succeed without enough start-up capital 3. Effective monitoring and supervision 4. Stakeholder participation and ownership 5. Good governance systems 6. Effective management systems 7. Existence of a modern MIS 8. Development of good products and services 9. Good customer relations and marketing 10. Robust sensitisation. Martha George Emmanuel S. Gbakie works as Communication and Knowledge Management Officer at the National Programme Coordination Unit of the International Fund for Agricultural Development, Sierra Leone. "}],"sieverID":"41eafd2c-a2d0-450e-80ff-5d6f3d0fc1ac","abstract":""}

data/part_1/01ea0c6557f24fc0fd8888242ef817e6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01ea0c6557f24fc0fd8888242ef817e6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/29f20600-8cd6-4321-95ad-1977f3d7a556/retrieve"},"pageCount":2,"title":"Transforming Food Systems Under a Changing Climate Future technologies and food systems innovation for accelerating progress towards the SDGs: key messages","keywords":[],"chapters":[{"head":"New and emerging technologies","index":1,"paragraphs":[{"index":1,"size":54,"text":"1. A recent inventory shows that new and emerging technologies are well spread across the food system, from production processes right along the value chain to consumers. These technologies are from the domains of cellular agriculture, digital agriculture, food processing and safety, gene technology, health, inputs, intensification, replacement food and feed, and waste reduction."}]},{"head":"2.","index":2,"paragraphs":[{"index":1,"size":90,"text":"Technologies differ widely in their readiness and potential for adoption by 2030. For example, several related to digital agriculture are relatively mature, such as improved climate forecasts, use of drone technology, and traceability technologies. Digital innovation continues apace, with declining costs and growing uptake in low-, middle-and high-income countries alike. Some other technologies were deemed highly unlikely to be available or widely adopted by 2030. An example is nitrogen fixation in cereals; several different approaches are currently being researched, and eventual success is considered plausible but not within this timeframe."}]},{"head":"3.","index":3,"paragraphs":[{"index":1,"size":68,"text":"All 75 technologies in the inventory were scored for their potential impacts on the Sustainable Development Goals. Most technologies seem to have largely positive impacts on the SDGs most closely associated with the food system such as SDG 1 (no poverty), 2 (zero hunger), 3 (good health and wellbeing) and 13 (climate action). There are many unknowns about the potential impacts of different technologies in different contexts, however."}]},{"head":"4.","index":4,"paragraphs":[{"index":1,"size":63,"text":"Across the food-related SDGs, different technologies vary in the extent and focus of their impact. There are no universal \"silver bullets\"; rather, the technologies make up an arsenal of ammunition of different sorts. This is inevitable, given the breadth of innovation that we found. But it is also desirable, so that countries can match available and commissioned innovation with their most pressing needs."}]},{"head":"5.","index":5,"paragraphs":[{"index":1,"size":84,"text":"Several technologies seem to balance readiness, adoption potential and impacts. The \"top ten\" include four technologies relating to replacement food and feed for livestock and fish: plant-based substitutes, insects, microalgae and cyanobacteria, and seaweed. Many efforts are underway attempting either to address the demand for livestock products by providing alternative protein sources or to decouple livestock production from land via alternative feeds to reduce its environmental impact globally. Growth demand for fish is spurring activity to reduce competition for feed with the livestock sector."}]},{"head":"6.","index":6,"paragraphs":[{"index":1,"size":74,"text":"Other technologies in the \"top ten\" include improved climate forecasts and pest/disease early warning; circular economy approaches for reutilising, recycling and repurposing resources, which can lead to improvements in food production while substantially reducing waste and creating new local business opportunities, as resources are revalued as part of the process; and vertical farming in confined spaces with no soil or natural light, another way in which food production can be decoupled from the land."},{"index":2,"size":83,"text":"What's needed to foster food system innovation? 7. For the \"top ten\" and other technologies that are nearready and with high potential for impact, investment in their dissemination and implementation will be critical for achieving the food-related SDGs. We urgently need novel methods to insert these options into current food systems, as well as better understanding of what might affect their uptake to scales that transform. The private sector will have a crucial role to play in driving the uptake of these technologies."}]},{"head":"8.","index":7,"paragraphs":[{"index":1,"size":53,"text":"At the same time, regulatory frameworks and market structures need to be established to ensure that these advances are well aligned with the aims of public policy. This will be challenging: adoption of technologies that may be highly disruptive to existing food systems will drive a complex web of direct and indirect effects."}]},{"head":"9.","index":8,"paragraphs":[{"index":1,"size":44,"text":"Engagement with issues of social licence and acceptability in the adoption of new, disruptive technology will require considerable investment in broad public dialogue to legitimise support. People have deeply engrained biological, psychological and cultural relationships with food -it's not just about price and safety."},{"index":2,"size":77,"text":"10. Throughout history, innovation has produced winners and losers. Although bottlenecks in the enabling environment need to be addressed, especially in lower-income countries where the potential impacts (both positive and negative) of technological innovation may be relatively larger, we also need to ensure that safety nets are in place for the losers of technological change in the short and long term. Success will create room across the SDGs for better health, wealth and environmental outcomes for all."}]}],"figures":[],"sieverID":"b4830949-0840-4b77-989d-0efc2c0422eb","abstract":"The global food system is the single largest driver of global environmental change, contributing 24% of greenhouse gas emissions, consuming 70% of blue water, and being the primary cause behind the 60% loss of vertebrate biodiversity since the 1970s. In the next three decades we will need a 30-70% increase in food availability to meet the demand for food by an increasingly numerous, urbanised and affluent population. The food system will need to change profoundly if humanity is to be provided with healthy food that is grown sustainably in ways that are both resilient in the face of climate change and do not surpass planetary boundaries. Technological innovation will have a critical role to play in this process. What might be possible if we adopted new, gamechanging technologies in the food system?"}

data/part_1/020a3f6c3f5dca9647bbfbf16437396b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"020a3f6c3f5dca9647bbfbf16437396b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a3101071-4a55-4799-aafd-55052c3ed66c/retrieve"},"pageCount":33,"title":"","keywords":[],"chapters":[{"head":"Ochuwa's story","index":1,"paragraphs":[{"index":1,"size":23,"text":"• Women do 90% of farm weeding, spending long periods bent over which affects health and sometimes they enlist their children to help."},{"index":2,"size":51,"text":"• Weed management technology has helped reduce the burden on women on their cassava farms. This means less time spent in weeding, less bending to weed, zero withdrawal of children from school to weed farms, and increased crop production and sales (due to better agronomic practices combined with better weeding management)."},{"index":3,"size":4,"text":"• Location: Abeokuta, Nigeri"},{"index":4,"size":36,"text":"Wakio's story • Women are disadvantaged for not having enough land to plant their produce, lacking the labour they need for farming and harvesting as well as difficulty in finding markets due to middlemen and competition."},{"index":5,"size":14,"text":"• Location: the Rift Valley region where pyrethrum farming is widely practiced, in Kenya"},{"index":6,"size":2,"text":"Festus' story  "}]}],"figures":[{"text":"Assignment 4 : Go get your storyGo on your field trip -conduct interviews, take photos, collect videoDon't forget to take consent forms Ask mentors for help Have interviews and visuals saved in a folder on your computer by February 28 Your field trip • Module 1 -January 24 -Sourcing stories • Module 2 -January 31 -Understanding your readers • Module 3 -February 7 -Interviewing and researching your story • Module 4 -February 14 -Taking photos and videos February 21 -no session -for field trip and interviewing • Module 5 -February 28 -Drafting your stories Field trip completed by this date • Module 6 -March 7 -Crafting your stories • Module 7 -March 14 -Editing and pitching your stories March 21 -no session -for writing, editing, pitching • Module 8 -March 28 -Recapping, troubleshooting Note change of date Finish all modules on March 28 "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"1b786495-5856-45ad-ac0f-fd6183800218","abstract":""}

data/part_1/022142b67b5300da17fb04e884a0b2bd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"022142b67b5300da17fb04e884a0b2bd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d548e29f-8e69-46b6-942a-dc5cc799aca1/retrieve"},"pageCount":9,"title":"Delivering for Nutrition in South Asia Equity and Inclusion","keywords":[],"chapters":[{"head":"BACKGROUND","index":1,"paragraphs":[{"index":1,"size":9,"text":"• Needs of beneficiaries are often multifaceted and complex."},{"index":2,"size":20,"text":"• FLWs often have a large area coverage, wide range of beneficiaries to reach within a limited timeframe and resources."},{"index":3,"size":18,"text":"• The opportunities for frontline workers (FLWs) to identify the specific needs and provide targeted solutions are limited."},{"index":4,"size":17,"text":"• They end up providing broad, unnecessary messages which may not necessarily address the issues in question."},{"index":5,"size":20,"text":"• A one-size-fits-all approach works counter productive, wasting cumulative time and resources, and falling short to achieve optimal tangible impact. "}]},{"head":"METHOD IMPLEMENTED","index":2,"paragraphs":[{"index":1,"size":12,"text":"1. Empathetic discussion to understand the problem areas according to the respondent."},{"index":2,"size":24,"text":"2. Locate specific domain(s) for the identified problem using a matrix of 4 domains of Behavior Change 1 across 4 levels of implementation (4x4)."}]},{"head":"Provide tailored solutions for Behaviour","index":3,"paragraphs":[{"index":1,"size":14,"text":"Change based on predefined action strategies for the specific domain located on the matrix."},{"index":2,"size":13,"text":"4. Assess whether the solution solved the problem and carry out course correction."}]},{"head":"METHOD IMPLEMENTED Community Mobilizers (CM) Training:","index":4,"paragraphs":[{"index":1,"size":20,"text":"• ACF India's field staff -over 200 at 8 locations across 4 states trained on identifying specific domains for intervention."},{"index":2,"size":18,"text":"• Equipped with knowledge and skills necessary to identify problems and deliver tailored solutions, leveraging the matrix's structure."}]},{"head":"Counselling sessions:","index":5,"paragraphs":[{"index":1,"size":3,"text":"• Consisted of:"},{"index":2,"size":9,"text":"• • Understanding the perspective of the family members"},{"index":3,"size":9,"text":"• Building their motivation for child and mother care"},{"index":4,"size":8,"text":"• Building an enabling environment for the mother"},{"index":5,"size":15,"text":"• Assessing the baseline skills of the new FLW to identify gaps in anthropometric assessment"},{"index":6,"size":10,"text":"• Providing them with training to build the necessary skills"},{"index":7,"size":26,"text":"• Advocacy at system level for supply of good quality anthropometric equipment 1. Improved Confidence: Delivering tailored solutions with a systematic framework to guide intervention delivery."}]},{"head":"Optimizing time of beneficiaries and CMs:","index":6,"paragraphs":[{"index":1,"size":22,"text":"Focus on the most critical aspects for meaningful change, especially when each CM has a large area to cover in shorter time."}]},{"head":"Holistic Approach:","index":7,"paragraphs":[{"index":1,"size":17,"text":"Consideration of both individual and environmental factors and recognizing that behavior change often requires a multifaceted solution."},{"index":2,"size":12,"text":"4. Cultural Sensitivity: Improved understanding of, and addressing cultural and social factors."}]},{"head":"Effective and targeted use of job aids:","index":8,"paragraphs":[{"index":1,"size":18,"text":"Information, education and communication material used only to facilitate need-based solutions, than overwhelming audience with too much information."},{"index":2,"size":22,"text":"6. More involved and interesting sessions: Focusing on the critical needs of the beneficiaries, increasing their involvement, than making them feel bored."}]},{"head":"KEY INTITAL FINDINGS","index":9,"paragraphs":[{"index":1,"size":6,"text":"Adaptability for scaling up well-designed interventions:"},{"index":2,"size":10,"text":"• Enhancing CMs' self-efficacy to deliver complex behavior change interventions."},{"index":3,"size":14,"text":"• Increased specificness improves the effectiveness by addressing the root causes of the problem."},{"index":4,"size":18,"text":"• FLWs develop a deeper understanding of the factors influencing behavior change, enhancing their overall capacity at scale."}]},{"head":"SIGNIFICANCE & APPLICATION","index":10,"paragraphs":[{"index":1,"size":12,"text":"• Meet the unique needs of different communities and regions.  High Fidelity"}]},{"head":"THANK YOU!","index":11,"paragraphs":[]}],"figures":[{"text":" Empathetic discussion and probing with the respondent to understand the problem areas • Locating the specific domain on the matrix • Providing targeted solutions or follow up points • Follow-up to assess outcome of intervention • Field observation and documentation of training reports to assess: • Effectiveness of matrix to deliver the tailored interventions • Need-based course correction and improvement in problem solving difficulties attending to her third girl child due to family's gender preference New FLW faces challenges in conducting anthropometric assessments and the equipment available to her are of poor "}],"sieverID":"f443cfb0-2001-4ce1-a741-0b86f700b209","abstract":"• Action Against Hunger (ACF) India works in 4 states:Maharashtra, Madhya Pradesh, Rajasthan, and Gujarat.• Coverage: 1266 rural and tribal villages and 160 Anganwadi centers in urban slums.• Key interventions: community management of acute malnutrition, 1000 days, food security and livelihoods (FSL) and water, sanitation and hygiene (WASH), and system strengthening.• Primary beneficiaries: malnourished children, their caregivers, pregnant, and lactating women, and their families.• Collaborative efforts with: Govt. officials, frontline workers, and Panchayati Raj Institute (PRI) members."}

data/part_1/027b6193ffaced487cc87ad4da36c65f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"027b6193ffaced487cc87ad4da36c65f","source":"gardian_index","url":"https://solar.iwmi.org/wp-content/uploads/sites/43/2021/09/PAKISTAN-SITUATION-ANALYSIS-REPORT_final-version-3.pdf"},"pageCount":44,"title":"Solar Irrigation in Pakistan A Situation Analysis Report","keywords":[],"chapters":[{"head":"List of Figures","index":1,"paragraphs":[]},{"head":"List of Tables","index":2,"paragraphs":[{"index":1,"size":51,"text":"Consequently, groundwater abstraction kept on increasing. This development led to many adverse policies and environmental implications, among which the most prominent are falling groundwater levels and CO2 emissions from diesel pumps. Uncurbed use of groundwater has led to a substantial increase in cropping intensity; however, agricultural productivity remains low in Pakistan."},{"index":2,"size":17,"text":"In the recent past, solar pumping technology has emerged as an alternative to diesel and electric pumps."},{"index":3,"size":59,"text":"Still, water professionals in Pakistan are concerned that converting pumps to PV solar will result in indiscriminate pumping and eventually lead to further groundwater depletion. Pakistan does not have a specific policy on solar technology for groundwater pumping in agriculture. However, the country does have several policies that have a bearing on solar technology for groundwater pumping in agriculture."},{"index":4,"size":203,"text":"The National Water Policy makes several references to groundwater pumping. The objectives of this national policy in terms of groundwater aims to regulate groundwater withdrawals for curbing overabstraction and promote aquifer recharge. It also aims to develop hydropower to increase the share of renewable energy. After the 18 th Amendment in the Constitution, governance and management of water resources are devolved to provinces. SIPs provide a promising alternative to diesel pumps. Still, marginal farmers cannot invest due to high initial costs and the low discharge capacities of SIPs compared to diesel-powered pumps. The provincial governments have tried to promote SIPs through High-Efficiency Irrigation Systems (HEIS). This is one of the primary reasons for the slow adoption rate as the farmers are not ready to shift from flood irrigation to HEIS techniques. Another challenge is that the costs of solar-powered pumping systems increase rapidly with an increase in pumping depth and discharge. For depths greater than 100 feet, the cost of solar tube wells increases significantly and becomes uneconomical. On the other hand, if water tables are shallow, SIPs provide a low operating cost alternative to marginal farmers struggling with slim profit margins due to high diesel fuel prices or excessive electricity load shedding."},{"index":5,"size":131,"text":"The SDC-SoLAR project addresses some of the policy-relevant questions around SIPs through its research activities. Through the work on measuring groundwater extraction behaviour of SIP farmers, the project hopes to contribute to the ongoing discourse on threats to groundwater due to over-pumping linked to zero marginal cost of electricity. Through its pilot on providing options to farmers to sell electricity back to the grid (simulated through heat sinks), the project aims to provide a workable solution to the potential groundwater over-extraction problem. Finally, the project also hopes to demonstrate that a well-designed precision surface irrigation system can help farmers make efficient use of groundwater without having to invest in highly capital intensive high-efficiency irrigation systems (HEIS). and supply (water availability); thus, the water shortage has risen in the last three decades."}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":158,"text":"In 1960, the signing of the Indus Basin Water Treaty led to the construction of dams and irrigated agriculture expanded over 16 million hectares in Pakistan (Lytton et al., 2021). This expansion in the irrigation system led to seepage from the canal system, which resulted in the development of a shallow groundwater emissions annually (FAO, 2019). Punjab is promoting solar technology by providing a 60% subsidy on installing a HEIS system and an 80% subsidy for a solar system if coupled with HEIS. However, this program requires farmers to use solar pumps only with HEIS, and this combination may not be appropriate for certain existing cropping patterns. The government of Khyber Pakhtunkhwa has also initiated projects through their Directorate of Agricultural Engineering to provide a 50% subsidy on SIPs to be used in rain-fed and water-scarce areas. The Sindh government has launched several schemes to install solar-powered tube wells and pumping stations to strengthen the province's agriculture sector."},{"index":2,"size":115,"text":"To date, PKR 802 million has been earmarked for providing SIPs and tube wells at subsidized rates to farmers, but the success of this program is yet unknown. Finally, in Baluchistan, the only Province where tube wells are connected to the grid, these pumps consume 900 MW of power annually. They are depleting the water table rapidly due to prolonged drought conditions and excessive groundwater pumping. The Baluchistan government is providing PKR 23 billion in electricity subsidies to farmers using grid-connected tube wells. In 2017, the federal government and Baluchistan agreed to replace 30,000 grid-connected tube wells with SIPs to decrease the burden on the provincial government. But, to date, this project has not materialized."},{"index":3,"size":101,"text":"Pakistan's private sector has played a vital role in promoting SIPs. Until recently, there were very few subsidy programs for SIPs wherein only large-scale farmers could afford to invest in SIPs, which were again provided by the private sector. The majority of farmers who adopted SIPs were large-scale farmers who used their funds. Given the large landholdings of these farmers (> 10 ha) and deepwater tables (> 25 meters in places where SIPs have been installed, the farmers have purchased large-sized SIPs greater than 5 HP. These systems cost between USD 9,000-20,000, but prices have been falling rapidly in recent years."},{"index":4,"size":93,"text":"This situation analysis of SIPs in Pakistan is divided into six sections. After the introduction (Section 1), in section 2, the national outlook of groundwater use is described by looking at the depth of groundwater, seasonal fluctuations, and the variability in groundwater quality in the Indus Basin. In section 3, policies and legislation related to SIP are mentioned at the provincial and federal levels. In section 4, public and private stakeholders are highlighted. In section 5, opportunities and challenges related to SIPs are discussed. The report ends with a conclusion in section 6."}]},{"head":"National Outlook of Groundwater Use","index":4,"paragraphs":[{"index":1,"size":102,"text":"Pakistan has one of the largest contiguous irrigation systems globally, irrigating about 17 million ha (Mha). Agriculture consumes more than 93% of water in Pakistan whereas, the water use efficiency is very low and ranges around 40% (PCRWR, 2020). The country is dependent on groundwater as the predominant water source, where groundwater provides over 60% of water for agriculture, more than 90% of water for domestic and almost 100% water for industrial sectors (PCRWR, 2020). Groundwater has played a significant role in increasing the overall cropping intensity in Pakistan from about 63% in 1947 to 150% in 2015 (Khan et al., 2016)."},{"index":2,"size":178,"text":"Figure 1 shows about 0.71 million tube wells in the country in 2001-02, which increased to 1.32 million in 2013-14, at an average annual growth rate of about 4.9%.  Over the last three decades or so, a spectacular increase in the number of private tube wells in the country has had many adverse policy and environmental implications. In many areas, high water tables used to be a significant threat till the 1980s. However, with a steep increase in the development of private tube wells, water levels have now declined. About 2.5 million farmers who depend on tube well for irrigation extract groundwater through privately owned tube wells or buy water from their neighbours (Pakistan Bureau of Statistics, 2014). The pace at which the groundwater exploitation has unfolded has added complexity to its management. Their behavioural pattern concerning groundwater use is highly dynamic. Farmers understand little about any adverse interaction, which is likely to result from the unsystematic and erratic nature of groundwater pumping. Their major interest is to pump more water to meet the rising crop water requirements."}]},{"head":"Depth and fluctuations of groundwater levels","index":5,"paragraphs":[{"index":1,"size":126,"text":"According to International Waterlogging and Salinity Research Institute (IWASRI), the area, which falls under Depth to Water (DTW) ≤1.5m, is classified as waterlogged. In contrast, DTW of 1.6-3.0m is termed as likely to be waterlogged (Basharat et al., 2014). Based on IWASRI Classification (as shown in figure 6), the groundwater depletion issue mainly exists in Lower Bari, followed by some parts of Rechna doab in Punjab. Particularly, the areas of Lodhran, Multan, Khanewal, Vehari, Pakpattan districts show high groundwater depletion, whereas the regions of Sahiwal, Chiniot, Toba Tek Singh and Lahore districts are partially depleted (Khan et al., 2016). According to Khan et al. (2016), the groundwater salinity increases with depth in the four doabs (Thal, Chaz, Rachna, Bari). However, the spatial pattern remains the same."},{"index":2,"size":217,"text":"The extensive groundwater pumping in Punjab province has helped address the menace of waterlogging and salinity (Figures 4 and 5), but at the same time, overexploitation has resulted in depletion in many parts of the Upper Indus Plain (UIP).  In 2013, about 98% of the Lower Indus Plain (Figure 7) had an average annual depth to the water table that ranged from 0.2 to 3.0m. Out of which, an area of about 51.3% falls under waterlogging conditions having DTW less than or equal to 1.5m. The deepwater table (>3 m) was only in some of the Rohri and Nara canal regions, where fresh groundwater was pumped for agriculture. The waterlogging is visible in the Indus Deltaic region of Sindh, where the River Indus joins the Arabian Sea (Iqbal et al., 2020).   The seasonal variations in Depth to Water (DTW) before and after the monsoon periods are very significant in the Lower Indus Plain (LIP) (Basharat et al., 2014). Due to the reduction in canal flows during the Rabi season, the additional irrigation requirements are met through groundwater abstraction, resultantly, an increase in depth to the water table. During the pre-monsoon period in 2015, the GIS mapping (Figure 12) suggests that the area covered by DTW >1.5 m has increased from 39% (post-monsoon, 2014) to 89% (pre-monsoon, 2015)."},{"index":3,"size":171,"text":"Whereas figure 13 shows, the area under DTW from 1.5-3.0 m has increased up to 72%, which was 32% in post-monsoon, 2014. This increase in area coverage is augmented by reducing recharge due to decreased canal flows in the Rabi season coupled with groundwater pumping to meet additional irrigation requirements. However, in certain areas, the depth to the water table has increased up to 16m due to groundwater pumping. These are the pockets of fresh groundwater availability in the districts of Larkana, Naushero Feroz, Shaheed Benazirabad, Matiari and Tando Allah Yar (Iqbal et al., 2020).  In areas of Baluchistan, there is a decline in the groundwater table; this is attributed to extensive groundwater abstraction and inefficient use of the pumped water. The excessive groundwater abstraction has lowered the water table by up to 5m per annum in some valleys, causing groundwater mining, especially in Quetta, Pishin, Mastung and Mangochar (Table 1). This results from irrational and highly inefficient water use for irrigation where water losses are immense (Ashraf and Sheikh, 2017). "}]},{"head":"Sub-Basin","index":6,"paragraphs":[]},{"head":"Quality of Groundwater","index":7,"paragraphs":[{"index":1,"size":45,"text":"The groundwater quality is divided into four water quality zones: freshwater (4.0 dS/m) from 0 to 300m depth at an interval of 50m depth. The groundwater quality maps were verified from USGS maps (work done in the 1950s by WAPDA) and Drainage Atlas of IWASRI/WAPDA."},{"index":2,"size":87,"text":"Figure 14 shows that in Thal doab, the upper 50m layers are mainly underlain by groundwater's fresh quality, except for some parts of the Khushab, Layyah and Muzaffargarh districts. Most of the areas of Mianwali, Bhakkar, Jhang, Layyah and Muzaffargarh districts are under fresh groundwater quality. The area under the Thar desert is underlain by the fresh quality of groundwater that has not been exploited so far. This area has a great potential to enhance agricultural productivity and the 'country's future food security (Khan et al., 2016).  "}]},{"head":"Groundwater Pumps: Electric and Diesel","index":8,"paragraphs":[{"index":1,"size":318,"text":"Pakistan has one of the 'world's largest groundwater aquifers (4th after China, India and the USA). Figure 17 below shows the spread of groundwater irrigation in Pakistan. The tube well numbers increased from less than 200,000 in 1980 to 1.1 million in 2015 (Verma et al., 2018). This is mainly due to increased cropping intensity which rose from 67% to around 150% during a similar time period (WB, 2019). There has been no embargo from the government to install agricultural tubewells, and farmers have utilized this provision to cultivate as much area as was possible. Figure 18 shows that the number of tube wells has increased from 0.2 million to over 1.2 million over the last two and a half decades (Qureshi & Ashraf, 2019). Punjab will be the main focus of the SoLAR project in Pakistan. Some preliminary details of the presurvey conducted with SIP farmers in Punjab are given in section 6. In addition to this, Punjab is also the most populated Province of Pakistan, so it will be worthwhile to look into the spread of diesel and electric pump tube wells across the province. 87% of the total tubewells are diesel-powered, whereas the rest of 13% are electrically powered (Agricultural Department, Punjab, 2014). In Punjab, the highest number of diesel and electric pump tubewells are in the Gujranwala division. On the other hand, the lowest number of diesel pump tubewells are in the Rawalpindi division and Sargodha division, respectively (Figure 19). The historical trend of tube wells growth in Sindh shows a significant increase during 1998-1999 and 2012-2013 (Figure 20). This results from the prevalence of drought events and an increase in cropping intensity (Iqbal et al., 2020). The number of tubewells was about 5,000 in 1980 in Baluchistan and has increased to over 40,000 by 2015 (Figure 21). In addition to this, the area under fruit cultivation increased from 660 km 2 in 1992-93  "}]},{"head":"Groundwater governance in Pakistan","index":9,"paragraphs":[{"index":1,"size":98,"text":"In the 1980s, high groundwater table led to problems of soil salinization. This problem was addressed through energy subsidies and the import of Chinese-made pumps that promoted groundwater abstraction. Later with time, farmers started to observe a decline in quantity and quality of groundwater, especially in areas located in the tail end of canal command areas. Mostly in river basins, farmers preferred to use surface water due to quality and cost associated. With time as farmland for water-thirsty crops like sugarcane and rice increased, the shortfall between supply and water demand increased. Consequently, groundwater abstraction kept on growing."},{"index":2,"size":109,"text":"Groundwater rights ordinance was introduced in 1978, and a permit system was launched in 1980. Still, direct management of a large number of tube wells proved to be difficult due to an immense number of groundwater users spread over a huge area (Qureshi, 2020). The government also tried to control groundwater extraction through electricity prices by moving from a flat tariff system to an actual billing system and then to a combined flat and billing system. This failed to affect groundwater abstraction as only 15% of total tube wells are powered by electricity (Zoumides & Zachariadis, 2009). Many farmers shifted from using electric pumps to diesel pumps (Qureshi, 2020)."},{"index":3,"size":13,"text":"In 1997, the government of Pakistan established Provincial Irrigation and Drainage Authorities (PIDA)."},{"index":4,"size":27,"text":"PIDA aimed to empower farmers, improve efficiency and sustainability in agriculture. Along with the establishment of PIDA, PIDA Acts were enacted to define groundwater extraction rights, empower"},{"index":5,"size":43,"text":"Water User Association (WUAs), advocate demarcation of critical groundwater zones, licenses for tube well installation in water distressed areas, and regular monitoring of pumping for all tube wells (Qureshi, 2020). Water User Association (WUAs) were empowered to monitor groundwater in canal command areas."},{"index":6,"size":51,"text":"In addition to this, the provincial governments were made responsible for evaluating the conditions of aquifers and ensuring their sustainable management. Limited institutional capacity impeded the effectiveness of the bodies mentioned above and legislation. Governments allowed farmers to extract groundwater unchecked to ensure food security. Meanwhile, institutional capacity did not improve."}]},{"head":"Policies and legislations related to use of solar technology in agriculture","index":10,"paragraphs":[{"index":1,"size":15,"text":"Pakistan does not have a specific policy on solar technology for groundwater pumping in agriculture."},{"index":2,"size":13,"text":"However, Pakistan does have several policies that have a bearing on the same. "}]},{"head":"National Water Policy","index":11,"paragraphs":[{"index":1,"size":10,"text":"The main objective of this policy is given as under:"},{"index":2,"size":34,"text":"Lay down a broad policy framework and set of principles for water security. The Provincial Governments can formulate their respective Master Plans and projects for water conservation, water development, and water management (GOP, 2018)."},{"index":3,"size":100,"text":"The objectives of this national policy in terms of groundwater aim to regulate groundwater withdrawals for curbing over-abstraction and promote aquifer recharge. It also aims to develop hydropower to increase the share of renewable energy. National water policy sets its strategic priorities for renewable energy by recognizing the importance of the large, medium, and small dams generating energy and storing water for agriculture and domestic purposes. It also highlights that with appropriate policies and subsidies, additional water at a lower cost can be provided in areas with shallow groundwater by converting a large number of tube wells into solar energy."}]},{"head":"Schemes to promote SIPs","index":12,"paragraphs":[{"index":1,"size":55,"text":"The Government of Pakistan has introduced various schemes at the federal and provincial levels to promote the use of SIPs to bring down carbon emissions and reduce the oil import bill. A majority of these schemes have been initiated in the last five years. An overview of these schemes is presented in the following sub-sections."},{"index":2,"size":112,"text":"At the federal level, an interest-free Solar Tube well Financing Scheme was announced in 2015 but not actualized mainly due to a lack of evidence on the impact of SIPs on the sustainability of the groundwater aquifer. The Government of Pakistan has recently commissioned consultants to prove the effects of SIPs on groundwater sustainability. Under the scheme, the federal government would concur to cover mark-up costs on behalf of farmers. The interest-free loan scheme for small farmers (having landholding of up to 12.5 acres) for the installation of 30,000 solar-powered tube wells over a period of three years. Modalities of the scheme were finalized by the Ministry of National Food Security and"},{"index":3,"size":52,"text":"Research, the State Bank of Pakistan, and the Ministry of Finance. To simplify the lending process for agriculture financing, the banks also introduced a revised loan application as per directions of the State Bank of Pakistan, which is the regulator of Banks in Pakistan. Once finalized, the scheme will be implemented nationwide."},{"index":4,"size":17,"text":"At the provincial level, there are several development investments in solar technology for groundwater pumping in agriculture."},{"index":5,"size":301,"text":"The largest investment is in the Punjab Irrigated Agriculture Productivity Improvement Project (PIAPIP), which stimulates a High-Efficiency Irrigation System (HEIS) coupled with SIP through capital cost subsidies. The Agriculture Department of Punjab province sponsors this project through the World Bank (OFWM, 2020). Departments responsible for executing this project are the Punjab Irrigation Department, divisional and deputy directors of On-Farm Water Management, supply and service companies, project implementation supervision consultants, and participating farmers/water user associations. One of the 'project's main aims is to install High-Efficiency Irrigation System (HEIS) coupled with solar irrigation pumps on 120,000 acres by 2021. This project defined HEIS as a drip and/or sprinkler irrigation system. By 2016/17, installation of HEIS has been completed on 20,000 acres. The primary incentive to farmers considering this conversion was a 60% subsidy on total system cost for installation of HEIS. The responsibility of installing HEIS is to supply and service companies (SSCs) prequalified by the Agriculture Department. The same SSCs are responsible for carrying out surveys, preparing designs and cost estimates, installing HEIS, and providing post-installation backup support services. The district/ tehsil OFWM staff mobilizes the farmers to adopt HEIS as the first step in the implementation activities of HEIS. Then interested farmers have to submit their application for HEIS installation to the Deputy Director or Director Agriculture (OFWM) at any time of the year. After scrutinizing the application, eligible applicants are advised to approach pre-qualified SSC of their own choice for a survey, design, and cost estimation of the selected system. Then the selected SSC has to submit the report on the on-site survey, after approval from Deputy Director Agriculture (OFWM), accepting an offer from the farmer and providing proof of submission of the 40% total cost. Under this program, district-wise spread of SIPs across Punjab is shown in figure 23."},{"index":6,"size":37,"text":"The highest number of SIPs are installed in the Rawalpindi division, and the least number of SIPs installed are in the Bahawalpur division.  The Sindh government has launched 11 schemes to install solar-powered tube wells and pumping "}]},{"head":"Public and Private Stakeholders","index":13,"paragraphs":[{"index":1,"size":125,"text":"The primary stakeholder in the public domain is the Government of Pakistan (GoP), which has taken many incentives in its energy strategy to overcome the energy deficit. The introduction of the net metering scheme in September 2015 has been an encouraging sign. Net metering is a billing system that connects the solar system to the grid system. Excessive energy produced by the solar system during daylight hours can be fed to the grid above and beyond consumer demand. This will encourage consumers to install the solar system as net metering will provide additional income to the consumers and encourage consumers to save energy. Further steps have been taken to reduce bureaucratic procedures (i.e., red tape) in processing applications for the issuance of net metering licenses."},{"index":2,"size":33,"text":"Currently, the PV market is dominated by Chinese products.  Exploiting available solar energy for the agriculture sector will increase the country's productivity and food security and help in cleaner and sustainable food production."},{"index":3,"size":83,"text":"Farmers owning smallholdings suffer from reduced profit margins, partially due to rising fuel prices and high pumping costs. Even in electricity-powered tube wells, farmers face great difficulty due to loadshedding and the rapidly increasing cost of electricity. Given the much lower operating cost of solarpowered tube wells, a scheme for replacing diesel or electric tube wells with solar tube wells or installing new solar tube wells can therefore be financially attractive for farmers if the initial high capital cost can be subsidized appropriately."},{"index":4,"size":107,"text":"Most of the arid parts of Pakistan have no access to electricity and have the deepest water tables. The villagers and communities use expensive and dirty fuels such as diesel to pump water from depths of up to 400 feet. The per person and per animal consumption of water is alarmingly lower than the WHO prescribed levels, resulting in poor health and hygiene and lower quality of life, particularly for women responsible for water collection. The SPIS in such regions, apart from energy and water conservation, will also provide further benefits like increased health & hygiene through daily access to water (up to 7 hours a day)."}]},{"head":"SIP related challenges","index":14,"paragraphs":[{"index":1,"size":75,"text":"There are demand-side challenges to the adoption of SIPs. Solar-powered irrigation systems provide a promising alternative to diesel-powered tube wells, but their adoption at scale has faced many problems in Pakistan. Farmers cannot invest in solar due to high initial costs and low discharge capacities than diesel-powered pumps. More than 90% of the irrigation is carried out through flood irrigation, and so far, all the provincial governments have tried to promote solar through High-Efficiency Irrigation"},{"index":2,"size":66,"text":"Techniques. This is one of the primary reasons for the slow adoption rate as the farmers are not ready to shift from flood irrigation to HEIS techniques. As SIPs can only operate during sunlight hours, their operating hours are limited per day. This is also another reason farmers are a bit reluctant to use solar as this may potentially not irrigate their field through flood irrigation."},{"index":3,"size":62,"text":"There are supply-side challenges as well the primary concern amongst water professionals in Pakistan is that any conversion of diesel pumping to PV solar will result in indiscriminate pumping leading to further groundwater depletion. The apprehension is that with PVs, there are no financial (electricity costs) to constrain farmers from pumping, and hence the assumption is that farmers will increase their pumping."},{"index":4,"size":58,"text":"PCRWR has undertaken some studies and analysed daylight hours/solar irradiation to conclude that the actual solar energy available will constrain pumping. However, this knowledge has not been widely acknowledged/accepted. There is some criticism that pumping depends not only on energy availability but also on the installed capacity and farmer behaviour that has not been studied in any detail."},{"index":5,"size":51,"text":"Additional challenges include the lack of awareness about the quality of PV and the benefits of high-  , 2010). Moreover, many solar panels required for large-size and high discharge tube wells occupy more land area, which small farmers especially find difficult to spare. In addition, several maintenance issues may also emerge."}]},{"head":"Conclusion","index":15,"paragraphs":[{"index":1,"size":16,"text":"There is potential for solar irrigation in all four provinces and other administrative units of Pakistan."},{"index":2,"size":118,"text":"Scaling up SIPs can also meet clean energy targets and provide assured irrigation to the farmers, yet the threat of groundwater over-exploitation remains. The use of groundwater increases rapidly in the irrigation sector, and it has already surpassed surface water use. There is no legislation in Pakistan to restrict overexploitation of groundwater. Groundwater quality is also deteriorating due to the lateral movement of brackish water to the sweet water aquifers, threatening to make existing sweet water aquifers unusable. There is no licensing mechanism to restrict farmers and other groundwater users to dig tube wells. Farmers located at the tails of many distributaries and canals are exclusively dependent on groundwater for irrigation due to the non-availability of surface water."},{"index":3,"size":126,"text":"It is a big challenge to manage groundwater overexploitation in Pakistan and bring down the CO2 emissions due to the use of diesel pumps. Solar pumps provide an excellent opportunity to control the CO2 emissions problems but at the same time may end up further exacerbating the problem of groundwater exploitation. The Federal and Provincial Governments need to immediately develop proper plans to convert existing diesel-powered pumps to solar and restrict overexploitation of groundwater through systems that do not enable the farmers to increase the abstraction of groundwater. The government also needs to declare zones where they want to promote solar pumps and see the possibility of decoupling the solar pumps from the HEIS systems, which have not gained much traction in the past many years."},{"index":4,"size":108,"text":"The SDC-SoLAR project aims to generate rigorous evidence on the groundwater extraction behaviour of SIP farmers and feed that evidence into the ongoing discourse on SIPs and the risk of groundwater overexploitation. In addition, through an experiment with heat sinks and differential tariffs, the project aims to demonstrate changes in farmers pumping behaviour in response to potential incomes earned from selling electricity to the grid. Currently, solar pumps are only promoted in conjunction with HEIS, and farmers are often reluctant to implement HEIS due to its high costs. Therefore, the SDC-SoLAR project will train farmers through research partners to implement surface precision irrigation techniques at the farm level."}]}],"figures":[{"text":"Figure 1 : Figure 1: Number of tubewells in Pakistan (millions) and average annual growth in number of tube wells ...................................................................................................................................................................... 6 Figure 2: The percentage share of tube wells, by Province (2013/14) ......................................................... 6 Figure 3: Agricultural Land Irrigated by Tube wells (%) ................................................................................ 7 Figure 4: Groundwater quality from 0-50 m depth in the Upper Indus Plain .............................................. 8 Figure 5: Groundwater quality from 50-100 m depth in the Upper Indus Plain .......................................... 8 Figure 6: Average Depth to Water table variations in 2014 over UIPA (Punjab Irrigation Department, Lahore) .......................................................................................................................................................... 8 Figure 7: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2013 ............ 9 Figure 8: Monthly GWS variations over Upper Indus Plain during February, 2017 .................................... 10 Figure 9: Monthly GWS variations over Upper Indus Plain during March, 2017 ....................................... 11 Figure 10: Monthly GWS variations over Upper Indus Plain during April 2017 ......................................... 11 Figure 11: Mean Monthly GWS variations over Upper Indus Plain from February-April, 2017 ................ 12 Figure 12: Spatial variations in depth to water table in Canal Command Area of Sindh in 2014 (premonsoon) .................................................................................................................................................... 13 Figure 13: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2014 (postmonsoon) .................................................................................................................................................... 13 Figure 14: Groundwater quality from 0-50 m depth in the Upper Indus Plain .......................................... 15 Figure 15: Groundwater Quality at 0-25 m; Lower Indus Plain .................................................................. 16 Figure 16: Groundwater Quality at 26-50 m; Lower Indus Plain ................................................................ 16 Figure 17: The spread of groundwater irrigation in Pakistan ..................................................................... 17Figure 18: Growth of tube wells in Pakistan ............................................................................................... 18 Figure 19: Division-wise Electric/ Diesel Pump Tube-wells in Punjab ........................................................ 19 Figure 20:Temporal trend in tubewells growth from 1990-2014 in Sindh ................................................. 19 Figure 21:Increasing trend of tubewells in Baluchistan .............................................................................. 20 Figure 22:Slight increase in the number of tube wells in Khyber Pakhtunkhwa ........................................ 20 Figure 23:District-wise SIPs in Punjab ......................................................................................................... 24 "},{"text":"Figure 18 : Figure 1: Number of tubewells in Pakistan (millions) and average annual growth in number of tube wells ...................................................................................................................................................................... 6 Figure 2: The percentage share of tube wells, by Province (2013/14) ......................................................... 6 Figure 3: Agricultural Land Irrigated by Tube wells (%) ................................................................................ 7 Figure 4: Groundwater quality from 0-50 m depth in the Upper Indus Plain .............................................. 8 Figure 5: Groundwater quality from 50-100 m depth in the Upper Indus Plain .......................................... 8 Figure 6: Average Depth to Water table variations in 2014 over UIPA (Punjab Irrigation Department, Lahore) .......................................................................................................................................................... 8 Figure 7: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2013 ............ 9 Figure 8: Monthly GWS variations over Upper Indus Plain during February, 2017 .................................... 10 Figure 9: Monthly GWS variations over Upper Indus Plain during March, 2017 ....................................... 11 Figure 10: Monthly GWS variations over Upper Indus Plain during April 2017 ......................................... 11 Figure 11: Mean Monthly GWS variations over Upper Indus Plain from February-April, 2017 ................ 12 Figure 12: Spatial variations in depth to water table in Canal Command Area of Sindh in 2014 (premonsoon) .................................................................................................................................................... 13 Figure 13: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2014 (postmonsoon) .................................................................................................................................................... 13 Figure 14: Groundwater quality from 0-50 m depth in the Upper Indus Plain .......................................... 15 Figure 15: Groundwater Quality at 0-25 m; Lower Indus Plain .................................................................. 16 Figure 16: Groundwater Quality at 26-50 m; Lower Indus Plain ................................................................ 16 Figure 17: The spread of groundwater irrigation in Pakistan ..................................................................... 17Figure 18: Growth of tube wells in Pakistan ............................................................................................... 18 Figure 19: Division-wise Electric/ Diesel Pump Tube-wells in Punjab ........................................................ 19 Figure 20:Temporal trend in tubewells growth from 1990-2014 in Sindh ................................................. 19 Figure 21:Increasing trend of tubewells in Baluchistan .............................................................................. 20 Figure 22:Slight increase in the number of tube wells in Khyber Pakhtunkhwa ........................................ 20 Figure 23:District-wise SIPs in Punjab ......................................................................................................... 24 "},{"text":" Groundwater decline in areas of Baluchistan ............................................................................... 14 Table 2: Total solar pumps installed by the Govt. agency/institutions ...................................................... 25 Table 3: Total solar pumps installed by the Private companies & their authorized dealers ...................... 26 Table 4: Irradiation of four provinces of Pakistan ...................................................................................... 28 ix List of Abbreviations "},{"text":"Figure 1 : Figure 1: Number of tubewells in Pakistan (millions) and average annual growth in number of tube wells "},{"text":"Figure 2 :Figure 3 : Figure2: The percentage share of tube wells, byProvince (2013/14)     "},{"text":"Figure 4 : Figure 4: Groundwater quality from 0-50 m depth in the Upper Indus Plain Figure 5: Groundwater quality from 50-100 m depth in the Upper Indus Plain "},{"text":"Figure 6 : Figure 6: Average Depth to Water table variations in 2014 over UIPA (Punjab Irrigation Department, Lahore) Source: Khan et al., 2016 "},{"text":"Figure 7 : Figure 7: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2013 Source: Iqbal et al., 2020 Pakistan Council of Research in Water Resources used NASA GRACE Satellite data to produce maps of monthly groundwater changes in the Indus River Basin. In figures 8 to 10, Orange and yellow indicate areas where groundwater might be depleted, while blue and green highlight areas where groundwater is replenished. "},{"text":"Figure 8 : Figure 8: Monthly GWS variations over Upper Indus Plain during February, 2017 Source: http://www.pcrwr.gov.pk/ "},{"text":"Figure 11 : Figure 11: Mean Monthly GWS variations over Upper Indus Plain from February-April, 2017 Source: http://www.pcrwr.gov.pk/ "},{"text":"Figure 12 : Figure 12: Spatial variations in depth to water table in Canal Command Area of Sindh in 2014 (pre-monsoon) Source: Pcrwr.gov.pk. 2020. "},{"text":"Figure 13 : Figure 13: Spatial variations in depth to the water table in Canal Command Area of Sindh in 2014 (post-monsoon) Source: Pcrwr.gov.pk. 2020. "},{"text":"Figure 14 : Figure 14: Groundwater quality from 0-50 m depth in the Upper Indus Plain Source: Khan et al., 2016In Lower Indus Plain, the extent of groundwater salinity further increases and intensifies below Hyderabad towards the Indus Delta due to sea-water intrusion and the prevalence of more fine strata (loam and clay). The groundwater of usable quality is found in shallow pockets in parts of Kashmore, Shikarpur, Ghotki, Sukkur, Khairpur, Naushero Feroz and Shaheed Benazirabad. The extent and intensity of hydro-salinity further increase with depth (Figures15 and 16)(Iqbal et al., 2020). "},{"text":"Figure 15 : Figure 15: Groundwater Quality at 0-25 m; Lower Indus Plain Source: Iqbal et al., 2020 "},{"text":"Figure 17 : Figure 17: The spread of groundwater irrigation in Pakistan Source: https://www.researchgate.net/figure/The-spread-of-groundwater-irrigation-in-South-Asia_fig1_331907288 "},{"text":"Figure 18 : Figure 18: Growth of tube wells in Pakistan Source: GoP, 2016-17 Diesel pumps are mostly installed at shallow depths that range from 20 -40 feet. The average farm size where diesel-powered tube wells are installed is less than 12.5 acres and constitute almost 85% of the total. Current estimates state that diesel-powered tube wells contribute nearly 5.025 million metric tons of CO2 emissions annually (FAO, 2019). Solar-powered irrigation systems provide a promising alternative to diesel-powered tube wells, but their adoption at scale has faced many problems in Pakistan. "},{"text":"Figure 19 : Figure 19: Division-wise Electric/ Diesel Pump Tube-wells in Punjab Source: http://crs.agripunjab.gov.pk/system/files/Tubewell%202013-14.pdf "},{"text":"Figure 20 : Figure 20:Temporal trend in tubewells growth from 1990-2014 in Sindh Source: GOP (2018) "},{"text":" km 2 in 2012-13(MNFSR, 2014). Hence, the water requirement for raising orchards increased to 1.920 BCM, and most of it comes from groundwater(Ashraf and Sheikh, 2017). Improved communication network and introduction of electricity with subsidized flat rates in Baluchistan after the 1980s has resulted in a tremendous increase in the drilling of tube wells. All these developments have also affected the sustainability of groundwater resources. Despite the importance of groundwater in Baluchistan, no proper groundwater monitoring system exists to regulate its utilization. "},{"text":"Figure 21 : Figure 21:Increasing trend of tubewells in Baluchistan Source: PCRWR (2016) "},{"text":"Figure 23 : Figure 23:District-wise SIPs in Punjab Source: Pakistan Agricultural Research Council (PARC) Agency for Barani Areas Development (ABAD) has launched a project titled Promotion of Alternate Energy for Command Area development of Mini dams/Ponds in the Potohar region of Punjab province, covering Rawalpindi, Attock, Chakwal & Jhelum (OFWM, 2018). The s objectives included utilizing the available water resources for profitable agriculture (high-value crops) and maximizing the benefits of farmers by reducing the operational cost of pumping water through the provision of alternative sources of energy in a sustainable manner. The government has approved a program for installing 200 solar pumps in the Potohar region in 2016. Out of these, a total of 83 solar pumps have been installed by a government institution in different areas of Soan Basin, as shown in Table 2. Most of these solar pumps (70) have been installed by Agency for Barani Areas Development (ABAD). "},{"text":" stations as part of efforts to improve and strengthen the province's agriculture sector in 2017. Pakistan Rs. 802 million schemes for providing solar water pumps and tube wells on subsidized rates to farmers have been initiated, but the progress on this scheme is still unknown. Water Resources Development Sector Project (2018), which includes pilot testing of about 130 ha of high-value agriculture in the command area of Zhob and Mula rivers in Baluchistan, has been planned. It will involve the installation of approximately 160 cost-effective solar-powered drip irrigation systems, along with other initiatives.Several pilots have also been undertaken, mainly by the Pakistan Council of Research in WaterResources (PCRWR). However, these have primarily been as technology demonstration pilots, i.e., to show that the technology of PV, submersible DC pumps can work reliably and are suitable for applications in agriculture. In 2017, the Federal and Provincial governments agreed to replace the 30,000 grid-connected tube wells with solar-powered tube wells to decrease the recurring burden of subsidies on electricity on the government, but this project has still not materialized.The Directorate of Agricultural Engineering, Government of Khyber Pakhtunkhwa from 2015-16 is also giving incentives in the form of sharing 50% cost with farmers for the pumping machinery/solar pumps procurement and using them for irrigation purposes in rain-fed /water scarcity areas of the Province under the project Provision of Pumping Machinery for Productivity Enhancement in Khyber Pakhtunkhwa The project is ongoing and aims to help in increasing the water access with an increase of per acre yield of crops. Irrigation Department, Government of Khyber Pakhtunkhwa in 2016-17 started installing solar systems coupled with pumping systems at ten selected sites as a pilot project, and the Federally Administered Tribal Areas (FATA) and Directorate of Irrigation & Hydel Power are also implementing a project in converting all tube wells to solar technology. "},{"text":" quality products. The implementation and dissemination of quality standards for PV are expected to reduce price sensitivity and increase the procurement of high-quality PV products.The possibility of groundwater over-extraction by deploying stand-alone off-grid SIPs with zero marginal costs remains a real challenge. Concern about groundwater over-exploitation is also preventing Pakistan from scaling up its solar irrigation program. The PCRWR used NASA's Gravity Recovery and Climate Experiment (GRACE) satellites data to produce a map of monthly groundwater changes in the Indus River Basin. Based on the analysis conducted from January to March 2016, a depletion trend (drawdown) in groundwater storage appeared. Most parts of Bari, Rechna, Chaz, and Central Thal doab were under stress in March 2016 and need careful water management and planning (regulation of groundwater pumping). Users in this region can expect the reduction in Ground Water Storage (GWS) to decline further and deeper to pump groundwater. Costs of solar-powered pumping systems increase rapidly with an increase in pumping depth and discharge. For depths greater than 100 feet, the cost of solar tube wells increases significantly and becomes uneconomical. Almost 66 per cent of farmers have farm sizes under 25 acres (GOP "},{"text":"  "},{"text":"  "},{"text":" This report presents a synthesis of Pakistan's groundwater situation, including a proliferation of groundwater pumps since the 1980s. It also highlights the issues around renewable energy transition and describes how the SDC-SoLAR (Swiss Development Corporation-Solar Irrigation for Agricultural Resilience) project led by the International Water Management Institute (IWMI) aims to navigate these complex issues through its research activities.Pakistan has one of the largest contiguous irrigation systems in the world, called the Indus Basin Irrigation System (IBIS). In the 1980s, high groundwater table led to problems of soil salinization. This problem was addressed through energy subsidies and the import of Chinese manufactured pumps Executive Summary Executive Summary ABAD Agency for Barani Areas Development ABADAgency for Barani Areas Development AEDB Alternative Energy Development Board AEDBAlternative Energy Development Board BCM Billion cubic meters BCMBillion cubic meters CCA Canal Command Area CCACanal Command Area DTW Depth to Water DTWDepth to Water FAO Food & Agriculture Organization FAOFood & Agriculture Organization GWS Ground Water Storage GWSGround Water Storage HEIS Higher Efficiency Irrigation System HEISHigher Efficiency Irrigation System HEIS High Efficiency Irrigation System HEISHigh Efficiency Irrigation System IBIS Indus Basin Irrigation System IBISIndus Basin Irrigation System IWASRI International Waterlogging and Salinity Research Institute IWASRIInternational Waterlogging and Salinity Research Institute LIP Lower Indus Plain LIPLower Indus Plain MAF Million Acre Feet MAFMillion Acre Feet OFWM On Farm Water Management OFWMOn Farm Water Management PARC Pakistan Agriculture Research Council PARCPakistan Agriculture Research Council PCRWR Pakistan Council of Renewable Energy Technologies PCRWRPakistan Council of Renewable Energy Technologies PEC Pakistan Engineering Council PECPakistan Engineering Council PIPIP Punjab Irrigated-Agriculture Productivity Improvement Project PIPIPPunjab Irrigated-Agriculture Productivity Improvement Project PV Photo Voltaic PVPhoto Voltaic SIPs Solar Irrigation Pumps SIPsSolar Irrigation Pumps SPIS Solar Power Irrigation System SPISSolar Power Irrigation System SSCs Supply and Service Companies SSCsSupply and Service Companies UIPA Upper Indus Pain Aquifer UIPAUpper Indus Pain Aquifer ZTBL Zarai Taraqiati Bank Limited ZTBLZarai Taraqiati Bank Limited GoP Government of Pakistan GoPGovernment of Pakistan  "},{"text":" Each Province has embarked on different trajectories to deliver on the National Water Policy. All the provincial governments have planned and/or launched subsidized solar irrigation pump schemes, mostly coupled with High-Efficiency Irrigation Systems (HEIS), especially in Punjab and Sindh. Until now, only Punjab province has succeeded in implementing its program to some extent, whereas in Khyber Pakhtunkhwa and Sindh provinces, the programs are at pilot stages, while in Baluchistan, programs have not materialized at all. Many farmers have installed Solar Irrigation Pumps (SIP) through private investments. Currently, the Photo Voltaic (PV) market is dominated by Chinese products. The dominance of Chinese products is attributed to price competitiveness with similar products from western countries, extensive customer outreach through dealership networks, and the significant variation in product quality/pricing that caters to different economic classes of customers. There is a lack of awareness about the quality of PV  "},{"text":" table, giving rise to waterlogging and salinity in many areas. To solve this problem, the of groundwater aquifer in some areas and salinity in others (Basharat and Tariq 2014). Especially the of groundwater aquifer in some areas and salinity in others (Basharat and Tariq 2014). Especially the farmers at the tail end of the canals do not get sufficient canal water, so they have to rely solely on farmers at the tail end of the canals do not get sufficient canal water, so they have to rely solely on groundwater. The quality of groundwater is poor, which exacerbates the issue of salinity. s. Solar groundwater. The quality of groundwater is poor, which exacerbates the issue of salinity. s. Solar pumping technology has emerged as an alternative to diesel and electric pumps in the last few years. pumping technology has emerged as an alternative to diesel and electric pumps in the last few years. Still, water professionals in Pakistan are concerned that converting pumps to PV solar will result in Still, water professionals in Pakistan are concerned that converting pumps to PV solar will result in indiscriminate pumping and eventually lead to further groundwater depletion. indiscriminate pumping and eventually lead to further groundwater depletion. Solar-powered irrigation systems provide a promising alternative to diesel-powered tube wells, but Solar-powered irrigation systems provide a promising alternative to diesel-powered tube wells, but adopting this technology at scale has been fraught with many challenges in Pakistan. On the one hand, adopting this technology at scale has been fraught with many challenges in Pakistan. On the one hand, farmers cannot invest in solar due to high initial costs and the low discharge capacities of solar pumps farmers cannot invest in solar due to high initial costs and the low discharge capacities of solar pumps compared to diesel-powered pumps. Secondly, more than 90% of the irrigation in Pakistan is carried out compared to diesel-powered pumps. Secondly, more than 90% of the irrigation in Pakistan is carried out through flood irrigation and not with the piped flow of high-efficiency irrigation systems (HEIS). Despite through flood irrigation and not with the piped flow of high-efficiency irrigation systems (HEIS). Despite efforts by provincial governments to promote solar through HEIS, most farmers are not prepared to shift efforts by provincial governments to promote solar through HEIS, most farmers are not prepared to shift from flood irrigation to HEIS techniques. from flood irrigation to HEIS techniques. Replacing diesel pumps with solar irrigation pumps can significantly bring down CO2 emissions. Current Replacing diesel pumps with solar irrigation pumps can significantly bring down CO2 emissions. Current government launched the Salinity Control and Reclamation Project (SCARP) scheme in the canal irrigated government launched the Salinity Control and Reclamation Project (SCARP) scheme in the canal irrigated areas of Pakistan. Under this program, the government installed large-capacity tube wells to control the areas of Pakistan. Under this program, the government installed large-capacity tube wells to control the level of groundwater. During drought and surface water shortages of 1996-2001, the government gave level of groundwater. During drought and surface water shortages of 1996-2001, the government gave subsidies to farmers for groundwater pumping, which led to an increase in groundwater abstraction. subsidies to farmers for groundwater pumping, which led to an increase in groundwater abstraction. During the 35 years from 1976 to 2012, groundwater contribution in agriculture increased many folds During the 35 years from 1976 to 2012, groundwater contribution in agriculture increased many folds from 31.6 BCMs to 59.95 BCM (FODP, 2012). The development of large dams stopped since 1976, so the from 31.6 BCMs to 59.95 BCM (FODP, 2012). The development of large dams stopped since 1976, so the agricultural growth and intensification were driven mainly by tube wells rapid expansion. Across the agricultural growth and intensification were driven mainly by tube wells rapid expansion. Across the country, there are approximately 1.3 million tube wells, of which 83% are diesel-powered; most of these country, there are approximately 1.3 million tube wells, of which 83% are diesel-powered; most of these tube wells are installed at shallow depths, between 12-18 meters. In the recent past, the growth of tube wells are installed at shallow depths, between 12-18 meters. In the recent past, the growth of electricity tube wells has slowed down due to a rise in the electricity tariff and power outages. Though electricity tube wells has slowed down due to a rise in the electricity tariff and power outages. Though tube wells provided drought resilience and increased cultivated area, it has decreased groundwater tube wells provided drought resilience and increased cultivated area, it has decreased groundwater table since 1989. It has caused an upward movement of saline water. Despite intense groundwater use, table since 1989. It has caused an upward movement of saline water. Despite intense groundwater use, agricultural productivity remains low in Pakistan, i.e., wheat production is 1.08 kg/m 3 in Pakistani agricultural productivity remains low in Pakistan, i.e., wheat production is 1.08 kg/m 3 in Pakistani Punjab, compared to 1.42 kg/m 3 in Indian Punjab. Punjab, compared to 1.42 kg/m 3 in Indian Punjab. Although extensive groundwater use has protected against drought and addressed the problem of Although extensive groundwater use has protected against drought and addressed the problem of waterlogging and increased cropping intensity, over-abstraction of groundwater has led to the depletion waterlogging and increased cropping intensity, over-abstraction of groundwater has led to the depletion  "},{"text":"Table 1 : Groundwater decline in areas of Baluchistan Source Period Average Decline in Water Level (m) PeriodAverage Decline in Water Level (m)  "},{"text":": Ashraf and Sheikh (2017)   "},{"text":" The National Water Policy makes some references to groundwater pumping. Water use efficiency, conservation, and renewable energy are among the strategic priorities and planning principles embedded in the National Water Policy. According to the Annual Plan (2020/21), the Pakistan Council for Renewable Energy Technologies (PCRET) will promote low-cost and sustainable energy solutions with renewable resources. Moreover, a Testing Facility is planned to be established for Solar & Allied Equipment with the collaboration of Korea to ensure quality standards in renewable energy products available in the market.There is also the Policy for Development of Renewable Energy for Power Generation. Given that Pakistan is a federation of four provinces and three administrative units (Gilgit-Baltistan, Azad Jammu and Kashmir, Islamabad Capital Territories), much of the governance and management of water resources devolved are to provinces, wherein each province has embarked on different trajectories to deliver on the National Water Policy. For example, the Province of Khyber Pakhtunkhwa is developing an integrated water resources management plan. In the Agricultural Policy of Khyber Pakhtunkhwa (2015-2025), the importance of adopting alternative energy sources such as solar energy for utilizing at the farm level to improve 'farmers' access to irrigation water has been mentioned. On the other hand,  "},{"text":"Private Companies / Authorized Dealers No. Of Installed Pumps Table3presents the list of companies and the number of solar pumps they have installed in the area. Pak Agro Tech has installed 100 solar pumps, by far the most solar pumps installed by any other private company active in the Soan Basin. Solar Sigma Ltd. 03 Solar Sigma Ltd.03 Miscellaneous. 25 Miscellaneous.25 Total Installed Pumps 374 Total Installed Pumps374 Pak Agro. Tech. 100 Pak Agro. Tech.100 Nizam Energy. 52 Nizam Energy.52 Green Line Technologies. 38 Green Line Technologies.38 MAK Pumps. 25 MAK Pumps.25 ATS Engineering. 25 ATS Engineering.25 Catkin Engg. Sales & Services. 13 Catkin Engg. Sales & Services.13 Authorized dealers of Catkin. 50 Authorized dealers of Catkin.50 Mansha Brother 20 Mansha Brother20 Solar Well. 08 Solar Well.08 ZEUS Energy Pvt. Limited. 06 ZEUS Energy Pvt. Limited.06 A.R. Brother. 05 A.R. Brother.05 Sharif International. 04 Sharif International.04  "},{"text":"Table 3 : Total solar pumps installed by the Private companies & their authorized dealersSource:  "},{"text":"Pakistan Agricultural Research Council (PARC)   "},{"text":" The dominance of Chinese products is attributed to price competitiveness with similar products from other countries, extensive customer outreach through dealership networks, and the large variation in product quality/pricing that caters to different economic classes of customers. The Federal Board of Revenue's (FBR) role is vital in ensuring that all imported solar equipment into the country complies with the recently approved quality import standards for Solar PV equipment.Multiple departments have developed and enlisted the Solar PV providers as per their criteria. The Alternative Energy Development Board (AEDB) was established as an autonomous body to promote and facilitate the exploitation of renewable energy projects in Pakistan. AEDB has provisionally approved 52 companies so far under AEDB Certification Regulation 2017 for Certification of Vendors/Installers/Service Providers to install Wind and Solar PV systems for net metering. Similarly, vital research areas in various projects. In all its projects, the main focus has remained on using SPIS in integration with other water conservation techniques rather than applying only SPIS techniques.Pakistan Agricultural Research Council (PARC) is the apex national organization working in close collaboration with other federal and provincial institutions in the country to provide science-based solutions to the agriculture of Pakistan through its statutory functions. PARC has demonstrated a solar-Pakistan has a vast PV potential, and all the necessary conditions for its implementation are-high radiation yield, a regulatory framework, and financing instruments that support its development. In terms of solar irradiation, it has been estimated that, on average, about 3000 sunlight hours are available in Pakistan each year, which can produce 5-7 kWh/m 2 of solar energy. The monthly average solar irradiation of capital cities of four provinces of Pakistan is given in table 4 below. Zarai Taraqiati Bank Limited (ZTBL) is the premier financial institution to develop the agriculture sector by providing financial services and technical know-how. ZTBL has also enlisted 56 companies, including PV solution providers and irrigation appliance providers. Pakistan Engineering Council (PEC) has also registered 262 Solar PV solution providers and 162 solar pump providers. Registration with PEC is one of the primary conditions for solar solution provider companies to participate in the respective irrigation department tenders. However, for net-metering cases on solar-powered irrigation systems, which are available only for 3 phase connection holders, registration with the Alternative Energy Development Board (AEDB) is the main prerequisite. PCRWR is an apex body with a mandate to conduct, organize, coordinate and promote research on all aspects of water resources, including irrigation (surface and groundwater), drainage, soil reclamation, drinking water, wastewater management, etc. PCRWR has employed solar power harnessing technology pumping systems have been designed to potentially utilize the pumped water through different high-efficiency irrigation systems (HEIS) to develop high-value agriculture. At Provincial levels, the On-Farm Water Management (OFWM) program of the Agriculture Department of Punjab aims to maximize crop and water productivity by ensuring efficient conveyance, application, and irrigation water viz-a-viz promoting improved water management interventions through user participation. 5. SIP related Challenges and Opportunities 5.1 SIP related Opportunities Capital of Provinces Irradiation (Am) KWb/m 2 Irradiation (Max) KWh/mV Lahore 2.8 6.27 Peshawar 2.4 6.35 Karachi 3.4 6.31 in all its powered irrigation system on pilot scales at Fatehjang, Chakwal, Faisalabad, and Karachi. These solar-Quetta 3.6 7.65 Zarai Taraqiati Bank Limited (ZTBL) is the premier financial institution to develop the agriculture sector by providing financial services and technical know-how. ZTBL has also enlisted 56 companies, including PV solution providers and irrigation appliance providers. Pakistan Engineering Council (PEC) has also registered 262 Solar PV solution providers and 162 solar pump providers. Registration with PEC is one of the primary conditions for solar solution provider companies to participate in the respective irrigation department tenders. However, for net-metering cases on solar-powered irrigation systems, which are available only for 3 phase connection holders, registration with the Alternative Energy Development Board (AEDB) is the main prerequisite. PCRWR is an apex body with a mandate to conduct, organize, coordinate and promote research on all aspects of water resources, including irrigation (surface and groundwater), drainage, soil reclamation, drinking water, wastewater management, etc. PCRWR has employed solar power harnessing technology pumping systems have been designed to potentially utilize the pumped water through different high-efficiency irrigation systems (HEIS) to develop high-value agriculture. At Provincial levels, the On-Farm Water Management (OFWM) program of the Agriculture Department of Punjab aims to maximize crop and water productivity by ensuring efficient conveyance, application, and irrigation water viz-a-viz promoting improved water management interventions through user participation. 5. SIP related Challenges and Opportunities 5.1 SIP related Opportunities Capital of Provinces Irradiation (Am) KWb/m 2 Irradiation (Max) KWh/mV Lahore 2.8 6.27 Peshawar 2.4 6.35 Karachi 3.4 6.31 in all its powered irrigation system on pilot scales at Fatehjang, Chakwal, Faisalabad, and Karachi. These solar-Quetta 3.6 7.65  "},{"text":"Table 4 : Irradiation of four provinces of Pakistan Source  "},{"text":": Muhammad et al., (2017)   "}],"sieverID":"188c9ecf-32e7-49bc-85a9-7347cdfabaaa","abstract":"Solar Irrigation for Agricultural Resilience (SoLAR) in South Asia aims to sustainably manage the waterenergy and climate interlinkages in South Asia through the promotion of solar irrigation pumps (SIPs). The main goal of the project is to contribute to climate-resilient, gender-equitable, and socially inclusive agrarian livelihoods in Bangladesh, India, Nepal and Pakistan by supporting government efforts to promote solar irrigation. This project responds to government commitments to transition to clean energy pathways in agriculture. All countries in this project have NDC commitments to reduce greenhouse gas (GHG) emissions and SIPs can play a significant role in reducing emissions in agriculture."}

data/part_1/028fddc234e2847369e0205509aec6f4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"028fddc234e2847369e0205509aec6f4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/959e9a84-ef7c-4972-a293-5ea8ecfc48bd/retrieve"},"pageCount":6,"title":"Design climate-smart agricultural interventions to be gender inclusive","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":156,"text":"To achieve the dual goal of wide-ranging adoption of CSA practices and gender equity, projects should include gender in their planning and throughout the project cycle. For example, our work in northern Uganda shows that the adoption of improved beans, maize, and sorghum has not been as high as expected; while women pay for fertilizers to boost productivity, men sell the harvests and decide how to spend the income. Therefore, although improved beans, maize, and sorghum are successful technologies to improve food security, they are less likely to be adopted because the motivation of the people who grow them -in this case, women -is low. This highlights the importance of having a discussion at the initial stages of the project when introducing the improved technologies so that such gender considerations are identified at the start of the project cycle, and measures can be taken to benefit both men and women and increase rates of technology adoption."}]},{"head":"What?","index":2,"paragraphs":[{"index":1,"size":9,"text":"Design climate-smart agricultural interventions to be gender inclusive p2"},{"index":2,"size":84,"text":"Research suggests that considering the needs of both men and women when identifying CSA practices will increase the likelihood of their adoption. In addition, discussions related to gender equality may decrease gender tensions within the community in the long term, leading to long-term joint empowerment and investment in well-being, while also contributing to the establishment of more diverse, resilient farm systems. When project interventions consider the needs of women, their participation in the project is usually increased, making joint decision-making easier in the future."}]},{"head":"Why?","index":3,"paragraphs":[{"index":1,"size":1,"text":"How?"},{"index":2,"size":50,"text":"Rapid appraisals that include CSA should be carried out in a sex-disaggregated way, separating men and women into focus group discussions to understand gendered constraints and opportunities. Both women's and men's priorities and considerations should be accounted for and farmer evaluations should include the perceptions of both men and women."}]},{"head":"CSA appraisals","index":4,"paragraphs":[{"index":1,"size":20,"text":"Addressing gender constraints and opportunities throughout the project cycle makes a CSA intervention more likely to be adopted at scale."}]},{"head":"Outcome","index":5,"paragraphs":[{"index":1,"size":29,"text":"The planned activities should include women as well as men in all discussions and surveys. Demonstration sites should include trials of both women's and men's preferred practices and crops."},{"index":2,"size":34,"text":"Involving men for women's empowerment is critical. Gender norms will not change in isolation. Men must be involved and see the value of women's active participation in projects and control of benefits and resources."},{"index":3,"size":35,"text":"Interventions should not address agriculture productivity alone. If perceptions of both men and women of a specific intervention are not considered, it can create food security issues at household level and increase tension between spouses."},{"index":4,"size":29,"text":"The implications of interventions should be considered for both men and women: how they use their time, their tasks, and what benefits they might receive and control in return."},{"index":5,"size":33,"text":"True joint decision-making processes involve egalitarian decision making, rather than shifting responsibility from one person to another. This process can result in increased investments in agriculture, and improved food security and on-farm resilience."},{"index":6,"size":24,"text":"2 Gender integration at project planning and implementation phases Data on the participation of men and women should be collected throughout the project cycle."},{"index":7,"size":28,"text":"Project implementers should record and use both women's and men's perceptions and evaluations of the project. Interventions should consider gendered constraints and opportunities, adapting the project as needed."},{"index":8,"size":29,"text":"During implementation, monitoring and evaluation feedback should be collected from both men and women, with the data analyzed and reviewed by project implementers for adapting the project as needed."}]},{"head":"Monitoring and evaluation","index":6,"paragraphs":[{"index":1,"size":43,"text":"Consider women's and men's roles and responsibilities on the farm and household domestic activities. Resources available between both sexes -including their access and control over the resources and benefits derived from them -and how they currently participate in decision making should be discussed."},{"index":2,"size":62,"text":"How the interventions proposed may promote or discourage women's participation in decision-making processes should also be considered. This approach can affect gender equality and development goals. For example, by encouraging women to participate in meetings, the whole community can share their vision of success and build trust; it can benefit from joint investments in iron roofs for houses, school fees, and food."},{"index":3,"size":34,"text":"Give men and women in communities a platform for voicing their concerns, for example about how they might be constrained from actively participating in certain activities during particular seasons when they might be busier."}]}],"figures":[{"text":"  "},{"text":"  "}],"sieverID":"b80e5857-0418-43a8-9f8d-03662b7b5540","abstract":"Research suggests that gender equity is a critical factor in the adoption of climate-smart agricultural (CSA) practices."}

data/part_1/02990022bb74a19d230c5e26bccc6ae5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02990022bb74a19d230c5e26bccc6ae5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5d35e5d3-e7ab-46bc-bf73-0d47db5ee942/retrieve"},"pageCount":2,"title":"Community Innovations Fund(CIF) for CSA","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"Description of Stage reached  New Innovation: No  New Innovation: No Stage of innovation: Stage 3: available/ ready for uptake (AV) Innovation type: Social Science Stage of innovation: Stage 3: available/ ready for uptake (AV)Innovation type: Social Science Geographic Scope: Multi-national Number of individual improved lines/varieties: <Not Applicable> Geographic Scope: Multi-nationalNumber of individual improved lines/varieties: <Not Applicable> Country(ies):  Country(ies): • The Socialist Republic of Viet Nam  • The Socialist Republic of Viet Nam • Cambodia  • Cambodia • Philippines  • Philippines  "},{"text":"Name of lead organization/entity to take innovation to this stage: <Not Defined> Names of top five contributing organizations/entities to this stage: designing climate risk management tools and advisory services in gender-focused value chains in five focus countries; surveys and other M&E tools seek to understand impact and learn lessons • ICRAF -World Agroforestry Centre • ICRAF -World Agroforestry Centre • ADB -Asian Development Bank • ADB -Asian Development Bank • Municipal Government of Guinayangan (Philippines) • Municipal Government of Guinayangan (Philippines) • DA -Department of Agriculture (Philippines) • DA -Department of Agriculture (Philippines) • CEDAC -Cambodian Centre for Study and Development in Agriculture • CEDAC -Cambodian Centre for Study and Development in Agriculture Milestones: Milestones: • Development organizations, private sector and sub-national initiatives testing CSA interventions • Development organizations, private sector and sub-national initiatives testing CSA interventions and co- and co-  "}],"sieverID":"fb3fc0e1-e571-4924-bd3a-1fcff1ae43ee","abstract":"P1596 -Gender sensitive CSA options trialed and tested in CSVs, and business case development for scaling Description of the innovation: CIF, adopted from PROLINNOVA, is a support system provided to learning groups or individuals in order to catalyze and support knowledge generation on practices and strategies for addressing location-location specific climate change issues. It is also a guarantee system for farmers for continued benefits from their farm despite utilizing it for experimentation and learning."}

data/part_1/02ab057246d4d98115d7f9682b9331bb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02ab057246d4d98115d7f9682b9331bb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/aaf83b05-c9cc-460d-9cdb-cf2fc2a892a4/retrieve"},"pageCount":1,"title":"Study #3730 Contributing Projects: • P343 -Policy engagement to build awareness of opportunities for mitigating and controlling aflatoxins in informal markets","keywords":[],"chapters":[],"figures":[],"sieverID":"97db42fb-04a2-4a8b-8e39-5ffd0afa3b1e","abstract":""}

data/part_1/02f828684ced800b0a5214326af5db58.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02f828684ced800b0a5214326af5db58","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2e7184f3-de18-42f8-ae85-14f43d09b40f/retrieve"},"pageCount":5,"title":"Agricultural development networks in 14 research sites Findings from the CCAFS Organizational Baseline Survey","keywords":[],"chapters":[{"head":"Overview of the OBS Network Data","index":1,"paragraphs":[{"index":1,"size":24,"text":"From 2010-2011, CCAFS research teams worked with local research partners in each of the following 14 study sites to collect data for the OBS:"},{"index":2,"size":15,"text":"◼ East Africa: Makueni and Nyando, Kenya; Rakai and Hoima, Uganda; Lushoto, Tanzania; Borana, Ethiopia;"},{"index":3,"size":11,"text":"◼ West Africa: Lawra-Jirapa, Ghana; Segou, Mali; Kollo, Niger; Kaffrine, Senegal;"},{"index":4,"size":11,"text":"◼ South Asia: Bagerhat, Bangladesh; Karnal and Vaishali, India; Rupandehi, Nepal."},{"index":5,"size":125,"text":"Village focus groups in each site created a list of the most important organizations working on agriculture, food security and climate change in their region, including government entities, non-governmental organizations and private sector companies. Across all 14 sites, 145 organizations in total were nominated, and each of these were surveyed to gather information on what types of climate change, food security and agriculture projects they carried out and how they partnered with other organizations working on similar projects. We leverage this data on partnerships and use social network analysis to map how all of the organizations in a site are related and what types of organizations tend to act as central partners connecting everyone, versus organizations that are isolated and have few to no partnerships."}]},{"head":"Figure 1. Map of OBS sites with organizational networks","index":2,"paragraphs":[{"index":1,"size":10,"text":"What are agriculture development networks and why do they matter? "}]},{"head":"Result 1: Characterizing network structures across 14 research sites","index":3,"paragraphs":[{"index":1,"size":315,"text":"The agricultural development networks from each site are visualized and grouped by type, using natural break points in the network density, centrality and fragmentation statistics (Figure 2). We found clear evidence for shared (high density, low centrality) and brokered (low density, high centrality) network structures, and a surprisingly high number of fragmented (many isolated actors) networks. Five sites were classified as shared structures, four sites as brokered, and five sites as fragmented structures. We were interested in understanding why the fragmented structures were just as common as the others, and what the research teams found in these sites. The East Africa research team noted \"…a weak link between most organizations and the ward extension workers from the district council. This was confirmed by the fact that the majority of them [organization representatives] were not aware, apart from hearing here and there from few farmers, who are involved in the specific activity.\" To better understand why different network types exist, we need more measures of network structure over as many communities and time periods as possible. Thus, this work is being extended in the CCAFS mid-line surveys currently underway, to follow up on these networks and understand if and how they have changed over time. To better understand the functional differences between fragmented, brokered and shared networks, it is critical for future research collecting network data to also measure network outcomes, so that we directly assess the effectiveness of different network structures for reaching specific goals. We can then compare the efficacy of organizations' activities in sites where networks are well connected (i.e. shared or brokered networks), compared to sites where organizational networks are highly disconnected (i.e. fragmented networks). Our next steps are to begin testing the effects of network connectivity and coordination on outcome variables collected by CCAFS at household and village levels, such as household food security and other indicators of climate analysis resilience."}]},{"head":"What roles do local and international organizations play in these networks?","index":4,"paragraphs":[{"index":1,"size":115,"text":"Understanding leadership in networks is critical to assessing both the potential efficacy of the network structure and how various actors carry power and influence over others working in the site. Organizations that are local, embedded within the community and provide their own services are predicted to fill leadership positions in networks with many actors that have greater differences in their goals, approaches and/or resources, and where greater social capital is needed to build cohesion across actors. External organizations (i.e. international NGOs, or INGOs), entering the community from the outside, are predicted to be found as leaders in complex circumstances, when the cost of coordination is high and access to resources is essential to effective coordination."},{"index":2,"size":197,"text":"Organizational networks in developing contexts became popularized in the 1990s when the World Bank recognized the importance of non-state actors and social capital as key policy tools that could provide public services and build local capacity when state governments neglect these responsibilities. At the heart of this debate is the distinction between importing capacity and resources of INGOs into under-resourced communities, versus relying on the local knowledge and potential legitimacy of domestic organizations. Some literature has suggested that in acute humanitarian response networks, INGOs have been found to be effective network leaders because of their ability to provide and distribute needed resources that were otherwise unavailable. In initiatives working to address long-run development challenges however, emphasis has been placed on capacity-building among local governments and organizations that already hold familiarity among their communities. For example, \"islands of sustainability\" can be achieved when local organizations take a leadership role in agricultural networks and empower rural smallholders by distributing technology and negotiating on their behalf with more powerful state and international actors for access to loans, financing and markets. Thus, the influence of local social capital can play a critical role in establishing legitimate leadership in local development projects."}]},{"head":"Result 2: Local organizations and international NGOs in networks","index":5,"paragraphs":[{"index":1,"size":212,"text":"To assess what roles various types of organizations play in their networks, we identified the organization type of each site's most central actor (i.e. greatest number of partnerships) and compared the average number of partnerships of organizations working at local, regional, national, and international scales. We found the most central nodes in all four brokered network sites were local or regional governments, indicating that local network leadership is more common in brokered networks. In three out of five shared sites, the most central nodes were local governments or local NGOs, again indicating higher likelihood of local network leadership in shared sites. Despite the local/regional scale actors filling the most central positions in brokered and shared governance networks, international NGOs had a slightly higher average number of partnerships across all sites. This can be explained by considering that INGOs were present in only one of the fragmented networks, whereas local and regional organizations comprised most of the actors in fragmented sites. In shared network sites, local/regional actors and INGOs had comparable numbers of partnerships, reflecting greater connectedness overall and greater coordination across actors at different scales. In brokered network sites, INGOs had fewer partnerships on average than local/regional scale organizations, likely because these local/regional organizations were most frequently occupying the most central positions."},{"index":2,"size":167,"text":"We also evaluated if the presence of an INGO in a site influenced overall network connectivity. We found a positive correlation between the density of partnerships in a network and the percentage of INGOs in a site, suggesting INGOs contribute to increased network connectivity. The average percentage of INGO actors in fragmented networks (5%) was significantly lower than that in brokered (18%) or shared (25%) networks. In fact, only one out of five fragmented network sites (Kollo, Niger) had any INGO presence at all, again providing support for the positive effect INGOs have on overall network connectivity. When looking at the effect of longevity of INGO presence in a site, we also found a positive correlation between overall partnership density in the network and the average number of years an INGO was in a site. However, between brokered and shared networks, we found little difference in the average time INGOs had been present: an average of 20 years in brokered and 17 years in shared network sites."}]},{"head":"Conclusions and policy implications","index":6,"paragraphs":[{"index":1,"size":78,"text":"This project uses the CCAFS OBS data to characterize and explore how agricultural development networks vary across region and place. Our analysis provides insight on the structure and composition of inter-organizational collaboration in CCAFS sites, where organizations aim to work together effectively and efficiently within local communities to build climate and agricultural resilience and food security. We draw two findings that we believe can help inform collaborative approaches to building community resilience in the face of climate change."},{"index":2,"size":59,"text":"First, the structures of partnership networks can vary quite greatly, from hierarchically-organized brokered networks, to densely connected shared networks, to very low partnership fragmented networks. Each of these network configurations may have implications on how climate change resilience and agricultural development efforts are implemented and coordinated across the group of public and private organizations working within a given site."},{"index":3,"size":107,"text":"Second, we found that local and regional organizations (both government and NGO actors) most often fill central leadership roles in networks with greater connectivity. This suggests these local and regional entities are necessary partners to involve in any new effort aiming to enter a community, as they hold the key to effectively coordinating on the ground work. At the same time, INGOs play an important role in increasing connectivity across a site, specifically by partnering with different local/regional organizations (rather than with other INGOs). These localinternational partnerships appear crucial to both gaining local trust and excitement for an initiative, as well as leveraging external resources and connections."},{"index":4,"size":70,"text":"Finally, through this work, we also learned the necessity of collecting network data on the \"periphery\" organizations (i.e. community-based groups, farmer cooperatives, informal support networks in a community) who may be outside of the formalized, key actors, yet still provide critical connectivity between organizations via personal relationships, or who may be key links between community residents and organizations' efforts. This indicates a key next step in studying agricultural development networks."}]}],"figures":[{"text":"Figure 2 . Figure 2. All 3 network types are observed across 14 CCAFS sites. "},{"text":"  "},{"text":"  "},{"text":" actors are required to be on board. Finally, fragmented networks may indicate an independence and autonomy among actors, potentially even signaling efficient distribution of responsibilities and activities. Conversely, the fragmentation and isolation may also signal a lack of coordination among actors or across initiatives, such that every organization is working separately and efforts have reduced efficacy due to lack of access to resources of information. This research focuses on mapping the organizational networks that are present in the CCAFS sites and uses relevant characteristics to understand what network types actually exist in agricultural development contexts. Here, we do not assess the effectiveness of the different network types, rather we suggest it is an important first step to understand if and how each of the network types exist. Collaborative governance efforts involving multiple state Collaborative governance efforts involving multiple state and non-state actors have grown in their importance for and non-state actors have grown in their importance for addressing complex social and economic development addressing complex social and economic development challenges. Understanding which actors are involved, what challenges. Understanding which actors are involved, what resources they bring into the collaborative network, and resources they bring into the collaborative network, and how they engage with one another are critical to how they engage with one another are critical to understanding the potential for networks to be effective in understanding the potential for networks to be effective in solving the problem at hand. In the contexts of food solving the problem at hand. In the contexts of food security and agricultural adaptation to climate change, security and agricultural adaptation to climate change, collaborative governance networks have gained attention collaborative governance networks have gained attention for their potential to leverage social capital, motivate for their potential to leverage social capital, motivate coordination in crisis-response periods, and build coordination in crisis-response periods, and build community resilience. community resilience. Organizational networks vary in their size, structure, Organizational networks vary in their size, structure, connectivity and centralization. Generally, networks can be connectivity and centralization. Generally, networks can be classified into the following broad types: classified into the following broad types: ◼ Brokered networks: highly centralized, hierarchical ◼ Brokered networks: highly centralized, hierarchical networks where a single actor sits between all, or networks where a single actor sits between all, or nearly all, other actors, acting as a key partner in the nearly all, other actors, acting as a key partner in the majority of network activities. The central actor majority of network activities. The central actor brokering these exchanges can be brokering these exchanges can be external to the community, or a lead external to the community, or a lead organization that is embedded within organization that is embedded within the community. the community. ◼ Shared networks: decentralized networks with high ◼ Shared networks: decentralized networks with high density of connections between almost all of the density of connections between almost all of the organizations. Responsibility for network organizations. Responsibility for network activities can be shared across many activities can be shared across many organizations, and there is no single organizations, and there is no single organization coordinating everyone. organization coordinating everyone. ◼ Fragmented networks: many isolated actors that ◼ Fragmented networks: many isolated actors that have few to no partnerships with other organizations. have few to no partnerships with other organizations. These networks have relatively low These networks have relatively low coordination between the efforts led by coordination between the efforts led by organizations acting independently from organizations acting independently from one another. one another. These different network types may have different These different network types may have different implications as to how climate change and implications as to how climate change and agricultural development activities are carried out by agricultural development activities are carried out by the organizations in a site. Brokered networks, for the organizations in a site. Brokered networks, for instance, may reduce the costs of collaborative instance, may reduce the costs of collaborative decision-making, implementing top-down decisions decision-making, implementing top-down decisions and enabling faster and more coordinated project and enabling faster and more coordinated project implementation, which may be particularly important implementation, which may be particularly important in crisis response times. However, brokered in crisis response times. However, brokered networks depend heavily on the capacity and networks depend heavily on the capacity and intentions of the central actor, who has more political intentions of the central actor, who has more political power than others. Shared networks, on the other power than others. Shared networks, on the other hand, rely on many trust-based, reciprocal hand, rely on many trust-based, reciprocal  "}],"sieverID":"23539435-5704-4b5a-80c3-852e532f3ad9","abstract":"Food security and agricultural development require coordination from cross-scale public and private organizations that provide resources and support to smallholder farming communities.◼ Based on network analysis of the data, we find three distinct types of agricultural development networks: highly centralized brokered networks, densely connected shared networks, and disjointed fragmented networks.◼ Leadership roles vary within networks: the presence of external organizations, such as international NGOs, increase overall coordination and capacity building, but local organizations are the most well-connected actors.This brief summarizes findings from a network analysis using data from the CCAFS Organizational Baseline Surveys (OBS) to analyze how organizations in CCAFS sites coordinate to work together on climate change and agriculture initiatives. The work was undertaken by a collaborative team of researchers at University of California Davis, University of Vermont, and CCAFS research staff. The study utilizes OBS data from 14 countries in West Africa, East Africa and South Asia and focuses on understanding the structures of partnership networks across different sites and what types of organizations fill specific roles in these networks (Figure 1)."}

data/part_1/03ba67a7a3fa4f45f5282c00fa6bff3e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03ba67a7a3fa4f45f5282c00fa6bff3e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e82b958b-1a3e-421b-ac98-e6cd6375102f/retrieve"},"pageCount":7,"title":"Study #3338 Contributing Projects:<Not Defined>","keywords":[],"chapters":[{"head":"Links to any communications materials relating to this outcome:","index":1,"paragraphs":[{"index":1,"size":73,"text":"• https://www.ifpri.org/publication/2019-global-food-policy-report • https://tinyurl.com/y78253wt ), this framework demonstrates that restoring and improving the natural environment is a key component of rural revitalization, essential not only to improve rural living conditions but also to restore the health of the planet (2). This framework also underpinned the collective WLE contribution to IPBES regional and global reports arguing that IPBES needed to pay much more attention to the critical dependency of food on ecosystem services (3,(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)."},{"index":2,"size":60,"text":"Even more importantly, the WLE ESR framework (1,6) was the foundation of a proposal to IPBES that its first nexus assessment should focus on food. In May 2019, governments from the 134 IPBES countries announced that the first IPBES Nexus Assessment would focus on Biodiversity, Food, Health and Water, drawing heavily on the proposal submitted by WLE/Bioversity and EAT (20)(21)."},{"index":3,"size":148,"text":"This outcome positions WLE as a core contributor to IPBES and its policy processes. This was only possibly through the collective contributions of the WLE partners in developing the integrative ESR Framework, and the constant presence of WLE/Bioversity at IPBES events since its inception in 2006. The Assessment will be published in 2022 at which point significant additional outcomes can be anticipated, with novel policies being developed that include nature-based solutions in agriculture and policy support for farmer actions that contribute to carbon capture, improved water quality, and habitat and connectivity for biodiversity, while also recognizing those services that benefit agricultural production, including dietary diversity, pollination, pest control and nutrient cycling in soils. WLE's long term engagement in the IPBES process is beginning to bear fruit. WLE is positioned as a principal contributor to agricultural developments in the next decade that support both human health and environmental sustainability."}]}],"figures":[{"text":"CGIAR system level reporting Link to Common Results Reporting Indicator of Policies : No Stage of maturity of change reported: Stage 1  Links to the Strategic Results Framework: Links to the Strategic Results Framework: Sub-IDOs: Sub-IDOs: • Increased capacity for innovation in partner development organizations and in poor and • Increased capacity for innovation in partner development organizations and in poor and vulnerable communities vulnerable communities Is this OICR linked to some SRF 2022/2030 target?: Too early to say Is this OICR linked to some SRF 2022/2030 target?: Too early to say Description of activity / study: <Not Defined> Description of activity / study: <Not Defined> Geographic scope: Geographic scope: • Global • Global Comments: There are 134 IPBES member states. Comments: There are 134 IPBES member states. Key Contributors: Key Contributors: Contributing CRPs/Platforms: Contributing CRPs/Platforms: • WLE -Water, Land and Ecosystems • WLE -Water, Land and Ecosystems Contributing Flagships: Contributing Flagships: • F5: Enhancing Sustainability Across Agricultural Systems (ESA) • F5: Enhancing Sustainability Across Agricultural Systems (ESA) Contributing Regional programs: <Not Defined> Contributing Regional programs: <Not Defined> Contributing external partners: Contributing external partners:  "},{"text":"CGIAR innovation(s) or findings that have resulted in this outcome or impact: NA Innovations: <Not Defined> Elaboration of Outcome/Impact Statement: Building on its scientific work (4-7), WLE continues to play a critical role in setting the direction of the work of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES). In phase I, the WLE CGIAR centers contributed to the Ecosystem Services and Resilience (ESR) working group which produced a critical framework (1, 6) highlighting agriculture's dependencies on, and contributions to, nature. Re-published in IFPRI's 2019 Global Food Policy Report (Chapter 6  "}],"sieverID":"7bab5a8e-9e50-4248-94f9-6ff2bd764ace","abstract":"Building on its scientific work, WLE influenced the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES) to focus on the critical interdependencies of biodiverse ecosystems and food production. The 134 IPBES countries have adopted WLE's proposal to focus its Nexus Assessment on Biodiversity, Food, Health and Water. It will identify nature-based solutions integrating agriculture and biodiversity to support both human health and environmental sustainability. WLE is positioned as a principal contributor to agricultural policy developments in the next decade."}

data/part_1/0491fa139f4d2e0c29c23d8a581a705a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0491fa139f4d2e0c29c23d8a581a705a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/06e9e02a-a49f-417e-84a7-7a4766eac934/retrieve"},"pageCount":19,"title":"","keywords":[],"chapters":[{"head":"Table of Contents","index":1,"paragraphs":[]},{"head":"ACRONYMS/ABBREVIATIONS","index":2,"paragraphs":[]},{"head":"BACKGROUND","index":3,"paragraphs":[{"index":1,"size":74,"text":"COMACO has been working with over 230,000 registered farmers, in Eastern, Muchinga and Central provinces, and these farmers have all signed conservation agreements to be part of a mission to secure a better life and become good stewards of their natural resources. Over 86% of these farmers have since become food secure, from increased adoption of regenerative soil improvement practices. Their income levels have also more than tripled with access to the COMACO markets."},{"index":2,"size":45,"text":"In Eastern province alone, COMACO is working with 62 multipurpose cooperatives that practice climate smart agriculture for increased productivity and sustainability and these cooperatives have formed a federation called Chitetezo Cooperative Federation with the support of the Accelerating Impact Climate Research for Africa (AICCRA) project."},{"index":3,"size":96,"text":"Chitetezo Cooperative Federation (CCF) was formed to act as a mother body of all the multipurpose cooperatives that are working with COMACO in Eastern province. The mission statement of the federation is \"Removal of poverty from our communities to build a better future for all of our people and a safer and more protected environment to sustain our needs\". In line with this mission, the federation's aim is to improve small scale farmer's lives and at the same time help conserve the natural resource through strengthening community-based leadership and increased gender roles in the cooperative leadership."},{"index":4,"size":35,"text":"With the support from AICCRA, COMACO through the federation is still developing and introducing several initiatives to ensure it quickly achieves its goals of attaining good life for its people living in a safe environment."},{"index":5,"size":46,"text":"Diversifying carbon market opportunities have also helped to account for increased carbon biomass derived from conserved forests and agroforestry, by planting Gliricidia sepium trees on farmers' fields, and from reduced forest degradation resulting from improved land use practices such as minimum tillage, composting, crop rotation, etc."},{"index":6,"size":39,"text":"To attain full benefits of these community-based land use practices, proper handling of climate information services is key, as it enhances a positive change in people's lives to adopt the best farming practices and resilience to climate change effects."}]},{"head":"PROJECT PROGRESS ACTIVITIES","index":4,"paragraphs":[{"index":1,"size":53,"text":"The objective of this report is to highlight project activities by Chitetezo Cooperative Federation (CCF) during the last quarter the project has been running, examine activities and how they are contributing to the desired goals of the project. The report includes a review of activities that occurred between January and June 2023 namely; "}]},{"head":"OBJECTIVES","index":5,"paragraphs":[{"index":1,"size":41,"text":"The overall objective is to establish a federation of more than 55 cooperatives that gives equal opportunity to Women and youths to become more profitable and food secure by adopting an agroforestry and legume-based farming system with their inherent conservation benefits."}]},{"head":"PROJECT ACTIVITIES","index":6,"paragraphs":[{"index":1,"size":71,"text":"The aim of CCF is to address the gaps faced by member cooperatives and link farmers into the value chain for opportunities to increase their income at household level. To do this, the Federation tackled constraints across the value chain from the farm level to markets without compromising the quality of crop produced through Climate Smart Agriculture. To meet these aims the following activities were done in the period under review:"}]},{"head":"Chitetezo federation board meeting","index":7,"paragraphs":[{"index":1,"size":36,"text":"Chitetezo cooperative federation held its third board meeting on the 25 th of January ,2023. This meeting was attended by all the board members(7 Males and 3 females). The meeting was Chaired by the board chairperson."}]},{"head":"Objectives of the CCF Board meeting:","index":8,"paragraphs":[{"index":1,"size":8,"text":"The main objectives of the board meeting were:"},{"index":2,"size":20,"text":"• To get team updates from all board members on matters that concern COMACO and the CCF from the field."},{"index":3,"size":15,"text":"• To discuss the affiliation process on how to make more cooperatives join the federation."},{"index":4,"size":15,"text":"• To review the previous crop market in the chiefdoms where digital payment was used."},{"index":5,"size":11,"text":"Looking at the 'Cash in -Cash out' challenges those farmers faced."},{"index":6,"size":30,"text":"• To review membership fee payments and amounts that each cooperative member must contribute to their respective cooperatives and how the crop market can be used to collect membership fees."},{"index":7,"size":22,"text":"• To look at crop buying strategy for 2023 market season where twelve cooperatives were selected to do crop buying by themselves."},{"index":8,"size":19,"text":"• To review the status of the organic seed that was given to farmers and chart the way forward."},{"index":9,"size":13,"text":"• To look at seed multiplication as a potential business for the cooperatives."}]},{"head":"Board members during the 3 rd Board meeting for Chitetezo Cooperative Federation","index":9,"paragraphs":[]},{"head":"Crop Market workshop with Stake holders","index":10,"paragraphs":[{"index":1,"size":110,"text":"Previously there was little education on crop markets given to the cooperatives and this led to a lot of misunderstandings between farmers and COMACO in this regard. To change this narrative, COMACO decided to start engaging more with cooperatives so that the farmers understand the dynamics that affect the market and what COMACO was doing to continue providing the much needed markets to the farmers. COMACO, with the help of its partners Chitetezo Federation and AICCRA went further and identified 12 cooperatives that were ready to go into crop buying themselves. These cooperatives had shown good leadership, accountability and had prior experience managing large sums of monies at cooperative level."},{"index":2,"size":53,"text":"To build capacity in the cooperatives in readiness for the crop market season, COMACO with the help of AICCRA held a workshop at Eastern Comfort Lodge in Chipata from the 24 th to the 27 th of April 2023. This workshop targeted cooperative chairpersons, treasurers, Principal lead farmers and business managers focusing on:"},{"index":3,"size":5,"text":"• Financial Management and requisitions"},{"index":4,"size":12,"text":"• Orientation on the electronic farmer register during crop purchase (using tablets)"},{"index":5,"size":15,"text":"• Training in accounting principles, record keeping, reconciliations and retirement of funds and stock take."},{"index":6,"size":10,"text":"• Capacity building -cooperative stock control and management including standardization."},{"index":7,"size":10,"text":"• Membership fee collection Cooperative cost control and logistics management"},{"index":8,"size":7,"text":"• Cooperative cost control and logistics management"},{"index":9,"size":18,"text":"• A practical session to walk through processes and procedures in order to close knowledge gaps was undertaken."},{"index":10,"size":6,"text":"• Security of cash and crop"},{"index":11,"size":23,"text":"• Quality training -pre-harvest, during harvest, post-harvest. Robust bulking point management, quality requirements and inspections at bulking points. Batching and tagging of crops."},{"index":12,"size":14,"text":"• Roles, responsibilities, and key functions of people involved in crop buying by cooperatives."},{"index":13,"size":19,"text":"• Advance feedback from selected cooperative leadership on potential solutions to last years' challenges encountered with electronic eTumba payment."},{"index":14,"size":14,"text":"• Short discussion of challenges from the previous season (both COMACO & cooperative side)"},{"index":15,"size":15,"text":"• Background about COMACO, its objectives, and what it seeks to achieve through this training."},{"index":16,"size":16,"text":"• Batching A total of 67 people participated in the trainings 15 females and 52 males."}]},{"head":"Crop Purchase Logistics calculations and lay out by the COO for Operations, Mr. Stuart Hall during the four days crop buying training workshop for 2023 Marketing Season in the Eastern","index":11,"paragraphs":[{"index":1,"size":7,"text":"Province covering all the COMACO East co-operatives."}]},{"head":"Cashier Training","index":12,"paragraphs":[{"index":1,"size":85,"text":"The main objective of the training was to train and equip cashiers, business managers and Principal Lead Farmers with knowledge on how to manage the crop purchases process such as cleaning and managing of bulking points, quality of the crop to be bought, handling of cash in the field, roles and responsibilities for each person involved in crop purchase and the documentation to be used. Seven field days were conducted in seven districts of Nyimba, Katete, Chipangali, Kasenengwa, Chipata, Mambwe and Lumezi with different themes."}]},{"head":"Scope of activities","index":13,"paragraphs":[{"index":1,"size":61,"text":"The activities that were held during these field days aimed at bringing farmers together and showcasing new interventions such as the use of Gliricidia Sepium trees and compost as natural fertilizer, cultivation of groundnuts and soybeans in rip lines as well as introducing to farmers the new MGV8 groundnut variety, its potential, resistance to diseases as well as its maturity period."},{"index":2,"size":106,"text":"The activities brought together over 900 small scale farmers of different age groups especially women and youths to learn, ask questions and indeed seek guidance on how they could access the various interventions that were highlighted to them. The representation by women was 40%, while 35 % were youths of both sexes and 25% men. The host farmers showcased Gliricidia interventions in their local maize fields as well as in a high breed maize fields. The host farmers explained to other farmers how they have been using Gliricidia sepium leaves as a way of fertilizing their crops and how they manage to produce a good harvest."}]},{"head":"MGV 8 groundnuts","index":14,"paragraphs":[{"index":1,"size":79,"text":"The host farmers explained that this new variety is medium maturing, disease resistant and produces between 50 to 75 nuts per plant. They also highlighted to other farmers how they cultivated using minimum tillage methods through rip lines unlike the old method of planting groundnuts in ridges. Host farmers further explained the advantages of planting in rip lines as those of great water retention allowing the crop to strive even when there were dry spells in the weather patterns."},{"index":2,"size":85,"text":"They also shared how they make their own compost manure and how it is applied in the rip lines just before planting groundnuts. It was explained that doing so helps crops germinate with good standing as well as provide rich soil nutrient. Many farmers were stunned to see the host farmers uprooting groundnuts from the ground with ease and were happy to see the number of nuts from one plant station and that they've never heard of the use of compost manure in groundnut fields."}]},{"head":"Local /hybrid maize varieties","index":15,"paragraphs":[{"index":1,"size":75,"text":"The host farmers were at hand to explain the interventions used in both local and hybrid maize varieties. They showcased how they have been practicing agroforestry using Gliricidia sepium trees as well as the use of compost manure. It was pleasing to see the quality of both maize varieties grown using these interventions as most farmers wondered in disbelief as their assumptions that hybrid maize can only be grown using chemical fertilizer was proven wrong."},{"index":2,"size":50,"text":"Just like in the groundnuts field, the host farmers also shared how they planted their crops in rip lines to retain soil moisture as well as how they used crop residues to keep soils warm and to make mulch as a way of sustaining maize crop during the dry spells."},{"index":3,"size":60,"text":"Also highlighted were the policy gaps in conservation and agroforestry farming where the lack of serious involvement by government to compel all cooperatives that receive agricultural inputs under the Farmer Input Support Program (FISP) to engage in conservation and agroforestry farming was pointed. It was also explained that if the government Host Farmer Elizabeth Daka showcasing her MGV8 groundnuts variety."},{"index":4,"size":55,"text":"got involved, the adoption of agroforestry was going to be high and would translate into household food security enhancement in many communities. It was further explained that doing so would lead to more income at household level as the monies that are currently being spent on chemical fertilizers would be channeled to other needy areas."}]},{"head":"Soybeans","index":16,"paragraphs":[{"index":1,"size":74,"text":"Just like above, it was explained how farmers continue to enjoy good harvest every season because of the interventions supported and promoted by COMACO-AICCRA partnership. Host farmers were at hand to showcase how to apply compost manure and how Gliricidia is used to keep soils rich and healthy. Agroforestry using Gliricidia, minimum tillage through ripping, retention of crop residues, creation of firebreaks and compost manure were at the center of interventions that were applied."},{"index":2,"size":43,"text":"Host farmers also highlighted to other farmers how they took care of their crop to reduce post-harvest losses. The host showcased how soybeans performed in rip lines where compost manure was applied as most farmers are used to planting this crop in ridges."},{"index":3,"size":46,"text":"Women and youths were encouraged to take the lead and show interest in the practices as they were the ones who take care of the family, and youths being the leaders of tomorrow, should take the lead and be in the forefront spearheading these new interventions."}]},{"head":"Total rainfall recorded.","index":17,"paragraphs":[{"index":1,"size":28,"text":"Wrapping up the field days activities, the host farmers took the crowd to the rain gauge station where they explained the amount of rainfall received in that area."}]},{"head":"Host-Elizabeth Daka explaining the interventions used in her soybeans demo plot.","index":18,"paragraphs":[{"index":1,"size":27,"text":"Host Elizabeth Daka Explaining the use of a rain gauge and total rainfall received in the area. Common questions asked during the field days by the attendees"}]},{"head":"Example of","index":19,"paragraphs":[{"index":1,"size":15,"text":"• When is the right time to make compost manure and how is it applied?"},{"index":2,"size":15,"text":"• Is planting groundnuts in rip lines not going to make it difficult when harvesting?"},{"index":3,"size":7,"text":"• Where can we get Gliricidia seed?"},{"index":4,"size":19,"text":"• Is growing Gliricidia trees alongside crops not a problem as the trees grow and produce shade to crops?"},{"index":5,"size":14,"text":"• How are Gliricidia leaves applied to crops, at what stage and how often?"},{"index":6,"size":8,"text":"• Can one use compost manure in soybeans?"},{"index":7,"size":9,"text":"• When is the right time to plant groundnuts?"},{"index":8,"size":10,"text":"• Where can we access this new MGV8 groundnut seed?"},{"index":9,"size":15,"text":"• How can one know that they've received enough rain to start planting their crops?"},{"index":10,"size":10,"text":"• When is the right time to make rip lines?"},{"index":11,"size":16,"text":"The hosts were well able to handle these questions and gave practical responses to the attendees."}]},{"head":"Agroforestry Trainings 3.6.1 Gliricidia adoption promotion training","index":20,"paragraphs":[{"index":1,"size":49,"text":"Trainings on Gliricidia adoption and management were conducted in Mnukwa and Chikuwe chiefdoms between the period of 17 th and 23rd of May 2023. The purpose of the training was to equip the farmers with the knowledge of the Gliricidia Sepium tree to promote increased adoption of the tree."}]},{"head":"Summary of Achievements","index":21,"paragraphs":[{"index":1,"size":37,"text":"1. The training was conducted by the Regional Coordinator from Mfuwe, Mr. Nathan Mulambya and the M&E Officer from Chipata Hub, Mr. Ray Chazangwe in Mnukwa while the Chikuwe one was conducted by the Regional Coordinator only."},{"index":2,"size":19,"text":"2. The training was attended by Cooperative board Members, PLFs, SLFs and farmers from both Mnukwa and Chikuwe Chiefdoms."},{"index":3,"size":30,"text":"• A total of 4 trainings were conducted in four different areas of Chikuwe and Mnukwa Chiefdoms. 3 trainings were conducted in Mnukwa while one training was conducted in Chikuwe."},{"index":4,"size":9,"text":"• A total of 512 farmers attended the trainings."},{"index":5,"size":16,"text":"Below is a summary • The following topics were covered during the gliricidia adoption promotion training."},{"index":6,"size":11,"text":"✓ Closing up of gliricidia fields to protect them from fires."},{"index":7,"size":22,"text":"✓ Benefits of gliricidia Sepium to the farmer which include, a. Improvement of Soil fertility by gliricidia sepium for improved crop yields."},{"index":8,"size":29,"text":"b. How to Coppice the tree to maximize the benefit c. Use of gliricidia as a pesticide and for preserving grain crops for storage both in bags and granary."},{"index":9,"size":13,"text":"d. Use of gliricidia leaves in Compost making and how to make it."},{"index":10,"size":10,"text":"e. How farmers can benefit from gliricidia through carbon credits."}]},{"head":"Communication 3.7.1 Radio Launch","index":22,"paragraphs":[{"index":1,"size":45,"text":"In partnership with Accelerating Impacts of CGIAR Climate Research for Africa (AICCRA), the CCF hosted the launch of Zambia Agri-smart radio show on the 20 th of March 2023. The launch was held at Chikuwe cooperative farmer support centre, in chief Chikuwe of Kasenengwa District."},{"index":2,"size":77,"text":"To accelerate climate action, it was observed that it is vital that communities have access to climate smart agriculture technologies in the appropriate formats and vernacular languages, to understand the impact of climate change and improve decision making in adaptation. The launch attracted more than 150 community participants. Several media houses where represented, the Ministry of Agriculture, Forestry Department and Metrological department. Other organizations supporting gender and social inclusion such as Lucy Grand Foundation were also present."}]},{"head":"Outreach through Farm Talk","index":23,"paragraphs":[{"index":1,"size":20,"text":"Farm Talk program under the segment called federation/Cooperative corner recorded and aired the following programs from January to April 2023:"},{"index":2,"size":5,"text":"Because of these weekly topics:"},{"index":3,"size":21,"text":"• The cooperative members were sensitized to spearhead the conservation activities in their chiefdoms e.g., land preparation, composting and Gliricidia Management"},{"index":4,"size":12,"text":"• Cooperatives were sensitized on the importance of affiliating to the Federation."},{"index":5,"size":23,"text":"• Cooperatives were also informed on the best systems to be used during seed loan recoveries and seed mobilization and other entrepreneurial activities."},{"index":6,"size":16,"text":"• Some cooperative members also received free radios to enhance the listenership of Farm talk radio."},{"index":7,"size":18,"text":"A total of 300 radios were procured this year under farm talk and have been distributed to farmers. "}]},{"head":"Transport","index":24,"paragraphs":[{"index":1,"size":10,"text":"Federation leaders need motor bikes to make them more efficient"}]},{"head":"COMACO/ Federation","index":25,"paragraphs":[{"index":1,"size":8,"text":"This remains a huge challenge for the federation"}]},{"head":"CONCLUSION","index":26,"paragraphs":[{"index":1,"size":46,"text":"During this reporting period we saw Objective 1 that is ''Enhance cooperative leadership to address such challenges as grain quality, crop bulking and transport logistics, and local adoption of mobile banking'' being addressed with several trainings conducted targeting twelve cooperatives that went into crop buying themselves."},{"index":2,"size":45,"text":"Generally, the period under review was a success because several trainings were done, in financial literacy and management, agroforestry practices through field days that were conducted and the launch of the radio program by AICCRA to supplement what COMACO is already doing with farm talk."},{"index":3,"size":46,"text":"COMACO extends its gratitude to AICCRA for the partnership and financial support that has enabled the Chitetezo Cooperative Federation to achieve positive strides thus far. It is hoped that there will be continued collaboration to ensure continuity of programmes that have already been set in motion. "}]},{"head":"APPENDICES","index":27,"paragraphs":[]}],"figures":[{"text":" ACRONYMS/ABBREVIATIONS ................................................................................................................ 1.0 BACKGROUND .................................................................................................................................. 2.0 PROJECT PROGRESS ACTIVITIES ....................................................................................................... 2.1 OBJECTIVES ....................................................................................................................................... 3.0 PROJECT ACTIVITIES .......................................................................................................................... 3.1 Chitetezo federation board meeting ............................................................................................ 3.1.1 Objectives: ............................................................................................................................. 3.2 Crop Market workshop with Stake holder .................................................................................... 3.3 Cashier Training ............................................................................................................................ 3.4 Chiefdom/Cooperative Trainings .................................................................................................. 3.5 Field Days ...................................................................................................................................... 3.5.1 Scope of activities .................................................................................................................. 3.5.2 MGV 8 groundnuts ............................................................................................................... 3.5.3 Local /high breed maize varieties ........................................................................................ 3.5.4 Soybeans .............................................................................................................................. 3.5.5 Total rainfall recorded.......................................................................................................... 3.6 Agroforestry Trainings ................................................................................................................ 3.6.1 Gliricidia adoption promotion training ................................................................................ 3.6.2 Summary of Achievements .................................................................................................. 3.7 Communication ........................................................................................................................... 3.7.1 Radio Launch ........................................................................................................................ 3.7.2 Outreach through Farm Talk ................................................................................................ 4.0 OVERALL ASESSMENT AND RECOMMENDATIONS ......................................................................... 5.0 CONCLUSION ................................................................................................................................... 6.0 APPENDICES .................................................................................................................................... 6.1 Quarter Work Plan for the next Reporting Quarter .................................................................... "},{"text":"• Chitetezo Cooperative board meeting • Crop market workshop with stakeholders • Cashier trainings • Chiefdom/cooperative Training on Crop markets ��� Field days activities • Agroforestry trainings • Radio Launch • Outreach through farm talk "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Cashier training in Lundazi 3.4 Chiefdom/Cooperative Trainings Three separate trainings were held in May 2023 in Chipata, Petauke and Lundazi with the support from AICCRA. The Chipata training covered Mambwe, Chipata, Chipangali, Kasenengwa, Katete and Sinda districts, while the training in Lundazi covered Lumezi, Lundazi, Chasefu and Chama districts and the training in Petauke covered Petauke, Lusangazi and Nyimba districts respectively. The trainings attracted a total of 292 participants broken down as follows: Training Male Female Total TrainingMaleFemaleTotal Chipata 100 41 141 Chipata10041141 Lundazi 76 28 104 Lundazi7628104 Petauke 27 20 47 Petauke272047 Total 203 89 292 Total20389292  "},{"text":"Cooperative training on crop marketing , with support from AICCRA through Chitetezo Cooperative Federation chose ten farmers to establish field demonstration plots and supported them with legume seed (Kafue soya beans and MGV 8 ground nuts) and hybrid maize (ZAMSEED 606) in different districts of Eastern province of Zambia. As part of ensuring that many farmers learn more about new crop varieties and interventions being carried out to maximize the harvests without the use of chemical fertilizer the CCF organized farmer field days as part of bringing farmers together to learn through seeing what new interventions once applied correctly and consistently can improve yields. 2. Mwape 32 18 50 2.Mwape321850 3. Mumbi 9 17 26 3.Mumbi91726 4. Mwanjawanthu 8 23 31 4.Mwanjawanthu82331 5. Kalindawalo 22 20 42 5.Kalindawalo222042 6. Sandwe 19 17 36 6.Sandwe191736 7. Mnukwa Undi 30 45 75 7.Mnukwa Undi304575 8. Mnukwa Maduweni 78 87 165 8.Mnukwa Maduweni7887165 9. Chikuwe 100 104 204 9.Chikuwe100104204 10. Ndake 18 20 38 10.Ndake182038 11. Mwape 8 20 28 11.Mwape82028 12. Luembe 6 21 27 12.Luembe62127 13. Nyalugwe Nyapili 5 18 23 13.Nyalugwe Nyapili51823 14. Nyalugwe Nyakachifu - 8 8 14.Nyalugwe Nyakachifu-88  Grand Total 343 433 776 Grand Total343433776 3.5 Field Days     3.5 Field Days S/N Chiefdom Female Male Total S/NChiefdomFemaleMaleTotal 1. Nyamphande 8 15 23 1.Nyamphande81523  "},{"text":" table indicating the number of farmers trained by area, date and gender Date Training Area Male Female Total Participants DateTraining AreaMaleFemaleTotal Participants 17/05/2023 Mnukwa (Undi) 45 30 75 17/05/2023 Mnukwa (Undi)453075 19/05/2023 Mnukwa (Maduweni) 87 78 165 19/05/2023 Mnukwa (Maduweni)8778165 22/05/2023 Chikuwe Shed 104 100 204 22/05/2023 Chikuwe Shed104100204 23/05/2023 Mnukwa (Muma) 32 36 68 23/05/2023 Mnukwa (Muma)323668 Total  268 244 512 Total268244512  "},{"text":" The launch of this program came in as supplementary to what COMACO and CCF are already doing with Farm talk radio program. Unlike the farm talk, AICCRA weekly radio program was to broadcast climate smart innovation to rural communities through community stations in Bemba and Nyanja languages through seven community radio stations located in Lusaka, Eastern, Central and Northern Provinces of Zambia. It would contain two types of episodes. 1. Climate Information Services: Climate-informed digital agro-advisories, that are data driven and provide location and context specific information, improving farmer decisions in the face of climatic uncertainties. 2. Munda Make Over: The program that features farmers challenges and how climate smart agriculture and agribusiness solutions can address them, contents produced by the Media Company, in collaboration with multiple partners in Zambia.  "},{"text":"e r s Chitetezo Cooperative Federation board members after receiving radios 4.0 OVERALL ASESSMENT AND RECOMMENDATIONS CHIKUWE AND NYAMPHANDE CFMGs and COOPERATIVE CURRENT ACTIVITIES for 5th and 10th APRIL 2023 Cooperatives preparedness and Grilicidia management for 12 and 17 April 2023 Conservation activities and Family Budgeting for 19 and 24 April 2023 Post Harvest, Marketing and Family Budgeting for 19 and 24 April 2023 Marketing and conservation benefits for 26 and 1 May 2023 Farmer Registers update, Community protection, Bush fires,Marketing, Post production, Grilicidia management, Harvesting proccess, production handling, pest management, benefits of agro-forestry, Farmer register, forestry conservation, etc. Radio Station Duration Per W eek Programs Programs Per M onth Airtime Grilicidia Compainy M inutes SM S cooperatives to be listening to during their Direct Calls Feedback Platforms Radio StationDurationPer W eekPrograms Programs Per M onth Airtime Grilicidia Compainy M inutes SM S cooperatives to be listening to during theirDirect Calls Feedback Platforms Breeze Fm Explorer FM petauke 30 minutes 1 Hour 2 Nil 31 Nil 1860 Nil monthly meetings. 45 35 675 Nil Breeze Fm Explorer FM petauke 30 minutes 1 Hour2 Nil31 Nil1860 Nil monthly meetings. 45 35675 Nil Mphangwe FM 45 minutes Nil 31 930 Nil Nil Mphangwe FM45 minutesNil31930NilNil Chikaya FM 30 minutes Nil Nil Nil 35 525 Chikaya FM30 minutesNilNilNil35525 Mnkhanya FM 30 minutes Nil Nil Nil 35 525 Mnkhanya FM30 minutesNilNilNil35525 Explorer Nyimba FM 30 minutes Nil 8 240 35 525 Explorer Nyimba FM 30 minutesNil824035525 Kwenje FM Most cooperative leaders have 15 minutes Nil Nil 70 Nil 3030 Capacity 35 220 Nil 2250 building 246 COMACO/Federation A number of 237 Kwenje FM Most cooperative leaders have 15 minutes Nil Nil 70Nil 3030 Capacity 35 220Nil 2250 building246 COMACO/Federation A number of 237 TOTAL very limited knowledge in workshops 482 trainings TOTAL very limited knowledge inworkshops482trainings financial literacy  and   Total Feedback for the first quoter 2023 were financialliteracyandTotal Feedback for the first quoter 2023 were T o p i c s c o v e r e d management i n J a n u a r y 1 2 3 4 week 1 week 2 week 3 W eek 4 Hardening,rootpruning and encouraging agro-forestry for 4 and 9 Junuary 2023 Together with gliricidia for the better future for 11 and 16 th January 2023 Final grilicidia transplanting and general conservation farming 25 and 30 January 2023 Gliricidia management and current activities 18 and 23 January 2023 conducted on financial T o p i c s c o v e r e d management i n J a n u a r y1 2 3 4week 1 week 2 week 3 W eek 4Hardening,rootpruning and encouraging agro-forestry for 4 and 9 Junuary 2023 Together with gliricidia for the better future for 11 and 16 th January 2023 Final grilicidia transplanting and general conservation farming 25 and 30 January 2023 Gliricidia management and current activities 18 and 23 January 2023conducted on financial T o p i c s c o v e r e d F e b r u a r y i n 5 6 7 8 week 1 week 2 week 3 W eek 4 crop management and agro-forestry for 1 and 6 February 2023 Final Grilicidia transplanting and bee keeping for 08 and 13 February 2023 Farming with agro-forestry and transformation 15 and 20 February 2023 Seed growers and Crop management for 22 and 27 February 2023 management but only 12 cooperatives T o p i c s c o v e r e d F e b r u a r y i n5 6 7 8week 1 week 2 week 3 W eek 4crop management and agro-forestry for 1 and 6 February 2023 Final Grilicidia transplanting and bee keeping for 08 and 13 February 2023 Farming with agro-forestry and transformation 15 and 20 February 2023 Seed growers and Crop management for 22 and 27 February 2023management but only 12 cooperatives T o p i c s i n a r c h c o v e r e d M 9 10 11 12 13 W eek 1 week 1 week 2 week 3 W eek 4 Agro-forestry management and Organic farming for 01 and 06 March 2023 Benefits of grilicidia fields for 08 and 14 March 2023 Poachers on indigenous trees and conservation for 15 and 20 March 2023 Indunas on community conservation benefits and conservation farming #compost for 29 march and 03 April 2023 GIS activities and Protection of natural resources for 22 and 27 March 2023 out of 62 benefited from these T o p i c si n a r c h c o v e r e d M9 10 11 12 13W eek 1 week 1 week 2 week 3 W eek 4Agro-forestry management and Organic farming for 01 and 06 March 2023 Benefits of grilicidia fields for 08 and 14 March 2023 Poachers on indigenous trees and conservation for 15 and 20 March 2023 Indunas on community conservation benefits and conservation farming #compost for 29 march and 03 April 2023 GIS activities and Protection of natural resources for 22 and 27 March 2023 out of 62 benefited from these T o p i c s i n A p r i l c o v e r e d 14 15 16 17 18 W eek 1 week 2 week 3 week 4 W eek 5    trainings last quarter. Need for continued T o p i c si n A p r i l c o v e r e d14 15 16 17 18W eek 1 week 2 week 3 week 4 W eek 5trainings last quarter. Need for continued W e e k l y R e m Poor record keeping from producer group level to Principal Lead farmer or cooperative level. i n d Key Challenges Trainings keeping among leaders Recommendations in are needed record cooperative Extension Manager/CCF General Manager Responsibility capacity building 50 Tablets have been procured and given to cooperatives to help with record keeping. The tablets have the updated register on it and the reporting Comment form. W e e k l y R e m Poor record keeping from producer group level to Principal Lead farmer or cooperative level. i n d Key ChallengesTrainings keeping among leaders Recommendations in are needed record cooperativeExtension Manager/CCF General Manager Responsibilitycapacity building 50 Tablets have been procured and given to cooperatives to help with record keeping. The tablets have the updated register on it and the reporting Comment form. It is very costly to provide these To reach out to all our Communication This remains It is very costly to provide theseTo reach out to all ourCommunicationThis remains trainings to all our farmers in all farmers we are currently Coordinator a challenge trainings to all our farmers in allfarmers we are currentlyCoordinatora challenge the 62 cooperatives   working with the Farm talk despite the 62 cooperativesworking with the Farm talkdespite      coordinator to come up procuring coordinator to come upprocuring      with radio Lessons that more radios with radio Lessons thatmore radios      can be recorded and that are can be recorded andthatare      stored on memory cards being given stored on memory cardsbeing given      that will be given to all the to farmers. that will be given to all theto farmers.  "},{"text":"6.1 Quarter Work Plan for the next Reporting Quarter Activities Jun July Aug Objective 2: Improve farmer cooperative commitment to agreed conservation regulations for soil and forest protection and opportunities for markets Outcome 2.1 Sustainable agriculture adoption supported with improved market and yield benefits Output 2. 1.2 Agroforestry adoption reaches 80% of cooperative members  board board members to members to easily easily coordinate coordinate with other with other cooperative cooperative leaders. leaders. Activity 1. Enhance farmer trainings in agroforestry (Gliricidia management from Activity 1. Enhance farmer trainings in agroforestry (Gliricidia management from nursery to field) nursery to field) Activity 2. Increased establishment of woodlots for production of agroforestry Activity 2. Increased establishment of woodlots for production of agroforestry seeds, firewood for cookstoves and carbon credits seeds, firewood for cookstoves and carbon credits  "},{"text":": Enhance cooperative leadership to address such challenges as grain quality, crop bulking and transport logistics, and local adoption of mobile banking. Outcome1.2. Cooperative seed multiplication model developed into a viable business approach. Output1.2.1 Cooperative seed growers supporting 50% of local legume seed requirements Activity   "},{"text":"Transform innovation ideas into full scale solutions for cooperative- run services to support farmer training Outcome 4.1Cooperative federation fund-raising strategy developed Output 4.1.2 Farm Talk Radio programming improved. Activity 1. Increase Federation visibility of its role and impact through social media and web-based communications supported by COMACO's communications department Activity 2. Support special guest speakers from the cooperative federation to broaden local technical knowledge for farmers. Activity 3. Include federation members in program production to improve sense of ownership  "}],"sieverID":"23ee8a49-a19f-4442-8a5c-f4ebb5beb006","abstract":""}

data/part_1/049e897e0229f7825688e0cae6c6e4db.json

@@ -0,0 +1 @@
+{"metadata":{"id":"049e897e0229f7825688e0cae6c6e4db","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d71e9945-92f5-4840-98b9-f4b77e56f51a/retrieve"},"pageCount":11,"title":"","keywords":[],"chapters":[{"head":"A historical perspective","index":1,"paragraphs":[{"index":1,"size":97,"text":"Garhwal is a part of the Uttarakhand HimaIayan area in India, wmch was once a unique repository of biodiversity ín its forests, grasslands, and farmlands, including a variety of unique landraces. This has been reflected in !he foods and folk culture of the area. Motmtain people have been relatively prospemus; unique landraces llave contributed to their prosperity in a big way. Quoting Walton's findings ofthe 19th Century, Bahuguna (1989) writes, \"The Hill man [is] indeed specially blessed by the presenee in almost every jungle of fruits, vegetables, and roots to help him over a period ofmoderate scarcity.\""},{"index":2,"size":115,"text":"The prosperity of the region in the past is also evident from oral mstory and written documents: \"The people were well off and they used to export wheat, rice, coarse grains, oil seeds, ginger, saffron, herbs, walnut, handrnade paper, copper mds, musk, honey, ghee, woolen c1othes, cows, bulls, ponies, elc., in the markets of foothills and imported only gur (molasses) and colton c\\oth\" (Bahuguna 1989). Lt. Col. Pitcher, who was appointed to inquire into the conditions ofthe lower classes, reported in 1838, \"The peasants ofGarhwal and Kumaon are better offthan Ihe peasants in any parts of the world, who neither live in such well-built houses, nor are so well-dressed as !he peasants ofKumaon (Bahuguna 1989)."},{"index":3,"size":117,"text":"This riehness ofGarhwal's agriculture was clearly evident right up to the end ofthe firsl half ofthe twentieth cenlury. The picture has now reversed entirely, largely due to externaI development and complete neglecI of local perspectives. The type of agricultural development associated with the Green Revolution began in relatively fertile irrígated valleys, leading lO the management of monoeultures of a few HYV s of just two cereal crops. These required liberal use of chemical inputs (fertilizers and pesticides), for which lot ofincentives and subsidies were províded to the farmers of the area. The HYV s of many crops also spread to rain-fed upland areas, which led to the reduction ofthe large number oflandraces the region was famous foro"}]},{"head":"Beej Bachao Andolan: The genesis","index":2,"paragraphs":[{"index":1,"size":122,"text":"The fertile valleys in Garhwal Himalayas witnessed a near genetic wipeout in agriculture. By the mid-1980s, large arcas of irrigated flatlands were occupied by only two crops-wheat and rice-and only a few varieties of these crops. A considerable proportinn nf arable land in the upper rain-fed areas had come under cultivation of introduced white-seeded soybeans. A majnrity of farmers had switched over to \"improved\" cultivation practices using recorrunended chemical fertilizers and synthetic pesticides, and were heavily reriant on extemal \"expertise.\" This almost completely transformed the mountain valleys, which were virtually converted into an experimental ground for government-sponsored agencies. These agencies conducted their experiments and demonstrations and distributed chemical inputs, \"tested\" seeds nf modern varieties, and \"improved\" tools and implements to the farmers."},{"index":2,"size":53,"text":"It was only a matter oftime until this genetic uniformíty was struck by disaster in the form of an unprecedented drought during 1987-88 and by pest epidemics in the two following years. The modem erops had a very narrow genetic base and were badly damaged; the farmers experienced the worst daysin their lives."},{"index":3,"size":80,"text":"To confront the crisis nf genetic vulnerability, the farmers in the Henwal Valley ofGarhwal began collecting indigenous seeds, whieh had almost dísappeared from the accessible fertile valleys. Initially, they eolleeted seeds of 1 O local rice varieties from remote rural areas not affected by changes in technology and reíntroduced them in theÍr fields. These local varieties exhibited remarkable performances. The pest epidemic recurred during this crop season, but it hit only the modern crop cultivars. The reíntroduced landraces remaíned undamaged."},{"index":4,"size":64,"text":"The next year, more farmers in the Henwal Valley opted for indigenous varieties. Seeds ofthe landraces produced during the first year were distributed to other farmers in the valley. After strenuous efforts, 35 indigenous varieties ofrice were collected during the seeond year and were all raised on farms. Nearly 60 pereent ofthe total area ofthe valley was covered by the reintroduced landraces thal year."},{"index":5,"size":52,"text":"During the third year, a total of 11 O landraces ofrice were reintroduced, and the genetic diversity in rice increased dramatically. Nearly 90 percent of the cultivated area in the valley carne under landraces. In the fourth year, the total number oflocal varieties went up to 126 and the year afier, 130."},{"index":6,"size":29,"text":"Experiencíng the wonderful performance of the landraces, the farmers of the valley launehed the Beej Bachao Andolan, (BBA) which has now spread its roots throughout the whole of GarhwaL"},{"index":7,"size":102,"text":"The BBA searches, collects, reintroduces, tests, distributes, and popularizes all available local varieties of mountain cropS. So far, it has reintroduced 300 genetically dístinct varieties ofrice, abou! 200 varieties ofkidney beans, 12 ofamaranth, and so on, in the Henwal Valley alone. The number of landraces reappearing in the once genetically transformed valleys is increasing year by year. Free exchange of seed within the cornmunity-the life-line of traditional mountain agriculture-has also been revived. BBA is witnessíng a landrace renaissance in the mountains. Superb landraces, once lost to the so-caBed HYV s, are becoming an increasingly potent symbol of farmers' self-respect, self-reliance, and independence."}]},{"head":"Impact ofmodern varieties-farmers' perspective","index":3,"paragraphs":[{"index":1,"size":67,"text":"In transfonning agriculture, seed has been the most potent weapon in the hands ofthe external development agencies, including multinational corporations. Along with a variety of chemicals, alien cultivation practices also came with the new \"miracle\" seeds. This gradually undennined farmers' traditional wisdom and innovativeness. A vicious cycle of dependence on market and development agencies for new seed varieties, chemical inputs, and technological know-how started in the region."},{"index":2,"size":75,"text":"Because of the inevitable dwarf characleristic and narrow straw-grain ratio of the HYV s, they provide considerably less fodder compared to their 10ng-staIked traditional counterparts. The quality of fodder provided is also inferior. The dwarf varieties have thus led to asevere shortage of the fodder and manure that are always badly needed by the li vestock-dependent eommunities ofthe mountains. In addition, when there i8 a fodder shortage, the work1oad of wornen farmers ínereases (Singh 1992)."},{"index":3,"size":60,"text":"Monocultures with a narrow genetic base are extremely vulnerable to epidemics and unfavorable weather conditions. The seeds ofHYVs cannot even be stored in houses wímout chemical treatment. They are mus a potential source of environmental pollutíon and healm hazards. Indiscrimínate use of chemical fertilizers and pesticides also reduce soíl fauna and flora and severely affect me healm of soil ecosystems."},{"index":4,"size":95,"text":"Seeds have always been regarded as a common property resource by farming communities in me mountains. Free exchange of seeds within mountain communities has been one of the most outstanding features of agriculture. Under transfonned agriculture involving new seeds and external inputs, seeds cease 10 be a common property resource, as does ｾ ｨ ･ ｩ ｲ ＠ free flow among fanners. Seeds are now a private resource of big corporatíons or public organizations. Patents and intellectnal property rights, etc., are the means to treat vital seeds as weapons of a newly emerging biological imperialism."}]},{"head":"Superb landraces","index":4,"paragraphs":[{"index":1,"size":133,"text":"Rice in fue HimaIayan mountains was once a natural treasure of genetic diversity. In this region rice can be grown successfully up lo an altitude of 2000 melers. Himalayan valleys are especially well known for fue special varieties of rice lbat grow there. Tradítional rice varieties, like hansraj, ranyawan, kanguri, bagwai, gorakhpuri, basmati, thapachini, jhumkya, etc., thrive in lowland areas, whíle chawaria, mujil. jhailda, lekmal, kallao, almunji, chwatu, etc., grow well in upland rain-fed areas and at high altitudes. Some of varieties can even be grown cIose to glaciers. Sorne varieties demand more water, sorne less, and some need no írrigation at all. The productivity of ram-fed rice varieties is comparable with lbat ofirrigated ones. Such rare, hardy, and sturdy variet-¡es would hardly be found in me plain areas anywhere in me world."},{"index":2,"size":66,"text":"HYVs cannot match tradítional varieties in theír palatability, or, perhaps, nutritive value. Due to chemical applications, HYV s can pose a potential risk to human health and disturb me natural food chain. The taste and distinctive aroma of sorne traditíonal rice varieties, e.g., Indian basmati, are known throughout the world. Many rice varietíes in the mountains, e.g., kafalya, kallao, ghyasu, and ramjawan are comparable lo basma/i."},{"index":3,"size":77,"text":"AlIlandraces are known for their characleristic size; me shape and size of ears; color, shape and size of seeds; palatability; aroma; cooking quality, etc. In addítion, lathmar and jhailda are free from splítting problems. They are generally planted in areas prone to hailstorms. Even wild animals cannot harm them because the ears ofthe plants bear awns. Sorne landraces are al so ofhígh medicinal value; for example, kajalya is used to cure leukorrhea and many other gynecologícal problems."}]},{"head":"Tbe baranaaja culture: Diversity is prosperity","index":5,"paragraphs":[{"index":1,"size":141,"text":"A croppíng pattem based on intermíxing finger míllet, locally known as baranaaja, ís a symbol of prosperity in the regíon. Baranaaja literally means \"12 food grains.\" The adage \"diversity is prosperity\" holds well from the perspective of mountain agriculture. Finger millet is intercropped with as many as 12, and sometimes even more, other food grains. Amaranth, buckwheat, kidney beans, horse gram' black soybean, black gram, green gram, cowpea, adjuki bean, sorghum, and cleome are the main crops intermixed with the base crop offinger míllet. Baranaaja provides a unique eXam-pIe ofhow a mountain farmercultivates diversity. Marginal and small farmers inhabiting the mountains manage agrobiodíversity in such a way that they can harvest the maximum number offood items from the mínimum amount ofland. The degree of agrobiodiversity is directly proportional to the level oftheir (food) security, and baranaaja is the core oftheir (agri)culture."},{"index":2,"size":116,"text":"The main result of conventional ínterventions in agriculture is to replace the unique baranaaja culture with monocultures of white-seeded soybeans. Soybeans as a cash crop is projected as a panacea for the land-based economy ofthe mountaíns. This crop was introduced recently as one ofthe packages of the OTeen Revolution and is said to be a source of protein, milk, and oiJ. Soybean, in faet, has never been an ingredient of local diets, nor has it fetched more money for the farmers. Farmers who switched to soybean cuitivation from baranaaja generally bartertheirproduce for salt or rice. Unlike all major mountain crops, soybeans do not provide fodder for livestock, which has contributed to fodder problems in the area."},{"index":3,"size":41,"text":"Realizing the potential dangers to local agrobiodiversity, the majority oflocal farmers have given up raising soybeans at the expense ofthe unique baranaaja. BBA, with the help offarmers has been successful in reviving the baranaaja culture, to the joy of mountain cornmunities."}]},{"head":"Ecological regeneration of common property resources","index":6,"paragraphs":[{"index":1,"size":71,"text":"The mountain farming systems lypical of Garhwal comprise forests, cropland, Iivestock, and households as fOUT organically Iiuked components (or subsystems). No input from outside the system lS required. This tradítional system ís \"closed,\" and self-eontainment is one of its most essential features. Forest biomass flows into cropland (cultivated land) in the form of organic manure via the agency of livestock. Crop biornass is recycled into cropland through livestock and human beings."},{"index":2,"size":104,"text":"This farrning system is altogether different from the one operating in the plains under Green-Revolution agricultura! practices. In the ¡atter, organic liukages among components are virmally missing. Forests are almost absent. Almost aH the necessary inputs are supplied from outside. The forests and grasslands in the mountains, on the other hand, are managed as cornmon property resources, with cropland continuously receiving a subsidy from them. Such a unique farming system could be termed a \"nature-subsidized, solar-powered agroecosystem.\" Green-Revolution agriculture, on the other hand, is a \"fossil-fuel-subsidized, solar-powered agroecosystem\" in whích petroleum-based inputs (chemical fertilizers, pesticides, and machines powered by fossil fuels) are inevitably used."},{"index":3,"size":131,"text":"Cornmon property resources play the most vital role in providing ecological integrity 10 mountain agriculture. Biodiversity in these areas has enormous bearing on agrobiodiversity. Ecologícal regeneration and enriehment of diversity in these areas is also a focal poin! ofBBA. Plentíful biomass harvests, especially of fodder and fuel wood, trom cornmon property resources have strengthened organíc línkages among the components of farming system, infusing health into the whole farmíng system. Croppíng systems are more fragile than fores! ecosystems. Ifthere is erop failure due lO an erralíe weather cycle, for example, cornmon property resources can fill much of the requirement for foOO. They also case pressure on croplands. In their absence, more and more areas would have lo be cultívated, whích would exact a heavy cost trom the ecological balance in the regíon."},{"index":4,"size":108,"text":"Cornmon property resourees also playa significant role in enhancing food secnrity. Villagers in Garhwal have access to at least 127 different food-providíng plants. Many ofthese food plants oceur in areas tha! are eornmon property resources. People íncorporate 23 wild fruits, flowers, and buds and 14 wild vegetables in their díets. These uncultívated foods complement the cultívated ones. FoOOs obtainable trom uncultivated comrnon property resource areas ofien have very high nutritive value. Many ofthese have medicinal value as well. At least 100 more plant varieties that occur naturally in uncultivated areas are exploited as fodder for livestock and thus become par! of human nutritíon through milk and milk prOOuets."},{"index":5,"size":59,"text":"When looking at the food spectrum of prehistoric humans, we come to know tbat they embraced at least 1500 species ofplants, while over 500 vegetables were utílized by ancient civilizatíons. However, in contemporary times, human nutrition ís based on no more than 30 plants, with three crops-wheat, rice, and maize--acc.ountíng for 75 percent of our cereal consumption (SAM 1984)."},{"index":6,"size":125,"text":"It can c1early be inferred trom this thal human societies have been moving steadíly towards a state of food poverty based on the decline of food díversity. The state of food díversity is grirnmer in agriculturally transformed areas deluged by high-yieldíng, fertilizer-dependent varieties of food grains. In these Green-Revolution areas onlya few species ofplants with a limited number ofvarieties remain the solesource ofhuman nutrition. There is no mentíon of and no debate about uncultívated foods. In urban mountain areas, where the public distribution system is the only way lo feed people, most ofnutritional requirements are mel by dal-bhat (pulses and rice). But the plates ofrnral mountain people are piled with delicíous and díverse foods thanks to the enormous biodiversity flourishing in their forests and agroecosystems."},{"index":7,"size":172,"text":"Because of the continued neglect of comrnon property resources in policíes and planning, however, considerable ecological damage has been witnessed in these areas over the last few decades. BBA took stock of this situation and designed concrete strategies for ecological regeneration. Van suraksha samiti (forest protection comrnittees) have been formed. Inspired by the Chipko Movement, the village youths involved in these committees have taken on !he task of regenerating the rapidly depleted fures!s. Overgrazing of the comrnon property resources by cattte and ovine species is no! allowed. Only hand-Iopping (no cuttíng with sickles) of oak leaves is permitted. Oak forests represen! !he natural clímax vegetation ofthe Middle Himalayas, playing a very specífic role in soil and water conservatíon and microclimate maintenance. These forests are especially protected from overexploitation. Only dry branches and twigs can be removed for firewoOO. The comrnittee's sanctions are to be followed by aH. BBA has enhanced the biodiversity ofthe cornmon property resources through massive plantings offoOO-yielding trees. These trees have begun bearing fruit and eontributing to food security."},{"index":8,"size":104,"text":"As a result of this cornmunity management, village residents in the Henwal Valley of Garhwal are now obtaining fuel, fodder, and several kinds ofwild foods (fruits, flowers, buds, vegetables, seeds, honey, etc.), along with cultivated fruits, from the cornmon property resource areas-free of cost on sustained basis. Water springs have been rescued and these supply clean drinking water to villagers. The reappearance of several wild animals-boars, bears, leopards, etc.-indicates that the ecological balance is being restored. Farmers are getting plentiful natural subsidies in the form of forest biomass, water for irrigation, etc., for agriculture, and the impact on agronomic yields in cropland is visible."}]},{"head":"Farmers' Experimentation","index":7,"paragraphs":[{"index":1,"size":106,"text":"BBA keeps records of the performance of all the landraces. BBA farmers also do their own informal experimentation on the landraces. The performance of all the landraces is compared with the so-called HYV s demonstrated by external development agencies. AIl the traits of vital socioeconomic importance, rather than just grain yields, are taken into consideration. The results of one such experiment conducted in Jardhargaon ofthe Henwal Valley are presented in table l. In their experimentation, farmers do not apply any statistical design, but they do take into consideration more traits and factors than an agricultural scientist would conventionally do. Sorne ofthe interesting observations are listed below."},{"index":2,"size":2,"text":". ."},{"index":3,"size":22,"text":"• The average yield of27 landraces (40.00 qper ha) was significantly higher than the yields of five HYVs (28.00 q per ha)."},{"index":4,"size":15,"text":"• Thapachini, a widely adopted landrace, gave the highest grain yield (54.00 q per ha)."},{"index":5,"size":19,"text":"• Jhumkya, khushboo, agariya, lathmar, kali mukhri, basmati nagni, lalmati, congressi, nailchamya, rekhalya, and rikhwa also gave impressive yields."},{"index":6,"size":9,"text":"• Most ofthe landraces attain maturity earlier than HYVs."},{"index":7,"size":17,"text":"• The average recovery percentage of landraces (72 percent) was significantly higher than that ofHYVs (60 percent)."},{"index":8,"size":15,"text":"• The average grain-husk ratio oflandraces (2.6: 1.0) was wider than that ofHYVs (1.5: 1.0)."},{"index":9,"size":36,"text":"• Straw-grain ratio s ofmost ofthe landraces (1.4:1.0 to 2.3: 1.0) are higher than those ofHYVs (1.1: to 1.6: 1.0), thus supplying more fodder, a critical produce, no less important for livestock production in the region."},{"index":10,"size":21,"text":"• Yields ofthe landraces are fairly sustainable. This has been observed for more than a decade in the Henwal Valley ofGarhwal."},{"index":11,"size":15,"text":"• More yields with low inputs (zero external input) indicate the high-energy efficiency in landraces."},{"index":12,"size":47,"text":"• Landraces show considerable tolerance to diseases and pest infestation, and sorne of them can thrive well under rain-fed conditions, thus exhibiting the unique trait of drought tolerance. HYV s, on the other hand, are vulnerable to several sorts of pests and cannot grow under rain-fed conditions."},{"index":13,"size":78,"text":"• In addition to organic manure, HYV s usually require external inputs (chemical fertilizers and dreaded pesticides); hence, their cultivation contributes to environmental pollution and  Note: Landraces were grown at the fann ofa BBA fanner. whiIe HYVs were the demonstrations of an agricultural university near the same farro. Organic manure was applied to all the plots at the rate of250 q per ha. HYVs, in addition, were also provjded with recommended doses of chemical fertiJizers and pesticides ."},{"index":14,"size":13,"text":"health hazards, whereas the landraces thrive under organic culture, ensunng environmenlal qualíty ."},{"index":15,"size":37,"text":"• Landraces nol only satisfY people's hunger and contríbute to food security, but lhey are also used in many rituals. AII through lhe hístory ofIndían cívílízatíon, these landraces have been used as symbols of religion and culture."},{"index":16,"size":9,"text":"• The social aceeptabilíty of landraees ís very high."},{"index":17,"size":108,"text":"Regular features oflhe movement inelude organizing meetings lO review lhe progress oflhe BBA and occasional walking tríps, along wilh seed faírs and partícipation in museums, fairs, etc., in urban areas. These have been consídered necessary for creating awareness in the cornmunity. The relentless search in remote and poorly aceessible areas for the collection of more and more seeds of landrace varieties exhibiting unique characteristics goes along with the awareness-raising activitieso An inventory ofthe unique traits oflandraces is made with lhe help of farmers in remote areas, and oral histories relating to their cultivation are recorded. BBA has also prepared a biodiversity register for e1aborating the characteristics of individuallandraces."},{"index":18,"size":75,"text":"Seeds of the local varieties of crops, such as rice, kidney beans, black soybeans, severa! local pulses, amaranth, etc., can now be found for sale in urban markets, indicating their increasing economic value in the market. Landraces, in fact, are fetchíng handsome retums for sorne ofthe families in the area. Many varieties of the crops grown only in the mountain areas are known for their special food and medicinal values and have great export potentiaL"}]},{"head":"Future Implications","index":8,"paragraphs":[{"index":1,"size":55,"text":"Traditional systerns of managernent and ecological knowledge have been the vital meaus by which mountain cornmunities have evolvedrichly diverse food-production and livelihood systems. Tradilional knowledge develops from the natural process of adaptation and, unlike conventional scientific knowledge, it is moral, ethical, aesthetic, intuitive, theosophical, cornpassionate, and holistic, resulting in a diverse local and bioregional econorny."},{"index":2,"size":57,"text":"One thing that seems certaÍn is that in the hístorical process of agricultural development, farmers have always sought to enhance the level of biodiversity. When they opt out of following the biodiversity-destructive ways 'ofthe Green Revolution, they retum to ¡he biodiversity-based agriculture they have tested over millennia. Farmers in the Garhwal Himalayas, through BBA, are doing this."},{"index":3,"size":119,"text":"Diversity in agricultura! crops, landraces, and theír wild relatives in the Indian Himalayas have been maintained by farmers for centuries. In India, lhe endemÍc species inhabit two areas for the most part: approxirnately 4,200 species are found in the Himalayas and 2,600 in the peninsular region. In the Indian Himalayas, crop diversity is related to eight groups of crops and 71 species. As a result of the selection pressure exercised within the species by locals over the millennia, enormous diversity has evolved in the form oflocallandraces (pant 1998). Too much emphasis on HYV s has led to lhe extinction of severallandraces during recent decades. People' s movements, líke the BBA, would help remove such extinction scenarios from !he mountains."},{"index":4,"size":69,"text":"The efforts ofBBA are noteworthy in that they have revived the cultivation ofunique landraces and cropping systems, promoted on-farm conservation of genetic resources, enhanced biodiversity in forests and agroecosystems, and encouraged the growth of organic farming based on ¡he principies of a living soíl, bíodíversity-complexity, and cyclic flow patterns. The success of BBA suggests that it is possible to combíne diversíty, productívíty, and livelíhood security in future agricultural policy."},{"index":5,"size":108,"text":"Since many of the locallandraces exhibít uníque properties-like taste, aroma, essential amino acids, bigh calcium content, medicinal (Ayurvedic) value, and the like-they can have very high market value in the plains and can bring in handsome retums to local farmers. A mountain-friendly agricultural policy can playa pivotal role in this regard. Prices should be decided on the basis of the characteristíc properties the produce possesses. Mountain agriculture, in fact, should be díctated by the principie of value, rather than volume. Value rather than volume should also be the main concern of the agrarian economy of the mountains and other marginal areas harboring unique biodiversity in their ecological ruches."},{"index":6,"size":61,"text":"When agrobiodiversity is managed and controlled by farming cornmuruties, ít ís virtually regarded as a cornmon property resource. Conservatíon ofplant and animal genes should be seen as an aspect of management of the cornmon property resource. lt should, therefore, be seen as a fundamental duty ofboth institutíons and farmers to conserve bíologícal and genetíc resources. BBA remÍnds us tbis moral obligatíon."},{"index":7,"size":86,"text":"A farmers' movement, rather thanjust farmers' participatíon or farmers' involvement, is the most radical approach towards realizing the most desirable change in a system. T1ús approach itselftakes cace of any bías and lack of instítutíonal mechanisms for change. lt also reverses negatíve change into positive. By creatíng local gene pools through large-scale farmers' movements, on-farm management (conservation and sustainable use) of genetic resources will also help marginal farmíng cornmunitíes, like those ofthe mountains, to remain impervious to the global polítícs surrounding control ofthe world's gene pools."}]},{"head":"Empowering Farmers through Participatory Plant Breeding: An Initiative of the Green Foundation","index":9,"paragraphs":[{"index":1,"size":6,"text":"Vanqja Ramprasad and Shibu M P"}]},{"head":"Abstraet","index":10,"paragraphs":[{"index":1,"size":216,"text":"In the so-called difficult envíronments, institulional planl breeding appears to be a fanure, mainly because breeding is direcled al increasing yields in more favorable environments. Although the improved varielies have broad adaptability, under varied marginal environments, they do nol express their yield potenlial or lhey do not satisfy olher user requirements. In any environmenl, the polential of a plant is controlled by the inleraetion ofits genelie compositíon with the environment. Tlús involves adaptation of the planl lo both physical environmenls (climate, ,oil, abiolic and biotic stress) and the sncioeconomic environmenl (userconcerns, consumers' preferenees, economíc status, markets, etc.). Afterthe íntroduetion of high-yielding varieties and hybrida during the Oreen Revolution in Indía, hundreda oflandrace. and indigenous varieties have beeome extinet or on the verge of extinctíon, largely hecause they have not been eonsidered economíeal to grow under the present market economy. Despite this, small-scale farroees in marginal envíronments continue lO grow a mixture of crops and vari• etíes as a buffer agaíost temporal and spalia! variation to cope wilh stress factoes. It has been a lime-tested practico by farmers to continue lo seleel their nexl generation of seed., thereby modifying the genelk eharacterislÍcs of the crops. Tapping into Ihis practice .nd empowering farmees lO improve Iheir crops has now come lo be referred lO as \"particípatory plan! breeding.\""}]},{"head":"Introduction","index":11,"paragraphs":[{"index":1,"size":71,"text":"Indigenous seed practices encompass practically all aspects of crop productíon, since seed saving is an integral partofcropping activities in indigenous systems. Farmers engaged in tbe production and multiplication of quality seeds deal witb asexual propagation, land preparatíon and soil management, seed and seedling preparation and care, crop and pest management, flowering induction, tbe enhancement ofseed quantity and quality, crop improvement, harvestíng or collection, seed processing, storage, and genetic conservatíon (Fernandez 1994)."},{"index":2,"size":87,"text":"The holistic understanding of cropping in semi-arid areas has lent support to tbe conservation of diversity in various parts oftbe country. In tbe last few decades, there have been dramatic changes in Indian agriculture. The advent ofthe Green Revolution in tbe mid-1960s has been a major threat to India's vast genetic díversity. Intercropping has been replaced by monocroppíng, and as a result, food production is perched on narrow genetic diversity. The erosion of agricultural biodiversíty tbreatens tbe long-terro stability and sustainabílíty ofIndian agriculture in tbe following ways:"},{"index":3,"size":15,"text":"• It erodes the genetic base on which scientists are dependant for crop breeding ."},{"index":4,"size":17,"text":"• A monocrop ofhigh-yielding varietíes (HYVs) does not provide adequate insurance against failures caused by natural calamitíes."},{"index":5,"size":10,"text":"The authors are with the Oreen Foundation in Bangalore, India."}]},{"head":"Need to revive biodiversity","index":12,"paragraphs":[{"index":1,"size":77,"text":"A considerable amount of the genetic material that has been maintained by farmers over several years is now no longer available to the farmers. The ex situ collections play an important role in preserving germplasm under freezing condítions but they have theír own limitations, like cost and 108s of viability during storage. This limits the natural course of evolution, since the environmental conditions to whích erops are constantly adapting cannot be recreated in a refrigerated gene bank."},{"index":2,"size":46,"text":"It is in this context that a plant-genetic-resources conservation program was introduced in 1992, to ultimately create a village-based community seed bank. Since then, the program has gone through the stages of colleetion, multiplieation, monitoring, evaluation, and farmers' partlcipation in selection, rating, and distribution of varieties."}]},{"head":"The proflle ofthe area","index":13,"paragraphs":[{"index":1,"size":147,"text":"Thally block, in the State ofTamil Nadu, and Kanakapura, in the state ofKarnataka, are semiarid, with an annual rainfall of700-9oo mm. The Oreen Foundation works in the dry-land regíons lyíng between these two administrative regíons-Tamil Nadu and Karnataka. Seed conservation work extends across 85 villages, involving more than 500 farmers. The agricultural scene paints a bleak pieture. The combination ofílliteracy, poor infraSÍf\\lcture, poverly, and srnallland holdings on the one hand and changing agricultural practices and market pressures on the otber have rendered agriculture very vulnerable for the farmers of the area. More than 85 percent of the cultivated area comes under rain-fed dry-land. Changíng rainfall patterns have affected the improved varieties introduced in the area. Yet the area also represents a rich source ofbiodiversíty, whích is on the verge of extinetion. It is against this baekdrop tha! the Oreen Foundation has initiated a genetie resource conservation programo"},{"index":2,"size":86,"text":"The major food erops of this region are frnger millet and dryland paddy, followed by wetland paddy, pulses, sorghum, maize, oílseeds, vegetables, and otherminor millets. Many ofthe indigenous varieties have been reíntroduced with low-input agrieulture sínce 1993, when the foundation started its work in the area. rablel gives the detaíls ofthe collectíons between 1995 and 1999. In 1998 an attempt was rnade to upgrade local varieties through a process of partlcipatory varietal selechon, and as an initial step, ragí (finger millet) and rice crops were selected."},{"index":3,"size":32,"text":"Earlier practices recall cultivation offour seasonal crops such as gingelly in the pre-monsoon season; groundnuts, paddy during early monsoon; ragi, pulses in the monsoon season; and horse gram in the post-monsoon periodo"},{"index":4,"size":66,"text":"Changes in climatic variations have had an impact on the rainfall pattern and, as a consequence, have affected different erops ín dífferent ways. Intercropping has been popular as a traditíonal practice, although many farmers have shifted to the improved varicties of finger millet, leading to erosion of tradítional ones. The program of seed conservation has widened the choice of finger millet varieties for farmers (figure 1)."},{"index":5,"size":54,"text":"The foeus ofthe program was not only to wíden the choice ofvarieties but also to increase yields by improving the quality of seeds. The on-farm conservatíon program, with nearly 34 indigenous varictíes of finger millet and 38 varieties of wetland and dry-land paddies provídes the basic materials for the particípatory plant breeding (PPB) process."}]}],"figures":[{"text":"Table   "},{"text":" 1. Performance ofSome Landraces and High-Yielding Varieties orRice in a Village oflhe Garhwal Himalayas, India ___ M. _ _ _ _ _      ___ M. _ _ _ _ _  Production (q per ha) Straw•Graln Plan! Helghl, Days 01 Production (q per ha)Straw•GralnPlan! Helghl,Days 01 Name of Landracel HYV Gr.ln Straw Ratio (cm) Maturity Name of Landracel HYVGr.lnStrawRatio(cm)Maturity Landraces      Landraces Thapachini 54\"00 96\"00 1\"8 140 140 Thapachini54\"0096\"001\"8140140 Khushboo 49.00 80.00 1.6 125 145 Khushboo49.0080.001.6125145 Kali Mukhri 46\"00 80.00 1.7 122 145 Kali Mukhri46\"0080.001.7122145 Agaria 49.00 78\"00 1.6 125 145 Agaria49.0078\"001.6125145 Kanguri 38\"00 54\"00 1,4 115 120 Kanguri38\"0054\"001,4115120 Lalmati 45\"00 64.00 1.4 120 140 Lalmati45\"0064.001.4120140 Rikhwa 43.00 64.00 1.5 125 130 Rikhwa43.0064.001.5125130 Jhumkya 50.00 80\"00 1.6 130 140 Jhumkya50.0080\"001.6130140 palphaBasmati Nagni 45\"00 88.00 2\"0 135 150 palphaBasmati Nagni45\"0088.002\"0135150 Utauli 3MO 64\"00 1.8 118 145 Utauli3MO64\"001.8118145 Bango! 40.QO 65.00 1.6 125 140 Bango!40.QO65.001.6125140 Congressi 45.00 104\"00 2\"3 126 145 Congressi45.00104\"002\"3126145 Anjana 29.00 48.00 1.7 125 145 Anjana29.0048.001.7125145 Gajraj 3MO 48.00 1\"5 126 150 Gajraj3MO48.001\"5126150 Ghyasu 37.00 72.00 1.9 135 150 Ghyasu37.0072.001.9135150 Lathmar 47.00 65.00 1.4 115 150 Lathmar47.0065.001.4115150 Rekhlya 43.00 70.00 L6 120 140 Rekhlya43.0070.00L6120140 Gorakhpuri 36\"00 65.00 1\"8 135 120 Gorakhpuri36\"0065.001\"8135120 Hansraj 33.00 75.00 2.3 130 160 Hansraj33.0075.002.3130160 Bhagwandas 33.00 58.00 1.8 125 135 Bhagwandas33.0058.001.8125135 Nyuri 35.00 60.00 1.7 110 120 Nyuri35.0060.001.7110120 Palyopar 36.00 66.00 1.8 120 140 Palyopar36.0066.001.8120140 Basmati 0000 32.00 55.00 1.7 125 150 Basmati 000032.0055.001.7125150 Nailchamya 43.00 72.00 1.7 120 145 Nailchamya43.0072.001.7120145 Chawarya 32.00 60.00 1.9 122 135 Chawarya32.0060.001.9122135 Luakat 37.00 60.00 1.6 130 145 Luakat37.0060.001.6130145 Ramjawan 33.00 57.00 1.7 125 130 Ramjawan33.0057.001.7125130 High.Yielding Varieties      High.Yielding Varieties Kastun 24.00 34.00 1.4 85 150 Kastun24.0034.001.485150 Pan! Ohan-6 30.00 40.00 1.3 72 155 Pan! Ohan-630.0040.001.372155 Sakat -4 41.00 64.00 1.6 72 165 Sakat -441.0064.001.672165 Pant Ohan -11 30.00 40.00 1.3 80 160 Pant Ohan -1130.0040.001.380160 Govind 17.00 18.00 1.1 85 155 Govind17.0018.001.185155  "}],"sieverID":"22ee6203-6dfa-43fc-b07b-f2eab9fc18a1","abstract":"In sítu conservation and farmers' access to and control over germplasm go hand-in-hand. If biodiversíty were the potentíal source of sustainability, on-farm conservation of crop species and genetic resources mus! be the inevitable process to realize sustainability in marginal areas Iike mountains. Farmers are at the center stage of agrobiodiversity management. If farmers' rights are lo be safeguarded and their independence is to be ensured, on-farm conservation of germplasm must remain in the hands of farmers. In situ conservatíon is also a way lo keep the negative effects of Green-Revolution-type agriculture al bay, including the possible extinction ofvaluable landraces.Kecping in mind these deeper issues and concerns, farmers in the Henwal Valley ofGarhwal Himalayas started a Beej Bachao Andolan (Save Seed Movement). By saving the traditional seeds and landraces, along with in situ conservation of biodiversity, this kínd of initiative brings positive changes to local agricultural systems, leading to ecologically sound, self-reliant, and sustainable agriculture. It also empowers farmers with seeds, wmch are the mos! potent symbols oftheir power and independence. Conserving landraces and biodiversity, along with empowering farmers, are the main targels ofthe Beej Bachao Andolan (BBA). Those active in the movement are trying Iheir best lo reintroduce seeds that were losl when the so-called high-yielding varieties (HYVs) produced by institution-led research were introduced. Farmers are reviving ecologically regenerative farming praetiees by improving the cornmon property resource base, mainly the forest ecosystems.This paper atrempts to present the experienees ofthe Beej Bachao Andolan, wmch is, in fact, a landrace renaissance in wmch mounlain farmers are the sole motive power. This story mighl help to stimulate farmers and pro-farmer organizations in other areas of the world to establish tms sort of conservatíon and development eff0:t, with farrners al the heart of it."}

data/part_1/04aa7cf3e01adf78a4c904933bf52cd3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04aa7cf3e01adf78a4c904933bf52cd3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/26a044b8-62c6-4e35-96bc-26c633c93d75/retrieve"},"pageCount":12,"title":"Genome-Wide Association Study of Resistance to Cassava Green Mite Pest and Related Traits in Cassava","keywords":["BLUP, best linear unbiased prediction","CGM, cassava green mite","CGMS, cassava green mite severity","GBS, genotypingby-sequencing","GLM, general linear model","GWAS, genome-wide association study","H 2 , broad-sense heritability","LP, leaf pubescence","LR, leaf retention","MAF, minor allele frequency","MLM, mixed linear model","NRCRI, National Roots Crop Research Institute","PC, principal component","PCA, principal component analysis","QTL, quantitative trait locus","SG, stay green","SNP, single-nucleotide polymorphism","SSR, simple sequence repeat","STC, shoot tip compactness","STS, shoot tip size"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":48,"text":"leaves extracting the cell contents (Yaninek and Hanna, 2003). Feeding damage by CGM causes leaf chlorosis, total defoliation, stunted growth, and root yield reduction up to 80%, which can eventually lead, in severely infected plants, to a candlestick appearance and low accumulation of starch in the storage roots."},{"index":2,"size":80,"text":"Important control measures against CGM include cultural practices such as early planting, biological control using natural predators of M. tanajoa like Typhlodromalus aripo De Leon (Yaninek and Hanna, 2003), and host plant resistance (Leuschner, 1982). The use of resistant cultivars has been, so far, the most effective solution in mitigating the negative effect of CGM in farmers' fields, not only because this approach reduces yield losses, but since it also decreases the levels of pest inoculum in the farming system."},{"index":3,"size":95,"text":"Clones with pubescent leaves, large compact shoot apices, and enhanced leaf retention (LR) and stay green (SG) offer higher levels of resistance to CGM than cultivars that lack these characteristics (Bellotti, 2002). Previous studies have reported the preference of T. aripo, the natural predator against CGM, for pubescent vs. glabrous cassava cultivars infested with M. tanajoa (Chalwe et al., 2015). Ultimately, leaf pubescence (LP) provides shelter for the predatory mite and enhances the ability of the predator to find the prey (CGM) due to the production of herbivoreinduced plant volatiles (Bellotti, 2002;Onzo et al., 2012)."},{"index":4,"size":134,"text":"There has been limited work on the genetic control of CGM to determine the gene(s) conferring resistance. Most studies on CGM have focused on conventional breeding with limited work on molecular breeding. Previous studies identified two simple sequence repeat (SSR) markers, NS 1099 and NS 346, which showed high association with CGM resistance (Ceballos et al., 2010;Choperena et al., 2012). Recently, using an F 1 cross developed between the Tanzanian landrace Kiroba and the breeding line AR37-80, two quantitative trait loci (QTLs), qCGMc5Ar and qCGMc10Ar, were reported to be linked to CGM resistance (Nzuki et al., 2017). However, the genetic mechanism underlying CGM resistance and its phenotypically associated traits (LP, LR, SG, shoot tip size [STS], and shoot tip compactness [STC]) has not been studied in diversity panels using a genome-wide association mapping approach."},{"index":5,"size":252,"text":"Conventional phenotype-based recurrent selection to breed CGM resistant cultivars is lengthy and resource intensive owing to several biological aspects associated with cassava breeding, including low seed set, slow multiplication rate of planting materials, and a 12-mo growing cycle (Ceballos et al., 2012). Moreover, the identification of CGM-resistant cultivars through phenotypic selection requires dry environmental conditions that favor M. tanajoa infestation. When and where such environmental conditions occur irregularly or nonuniformly, screening for the severity of the pest damage can be difficult. These challenges can be overcome through the use of genomic-assisted and marker-assisted breeding tools to facilitate indirect selection (Wolfe et al., 2016). Therefore, we performed a genomewide association study (GWAS) to uncover genomic regions associated with natural resistance to M. tanajoa. A GWAS is an efficient and effective method for identifying new genes in complex phenotypic traits (Altshuler et al., 2008). This approach has been particularly useful for mapping major loci for various other traits in cassava. Some of the studied traits include genetic architecture of cassava mosaic disease, which is caused by cassava mosaic geminiviruses in the family Geminiviridae and the genus Begomovirus (Wolfe et al., 2016), b-carotene and dry matter content (Esuma et al., 2016;Rabbi et al., 2017), shoot weight, fresh root yield, starch fraction amylose content, dry matter content, and starch yield (de Oliveira et al., 2012). The current study was conducted aiming to identify genomic regions and single-nucleotide polymorphism (SNPs) linked to CGM resistance and other CGM-related traits in a GWAS panel of 845 advanced breeding lines."}]},{"head":"MATERIALS AND METHODS","index":2,"paragraphs":[]},{"head":"Germplasm Collection","index":3,"paragraphs":[{"index":1,"size":71,"text":"A diverse panel of cassava germplasm maintained by the National Root Crop Research Institute (NRCRI), Umudike, Nigeria, was used for GWAS. The diversity panel consists of 845 advanced breeding lines that had been selected and clonally maintained. Three hundred and seventy-two clones were obtained from the cassava breeding program at IITA in Nigeria, 82 clones from CIAT, Colombia, and 391 clones from the breeding program of NRCRI, Nigeria (Supplemental Table S1)."}]},{"head":"Experimental Sites","index":4,"paragraphs":[{"index":1,"size":104,"text":"The GWAS panel clones were evaluated in three locations in Umudike (5°29¢ N, 7°24¢ E; annual rainfall of 2200 mm; altitude of 120 m; mean annual temperature of 22 to 31°C; Dystric Luvisol soils; humid forest), Kano (12°0¢0¢¢ N, 8°31¢0¢¢ E; annual rainfall of 830 mm; altitude of 470 m; mean annual temperature of 29 to 38°C; coordinates; Calcic Luvisol soils; Sudan savanna), and Otobi (8°41¢ N, 7°20¢ E; annual rainfall of 1500 mm; altitude of 319 m; mean annual temperature of 24 to 35°C; Ferric Luvisol soils; southern Guinea savanna) in Nigeria. These sites represent the hot spots of CGM in the country."}]},{"head":"Field Layout and Experimental Design","index":5,"paragraphs":[{"index":1,"size":76,"text":"The trials were laid out in a randomized incomplete block design with three replications. Each plot consisted of five plants per row on ridges. There was 1 m of spacing between ridges and also between plants within the row, giving a total population of 10,000 plants ha −1 . The trials were evaluated in the 2013-2014, 2014-2015, and 2015-2016 cropping seasons. The populations were systematically phenotyped for CGM severity (CGMS), LP, LR, SG, STC, and STS."}]},{"head":"Agronomic Practices","index":6,"paragraphs":[{"index":1,"size":65,"text":"Fertilizer (15:15:15 N-P-K) was applied at the rate of 600 kg ha −1 . Fertilizer was applied at 8 wk after planting using the ring For the clone effect c i , the best linear unbiased prediction (BLUP) represents an estimate of the total genetic value for each individual. To calculate the predictor error variance (PEV), the BLUPs were deregressed using the equation ( )"},{"index":2,"size":55,"text":"where PEV is the prediction error variance for each clone (Wolfe et al.;2016, 2017). The deregressed BLUP was used for the association analysis to help reduce noise variation in GWAS. Variance components extracted from the lmer output and broad-sense heritability (H 2 ), based on clone means, was estimated according to (Hallauer et al., 2010)."},{"index":3,"size":22,"text":"Pearson correlation was calculated between traits using trait means of 845 accessions, which was performed using the cor function implemented in R."}]},{"head":"DNA Extraction and SNP Genotyping","index":7,"paragraphs":[{"index":1,"size":309,"text":"DNA extraction was performed following the DNeasy Plant Mini Kit (Qiagen) protocol with slight modification. The young fresh leaf samples were harvested from the apical part of cassava plant in the field. About three to five tender leaves, weighing ?500 to 900 mg, were inserted in well-labelled extraction tubes arranged in a labelled 96-well box and placed on ice to maintain DNA integrity. From the field, the leaf samples were transferred to the NRCRI molecular laboratory and stored in a −80°C freezer. Before the commencement of the extraction process, the stored samples were lyophilized for 24 to 48 h. With the use of a tissuelyser running with a 1´ speed at a rate of 1500 strokes min −1 , the samples were ground to a fine powder. Genomic DNA was extracted and quantified using a NanoDrop 1000 (Thermo Scientific), whereas the molecular weight was assessed by agarose gel electrophoresis. After successful DNA extraction, the samples were sent to the Institute of Genomic Diversity, Cornell University, Ithaca, NY, for SNP genotyping. There, SNP genotyping was performed following the genotyping-by-sequencing (GBS) protocol of (Elshire et al., 2011) using the ApeK1 restriction enzyme recommended by (Hamblin and Rabbi, 2014). Genotypes were called using the TASSEL 5.0 GBS pipeline version 2 (Glaubitz et al., 2014) and aligned to the cassava reference genome, version 6 (http://phytozome.jgi.doe.gov). The GBS data were filtered so that clones with >80% missing and markers with >60% missing genotype calls were removed. The SNPs with low quality (i.e., markers with extreme deviation from Hardy-Weinberg equilibrium, c 2 > 20) across all samples were removed from the dataset. Only biallelic SNP markers with a call rate >70% and minor allele frequency (MAF) of 0.05 were used for the analyses. Finally, imputation of the filtered dataset with 84,585 SNP markers >0.01 MAF was performed using Beagle version 4.0 (Browning and Browning, 2009)."}]},{"head":"Population Structure and Genome-Wide Association Analysis","index":8,"paragraphs":[{"index":1,"size":71,"text":"A dataset of 61,307 SNP markers with MAF ³0.05 was used for the assessment of population structure and GWAS. Principal component analysis (PCA) on SNP markers was used to identify major patterns of relatedness within and among the method, where a round small channel is made around the plants to input the fertilizers after planting. The field was weeded three times during the first 4 mo. Weeding was done by hoe."}]},{"head":"Agronomic Data","index":9,"paragraphs":[{"index":1,"size":6,"text":"The traits evaluated were as follows:"},{"index":2,"size":218,"text":"1. Cassava green mite severity was evaluated at the visual rating of the damage caused by CGM at 6 mo after planting in January (peak of dry season). A 1-to-5 scale was used to rate symptoms where 1 = highly resistant (no symptoms observed), 2 = resistant (moderate damage, no reduction in leaf size, scattered chlorotic spots on young leaves), 3 = moderately resistant (severe chlorotic symptoms, slight reduction in leaf size), 4 = susceptible (severe chlorotic symptoms and severe reduction in leaf size of young shoot), 5 = highly susceptible (very severe chlorosis, extensive defoliation, candlestick appearance of young shoots). 2. Leaf pubescence was characterized visually for the degree of hairiness on the young leaf with 0 = glabrous, 3 = little pubescence, 5 = moderate pubescence, and 7 = high pubescence. 3. Leaf retention was evaluated at the visual rating of leaf longevity using a scale of 1 = very poor retention, 2 = poor retention, 3 = fair retention, 4 = good retention, 5 = outstanding retention. 4. Stay green was scored visually based on a 1-to-3 scale where 1 = poor (<50% of the leaves are live and green), 2 = moderately good (50-35% of the leaves are live and green), and 3 = very good (³75% of the leaves are live and green)."},{"index":3,"size":87,"text":"Leaf longevity was assessed by scoring for LR and SG. 5. Shoot tip size was a visual assessment of shoot apices based on how large or small the shoot apices are and categorized on a scale of 1 to 3 where 1 = small, 2 = medium, and 3 = large. 6. Shoot tip compactness was also based on visual assessment of the compactness of shoot apices according to how closely the shoot apices are, where 1 = loose, 2 = moderately compact, and 3 = compact."},{"index":4,"size":18,"text":"All the traits were evaluated during the peak of dry season ( January) at 6 mo after planting."}]},{"head":"Phenotypic Data Analyses","index":10,"paragraphs":[{"index":1,"size":35,"text":"Phenotypic data obtained from three experimental years were initially analyzed separately and subsequently pooled across years, using lme4 (linear mixed effects models using Eigen and S4) package implemented in R software (R Core Team, 2014)."},{"index":2,"size":24,"text":"The mixed models were fitted considering the location and year effect using the \"lmer\" function of the lme4 r package (Bates et al., 2015):"},{"index":3,"size":55,"text":"where Y ijk represents raw phenotypic observations; m is the grand mean; c i is a random effects term for clone; b j is a fixed effect for the combination of location and year harvested; r k(i) is a random effect for replication nested within a location-year combination; and e ijk is the residual variance."},{"index":4,"size":12,"text":"breeding populations (NRCRI, IITA, and CIAT) using the prcomp function in R."},{"index":5,"size":32,"text":"Association analysis was performed using three different statistical models comprising both general linear models (GLMs) and mixed linear models (MLMs) using TASSEL 5.0 (Bradbury et al., 2007). The following models were tested:"},{"index":6,"size":43,"text":"1. Naïve model: GLM without any correction for population structure. 2. PK model: MLM with two principal components (PCs) from PCA and K matrix as a correction for population structure. 3. K model: MLM with K matrix as a correction for population structure."},{"index":7,"size":11,"text":"Results were compared to determine the best model for the analysis."},{"index":8,"size":95,"text":"The statistical formula for the GLM is y = Xb + e and for the MLM is y = Xb + Zu + e (Yu et al., 2006) where y is the vector of the phenotypic observations, X and Z are the known design matrices, b is a vector containing the fixed effects (genetic marker information and the population structure [the Q matrix]), u is a vector containing random additive genetic effects, and e is the vector of random residues. In MLM, the variance structure of random vectors u and e is 0 Var 0"},{"index":9,"size":25,"text":"where 2 a = s G K with K as the kinship matrix and 2 a s as the additive genetic variance, and 2 e"}]},{"head":"= s R I","index":11,"paragraphs":[{"index":1,"size":146,"text":"with I as an identity matrix and 2 e s as the residual variance. In MLM, PCs from PCA and kinship (K) matrix analyses were used as the covariate (Bradbury et al., 2007;Hao et al., 2012). For the GLM analyses, a permutation test was run, and the number of permutations was 1000. The correcting ability for false positives of these models was tested through the evaluation of the quantile-quantile plots of the observed −log 10 (p values) vs. expected −log 10 (p values). Manhattan and quantile-quantile plots were generated using the R package qqman (Turner, 2014). To avoid false positives, a Bonferroni correction was used to set the significance cutoff at −log 10 (a/n). Where a is 0.05, which is the standard significance threshold, and n is the number of SNPs. In this study, the Bonferroni correction significance cutoff was − log 10 (0.05/61,307) = 6.23."}]},{"head":"Candidate Genes Identification","index":12,"paragraphs":[{"index":1,"size":62,"text":"Significant SNPs from the GWAS results were selected for candidate gene identification. In QTL regions, SNP markers above the Bonferroni threshold (−log 10 > 6.23) were mapped onto genes within a 4-to 8-Mb interval using the SNP location and gene description from the M.esculenta_305_v6.1.gene.gff3 available in Phytozome 11 (Goodstein et al., 2011) and the intersect function from bedtools (Quinlan and Hall, 2010)."},{"index":2,"size":18,"text":"Gene ontology annotation for each time point and combining all the datasets was done using Panther (http:// go.pantherdb.org/)."}]},{"head":"Data Availability","index":13,"paragraphs":[{"index":1,"size":18,"text":"The phenotypic and genotypic data generated and analyzed during this study are available in the Cassavabase repository (https://www.cassavabase.org/)."}]},{"head":"RESULTS","index":14,"paragraphs":[]},{"head":"Phenotypic Evaluations","index":15,"paragraphs":[{"index":1,"size":134,"text":"Descriptive Statistics and Broad-Sense Heritability across Three Locations for Three Years Summary statistics of phenotypic data obtained for three growing seasons in the three sites (Umudike, Otobi, and Kano) are presented in Table 1. The highest mean (3.22 of a maximum of 5) was obtained for CGM at Kano, and the lowest (2.51 of a maximum 5) was obtained for CGM at Umudike. The highest means for LP and LR were obtained in Umudike, whereas the lowest were found in Kano. This implies that the lower the LP and LR, the higher the CGMS. Estimates of H 2 ranged from low to moderate, with the highest H 2 for CGM (0.30) and the lowest H 2 for LR (0.15). Trait variability estimated by a CV ranging from 30.6% for STC to 82.63% for LP."}]},{"head":"Distribution and Correlation of the Traits","index":16,"paragraphs":[{"index":1,"size":148,"text":"Correlation values among the different traits evaluated in the three environments are presented in Table 2. Results showed that LP (r = −0.94), LR (r = −0.63), SG (r = −0.61), STS (r = −0.52), and STC (r = −0.65) significantly and negatively correlated with CGMS (p < 0.01), whereas LR (r = 0.65), SG (r = 0.55), STS (r = 0.58), and STC (r = 0.68) significantly and positively correlated with LP. The distribution of deregressed BLUPs used as response variables in GWAS can be seen in Fig. 1. A wide range of variation was observed among the genotypes for all traits measured, and most traits exhibited a nearnormal distribution (Fig. 1). The results also showed that the performance of plants that were moderately resistant to CGMS were more in number than the resistant and susceptible plants. Moderately pubescent plants tend to show good LR and SG."}]},{"head":"Population Structure and Genetic Diversity","index":17,"paragraphs":[{"index":1,"size":153,"text":"A total of 61,307 polymorphic SNPs with MAF >5% were used in this study. Using PCA to summarize genetic variation in the accessions, only a subtle differentiation was observed in the collection of germplasm (Fig. 2). Principal component analysis of the accessions revealed that the first, second, third and fourth PCs accounted for 0.31, 0.17, 0.06 and 0.05, respectively, of the genotypic variability (Supplemental Table S2). The top two PC loadings accounted for 48% of the variation and were included in the subsequent genome-wide association analyses (Fig. 2). SNP markers for CGMS, LP, LR, and SG, respectively. The most significant SNP marker (S8_5962253) had a −log 10 (p value) of 12 and explained 7% of the observed phenotypic variation. No significant SNP markers were observed for STS and STC in the combined dataset. The contribution of any single SNP to the phenotypic variation ranged from 4 to 7% across the traits (Table 3)."}]},{"head":"Cassava Green Mite Severity","index":18,"paragraphs":[{"index":1,"size":38,"text":"Twelve markers were significantly associated with CGM resistance. The significant markers associated with the trait mostly concentrated in a single region on chromosome 8. The top significant SNP marker (S8_5962253) explained 7% of the phenotypic variance (Table 3)."}]},{"head":"Leaf Pubescence","index":19,"paragraphs":[{"index":1,"size":35,"text":"Seventeen markers were found to be significantly associated with LP. The significant markers associated with this trait also lies on chromosome 8. Variance explained by the significant markers ranged from 4 to 7% (Table 3)."}]},{"head":"Leaf Retention","index":20,"paragraphs":[{"index":1,"size":35,"text":"Five markers displayed significant associations with LR. These markers (S8_5962253, S8_6439483, S8_6439519, S8_6439891, and S8_6439935) were found on chromosome 8. Each of these markers explained 4% of the phenotypic variation of this trait (Table 3)."}]},{"head":"Stay Green","index":21,"paragraphs":[{"index":1,"size":28,"text":"A marker was found to be significantly associated with SG. This marker (S13_692620) was found on chromosome 13. The marker explains 4% of the phenotypic variation (Table 3)."}]},{"head":"Genotype  Environment Effects","index":22,"paragraphs":[{"index":1,"size":17,"text":"The effect of genotype ´ environment interaction for CGMS, LP, LR, SG, STS, and STC was demonstrated"}]},{"head":"Association Analysis","index":23,"paragraphs":[]},{"head":"Model Selection","index":24,"paragraphs":[{"index":1,"size":159,"text":"To identify the most suitable model to conduct GWAS for the dataset, three different standard GWAS models were evaluated for CGMS (Fig. 3). As depicted in the quantilequantile plots, false-positive associations were observed using the naïve model for association analysis. When the K and PK model effects were incorporated, potential spurious associations were filtered out, and the p values were closer to the expected distributions for the trait analyzed. The K and PK models showed a good fit for p values, whereas the naïve model was characterized by an excess of small p values that correspond to the abundance of spurious associations (Fig. 3). This indicated that the K and PK were consistent for reducing −log 10 (p values) toward the expected level, thereby controlling for false positives. On the other hand, the K model performed similarly to the PK model, displaying a highly uniform distribution of p values. Therefore, all subsequent results were based on the K model."}]},{"head":"Marker-Trait Association","index":25,"paragraphs":[{"index":1,"size":192,"text":"Association tests were performed for all traits in an analysis that combined all years and locations. Thirty-five SNP markers in total passed the Bonferroni significance threshold (Table 3). The GWAS identified 12, 17, 5, and 1 significant  by comparing GWAS results for the three seasons (2013, 2014, and 2015) across the three locations (Supplemental Table S5). The GWAS QTL regions explained between 4 and 8% of the observed phenotypic variation for all traits in Kano, Otobi, and Umudike, respectively (Supplemental Table S3). As seen in Fig. 4, a QTL with the most significant signal marker (S8_5962253) on chromosome 8 observed for CGMS, LP, and LR across the three locations. Different numbers of significant SNP markers were observed for different traits. In 2013, 34 significant SNP markers were observed for CGMS (11), LP (13), LR (8), SG ). The SNP marker (S8_5962253) was the most significant hit for years 2013 and 2015, but not in 2014, although it was significant using the average from the 3 yr. Moreover, the same QTL region on chromosome 8 was identified as significantly associated with CGMS, LP, and LR when mapping across all accessions in the panel."},{"index":2,"size":118,"text":"In addition, ANOVA for all traits evaluated in the three different locations across 3 yr revealed highly significant differences among the genotypes for all the traits (p < 0.001), thereby indicating the presence of substantial phenotypic variance (Supplemental Table S4). The results also indicated that the effects of location and year were significant (p < 0.001 and 0.05, respectively) for all the traits. Genotype ´ location interactions were not significant for all the traits. Apart from CGMS, all other traits were significant for genotype ´ year interactions. Genotype ´ location ´ year interactions were significant for CGMS, LP, LR, and STC.  Stay green and STS were not significant for genotype ´ location ´ year interactions (Supplemental Table S4)."}]},{"head":"Candidate Genes","index":26,"paragraphs":[{"index":1,"size":118,"text":"The association results were intersected with the gene annotations within a 4-to 8-MB region on chromosome 8, and this region was the significant QTL for CGMS, LP, and LR. A total of 35 unique genes were identified within this region (Fig. 5, Supplemental Table S6). Most of the annotated genes are classes of membrane proteins that are involved in diverse functions ranging from plant growth and development to stress tolerance. Among these genes, 17 candidate genes were found in the significant GWAS signal region linked to CGM resistance. The 17 candidate genes were subdivided into seven categories according to their protein structure: Zn finger, pentatricopeptide, MYB, MADS, homeodomain, trichome birefringence-related protein, and ethyleneresponsive transcription factor genes (Table 4)."}]},{"head":"DISCUSSION","index":27,"paragraphs":[{"index":1,"size":33,"text":"In this study, a diversity panel of 845 clones from the NRCRI cassava breeding program was used for genomewide association mapping to identify QTL regions associated with CGM resistance and other related traits."},{"index":2,"size":90,"text":"Overall, the estimates of H 2 for CGMS, LP, LR, SG, STS, and STC were low to moderate, ranging between 0.15 and 0.30. The H 2 estimates for these traits were lower than the narrow-sense heritability estimates reported by Chalwe et al. (2015) and were lower than other agronomic traits in cassava (Wolfe et al., 2017). Despite the low heritability of these traits, they are good candidates for genomic selection, which is a breeding approach that is more accurate than traditional selection, especially for low-heritability traits (Calus et al., 2008)."},{"index":3,"size":105,"text":"Correlation estimates in crop breeding help to determine the success of indirectly selecting one trait for another (Falconer and Mackay, 1996). The correlation between leaf and shoot pubescence and CGM was reported by Byrne et al. (1983). Pubescence, therefore, acts to protect the most susceptible part of the plant from the Mononychellus mites (Hershey, 1987). Our correlation results showed that LP, LR, SG, STS, and STC are significantly and negatively correlated with CGMS. Thus, the observed correlation between CGM and other traits indicates that genotypes with pubescent leaves, outstanding LR, SG ability, compacted shoot tip, and large STS exhibited resistance to tolerance to CGM infestations."},{"index":4,"size":117,"text":"Table 3. Single-nucleotide polymorphism (SNP) marker loci significantly associated with the traits and their explained proportion of phenotypic variation by marker (R 2 ).  In Africa, the history of a cassava has followed complex domestication and breeding processes (Bredeson et al., 2016), with germplasm sharing and recurrent use of elite parents among the breeding programs (Wolfe et al., 2016). Conceivably in cassava, relatedness among cultivars can lead to population structure, which can confound the results of GWAS when relatedness is not included in the GWAS model (Yu et al., 2006). However, the population structure analysis of the GWAS accessions showed only a subtle differentiation between accessions, similar to those previously reported in cassava (Wolfe et al., 2016)."},{"index":5,"size":59,"text":"The incorporation of both K and PK matrices into a MLM has been successfully used in other species that exhibited significant population structure and relatedness (Gajardo et al., 2015;Zhou et al., 2016). Furthermore, the K model computational time is faster, and no additional steps like identifying population structure and PCs in the germplasm are required (Pasam et al., 2012)."},{"index":6,"size":42,"text":"Using three different standard GWAS models, we observed a stringent reduction in the number of significant markers when either the K or PK model was incorporated in GWAS, whereas in comparison, the naïve GLM model exhibited a high rate of false-positive rates."},{"index":7,"size":53,"text":"To gain insight into the genetics of CGM resistance and its correlated traits, we selected the results from the K model to annotate the significant markers into candidate genes. We identified 35 unique genes within the SNPs   and NS346) that showed high association with CGM resistance (Ceballos et al., 2012;Choperena et al., 2012)."},{"index":8,"size":56,"text":"In addition, a QTL mapping study in a biparental population identified two QTLs linked to CGM resistance (qCGMc5Ar and qCGMc10Ar) on chromosomes V and X respectively, with a maximum logarithm of odds of 20.19 at C1 (with phenotypic explained variance of 6.48) and 24.03 at C2 (with phenotypic explained variance of 4.11) (Nzuki et al., 2017)."},{"index":9,"size":97,"text":"We indirectly assessed the effect of genotype ´ environment interaction for all traits over 3 yr by comparing GWAS results across locations. Here, the GWAS peak associated with the candidate genes was consistently significant in 2013 and 2015, but not in 2014. These differences in significant QTLs are likely due to differences in weather patterns experienced during the growing seasons throughout years, which can have an impact on trait scores. In addition, for CGMS, LP, and LR, the same QTL was detected across locations, suggesting the lack of genotype ´ environment interaction for all traits across locations."},{"index":10,"size":200,"text":"The fact that CGMS, LP, and LR show a stable QTL across locations indicates that these traits can be under the same genetic control or that the genes controlling each of these traits are linked and located on the chromosome 8 QTL region. The presence of pleiotropic effects may be beneficial, as genes conferring resistance to CGM are linked to LP and LR. These desirable traits (LP and LR) may be cointroduced along with the pest resistance into susceptible, glabrous cassava cultivars. Thus, we focused on the annotation of candidate genes within the 4-to 8-Mb region containing the CGM GWAS peak. Within the QTL region, we found 17 candidate genes that have strong homology with genes that are related to plant defense against insects. Among the most promising candidates, we identified protein trichome birefringence-related genes, Homeodomain-leucine zipper genes, myb-like helix-turn-helix (HTH) family protein and Zn finger protein 8 (ZFP8). The protein trichome birefringence-related genes are involved in increased levels of crystalline secondary wall cellulose in trichomes and stem development (Bischoff et al., 2010). Trichome birefringence-related genes are also involved in many developmental processes including defense to insects, herbivores, microbes, maintenance of leaf temperature, and transpiration regulation (Zhao et al., 2015)."},{"index":11,"size":101,"text":"Homeodomain-leucine zipper genes are unique to plant kingdom and participate in organ and vascular development including trichome development (Ariel et al., 2007;Zhao et al., 2015), and MYB domain transcription factor genes like myb-like HTH are involved in the specification of the leaf proximal distal axis and also regulates trichome differentiation in tobacco (Nicotiana tabacum L.) (Payne et al., 1999). Finally, Zn finger protein 8 (ZFP8) is required for the initiation of inflorescence trichomes in response to gibberellin and cytokinin (Gan et al., 2007), and in Cucumis sativus L., ethylene treatment increased the number of cells per trichomes (Kazama et al., 2004)."},{"index":12,"size":91,"text":"Here, we identified a number of candidate genes in a GWAS panel representative of African cassava diversity. Earlier studies identified QTL regions for CGM resistance in other chromosomes than the ones reported here, suggesting loci specificity dependent on germplasm origin. Therefore, to fully dissect the genetic architecture of CGM resistance, additional clones should be tested over several years and at multiple locations. After validation, our results can be translated into marker-assisted breeding strategies that will serve as a complement to conventional breeding approaches to improve cassava cultivars for resistance to CGM."}]},{"head":"CONCLUSION","index":28,"paragraphs":[{"index":1,"size":101,"text":"This study is the first one to follow a genome-wide association mapping approach to dissect the genetic basis of CGM resistance and related traits in an African cassava germplasm. The genome-wide association analysis led to the identification of 17 candidate genes associated with CGM resistance, LP, and LR in cassava. This approach provides to plant breeders a useful tool to identify genes and discover valuable alleles for cultivar improvement. Validation studies involving fine mapping, joint linkage mapping, and genetic evaluation of candidate genes are required to understand the relationship between these candidate genes and the phenotypes evaluated in this GWAS analysis."},{"index":2,"size":44,"text":"UKAid (Grant 1048542, http://www.gatesfoundation.org) and from the NRCRI, Umudike, Nigeria. We especially thank Peter Kulakow for his support during the work. Thanks to the technical team at NRCRI for assistance during field activities. We appreciate Roberto Lozano for guiding Lydia in candidate gene analysis."}]}],"figures":[{"text":" 1), and STC (1). In 2014, 11 SNPs were found to be associated with two traits (LP [8] and STS [3]) on chromosomes 8 and 9, respectively. In 2015, GWAS identified 60 SNPs on chromosome 8 for five traits (CGMS [15], LP [19], LR [14], SG [8], and STC [3] "},{"text":"Fig. 1 . Fig. 1. Histogram of deregressed best linear unbiased predictions (BLUPs) for all traits-(a) cassava green mite severity, (b) leaf pubescence, (c) leaf retention, (d) stay green, (e) shoot tip compactness, and (f) shoot tip size-evaluated across the three locations for 3 yr. "},{"text":"Fig. 2 . Fig. 2. Principal component analysis (PCA) plot of Principal Component 1 (PC1) against Principal Component 2 (PC2) illustrating population structure in the M. esculenta diversity panel genotyped with the single-nucleotide polymorphism markers. The red, blue, and green rectangles represent M. esculenta with CIAT, IITA, and National Root Crops Research Institute (NRCRI) origins. "},{"text":"Fig. 3 . Fig. 3. Comparison of different genome-wide association study models. Cumulative distribution of p values computed from 61,307 single-nucleotide polymorphisms, and cassava green mite severity phenotype for different association models are presented. The more uniform the distribution of p values, the better the model. "},{"text":"Fig. 4 . Fig. 4. Manhattan plots summarizing genome-wide association results for (a) cassava green mite severity, (b) leaf pubescence, (c) leaf retention, and (d) stay green across the three locations. The Bonferroni significance threshold is shown in red. A quantile-quantile plot if the p values is shown to access the number and magnitude of observed associations between genotyped single-nucleotide polymorphisms and the traits. "},{"text":"Fig. 5 . Fig. 5. Manhattan plot for genome-wide diagnosis of association for chromosome 8, zooming out the region with association signal for cassava green mite. Horizontal blue and red lines are the suggestive and Bonferroni threshold lines, respectively. "},{"text":"Table 1 . Descriptive statistics (mean ± SD), CV, and broad-sense heritability (H 2 ± approximate SEM) for all the traits.   Umudike   Otobi   Kano   Pooled  UmudikeOtobiKanoPooled  Mean ±  H 2 ± Mean ±  H 2 ± Mean ±  H 2 ± Mean ±  H 2 ± Mean ±H 2 ±Mean ±H 2 ±Mean ±H 2 ±Mean ±H 2 ± Traits † SD CV SEM SD CV SEM SD CV SEM SD CV SEM Traits †SDCVSEMSDCVSEMSDCVSEMSDCVSEM   %   %   %   %  %%%% CGMS 2.81 ± 33.10 0.30 ± 2.81 ± 31.53 0.16 ± 3.22 ± 35.66 0.08 ± 2.91 ± 40.00 0.30 ± CGMS2.81 ±33.100.30 ±2.81 ±31.530.16 ±3.22 ±35.660.08 ±2.91 ±40.000.30 ±  0.93  0.01 0.89  0.01 1.15  0.01 1.00  0.01 0.930.010.890.011.150.011.000.01 LP 2.58 ± 101.00 0.29 ± 2.39 ± 104.5 0.15 ± 2.62 ± 97.44 0.12 ± 2.53 ± 101.30 0.29 ± LP2.58 ±101.000.29 ±2.39 ±104.50.15 ±2.62 ±97.440.12 ±2.53 ±101.300.29 ±  2.61  0.03 2.50  0.03 2.56  0.04 2.60  0.01 2.610.032.500.032.560.042.600.01 LR 3.02 ± 28.50 0.13 ± 3.05 ± 28.26 0.05 ± 2.93 ± 27.31 0.05 ± 3.01 ± 28.20 0.15 ± LR3.02 ±28.500.13 ±3.05 ±28.260.05 ±2.93 ±27.310.05 ±3.01 ±28.200.15 ±  0.86  0.01 0.86  0.01 0.80  0.01 0.80  0.01 0.860.010.860.010.800.010.800.01 SG 2.24 ± 27.08 0.15 ± 2.23 ± 28.37 0.07 ± 2.22 ± 25.68 0.06 ± 2.23 ± 27.20 0.17 ± SG2.24 ±27.080.15 ±2.23 ±28.370.07 ±2.22 ±25.680.06 ±2.23 ±27.200.17 ±  0.61  0.01 0.63  0.01 0.57  0.01 0.60  0.01 0.610.010.630.010.570.010.600.01 STC 2.05 ± 30.69 0.22 ± 2.03 ± 30.69 0.11 ± 2.00 ± 30.20 0.12 ± 2.03 ± 30.60 0.17 ± STC2.05 ±30.690.22 ±2.03 ±30.690.11 ±2.00 ±30.200.12 ±2.03 ±30.600.17 ±  0.63  0.01 0.62  0.01 0.60  0.01 0.60  0.01 0.630.010.620.010.600.010.600.01 STS 2.22 ± 31.86 0.16 ± 2.18 ± 33.19 0.08 ± 2.19 ± 31.00 0.06 ± 2.20 ± 32.10 0.23 ± STS2.22 ±31.860.16 ±2.18 ±33.190.08 ±2.19 ±31.000.06 ±2.20 ±32.100.23 ±  0.71  0.01 0.72  0.01 0.68  0.01 0.70  0.01 0.710.010.720.010.680.010.700.01 † CGMS, cassava green mite; LP, leaf pubescence; LR, leaf retention; SG, stay green; STC, shoot tip compactness; STS, shoot tip size.   † CGMS, cassava green mite; LP, leaf pubescence; LR, leaf retention; SG, stay green; STC, shoot tip compactness; STS, shoot tip size.  "},{"text":"Table 2 . Phenotypic correlation coefficient analysis of all traits evaluated across the three locations for 3 yr. Trait † CGMS LP LR SG STS STC Trait †CGMSLPLRSGSTSSTC CGMS 1 −0.94*** −0.63*** −0.61*** −0.52*** −0.65*** CGMS1−0.94*** −0.63*** −0.61*** −0.52*** −0.65*** LP  1 0.65*** 0.64*** 0.53*** 0.67*** LP10.65*** 0.64*** 0.53*** 0.67*** LR   1 0.55*** 0.50*** 0.53*** LR10.55*** 0.50*** 0.53*** SG    1 0.58*** 0.58*** SG10.58*** 0.58*** STS     1 0.68*** STS10.68*** STC      1 STC1  "},{"text":"Table 4 . genes annotated as candidates for association with cassava green mite resistance. Gene Chromosome Gene description GeneChromosomeGene description Zn finger transcription factor genes   Zn finger transcription factor genes Manes.08G058500 8 C2H2-like Zn finger protein Manes.08G0585008C2H2-like Zn finger protein Manes.08G048200 8 C2H2-type Zn finger family protein Manes.08G0482008C2H2-type Zn finger family protein Manes.08G048800 8 CCCH-type Zn finger protein with ARM repeat domain Manes.08G0488008CCCH-type Zn finger protein with ARM repeat domain Manes.08G034200 8 Dof-type Zn finger DNA-binding family protein Manes.08G0342008Dof-type Zn finger DNA-binding family protein Manes.08G046400 8 K homology-domain-containing protein-/-Zn finger (CCCH-type) family protein Manes.08G0464008K homology-domain-containing protein-/-Zn finger (CCCH-type) family protein Manes.08G041900 8 Zn finger protein 8 Manes.08G0419008Zn finger protein 8 Pentatricopeptide repeat family   Pentatricopeptide repeat family Manes.08G026500 8 Pentatricopeptide repeat (PPR) superfamily protein Manes.08G0265008Pentatricopeptide repeat (PPR) superfamily protein Manes.08G053900 8 Pentatricopeptide repeat (PPR-like) superfamily protein Manes.08G0539008Pentatricopeptide repeat (PPR-like) superfamily protein Manes.08G060500 8 PENTATRICOPEPTIDE-REPEAT-596 Manes.08G0605008PENTATRICOPEPTIDE-REPEAT-596 MYB-domain transcription factor genes   MYB-domain transcription factor genes Manes.08G058000 8 myb-domain protein 106 Manes.08G0580008myb-domain protein 106 Manes.08G045400 8 myb-like helix-turn-helix (HTH) transcriptional regulator family protein Manes.08G0454008myb-like helix-turn-helix (HTH) transcriptional regulator family protein MADS-domain transcription factor genes   MADS-domain transcription factor genes Manes.08G035100 8 AGAMOUS-like 80 Manes.08G0351008AGAMOUS-like 80 Homeodomain transcription factor genes   Homeodomain transcription factor genes Manes.08G043900 8 Homeobox from Arabidopsis thaliana Manes.08G0439008Homeobox from Arabidopsis thaliana Manes.08G024700 8 Basic leucine zipper (bZIP) transcription factor family protein Manes.08G0247008Basic leucine zipper (bZIP) transcription factor family protein Manes.08G046700 8 bZIP transcription factor family protein Manes.08G0467008bZIP transcription factor family protein Trichome birefringence-related protein   Trichome birefringence-related protein Manes.08G044000 8 PROTEIN TRICHOME BIREFRINGENCE-RELATED Manes.08G0440008PROTEIN TRICHOME BIREFRINGENCE-RELATED Ethylene-responsive transcription factors   Ethylene-responsive transcription factors Manes.08G026900 8 SAUR-like auxin-responsive protein family Manes.08G0269008SAUR-like auxin-responsive protein family  "}],"sieverID":"ca727f5c-3c46-4b85-8cb7-9a42eaf32bff","abstract":"C assava (Manihot esculenta Crantz) is the primary source of carbohydrates for >1 billion people, including the poorest on the African continent. Cassava production is particularly vital to the economy of Nigeria, the world's leading producer of cassava, since a decline of cassava yield can lead to household food and income insecurity.Most often, the yields on smallholder cassava farms are relatively low due to viral diseases and cassava green mite [CGM, Mononychellus tanajoa (Bondar)] pest infestation. Cassava green mite is a dry-season pest that feeds by inserting their piercing and sucking mouthparts (chelicerae) into the abaxial surface of cassava"}

data/part_1/051cf333b704eaf14056bbe04fd0ba4b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"051cf333b704eaf14056bbe04fd0ba4b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/34d92e4c-39b2-47aa-ad85-691876140d03/retrieve"},"pageCount":23,"title":".","keywords":["MXI!","NTRfIioe","LA tlUJ:l:lI..J'!a CONTXI!Nl!' 37% OP.: LOTl\":1\"\"I CON ~HJR\"con PF:PP:CHO!5. '''>1'':"],"chapters":[{"head":"Introducción","index":1,"paragraphs":[{"index":1,"size":4,"text":"Antecedentes CENTRO Dt DOClJMENTACIOIll"},{"index":2,"size":64,"text":".;¡ Adrian Maitre En la zona frijol era de San Gil se observan procesos erosivos fuertes, ocasionados por el agua y por el viento 2 • Durante recorridos en la zona por parte de integrantes del CIAT y del ICA~. se ha observado una práctica de siembra que facilita la erosión y que es la orientación de surcos en el sentido de la pendiente."},{"index":3,"size":57,"text":"En el semestre 1991A se han iniciado trabajos agronómicos, dirigidos a controlar la erosión. Dentro de estos trabajos se está incluyendo como factor la orientación de los surcos. Se quiere comparar la supuesta práctica del agricultor (surcos en el sentido de la pendiente) con la práctica recomendada por la investigación (surcos atravesados o por lo menos inclinados)."},{"index":4,"size":3,"text":"~ ______________ -J"},{"index":5,"size":65,"text":"Sin embargo, na Siempre los agricul tor'es siembran en el sentido de la pendiente. 4 En los campos de agricultores se observa tanto la siembra en el sentido de la pendiente como en un ángulo distinto (inclinaélo o atravesado). Existen, entonces, dos gr\".pos de agricultores. El primer grupo que observa la medida de conservación de suelos (surcos inclinados/atravesados) y el segundo que no la observa."},{"index":6,"size":5,"text":"• Objetivos del Estudio 1."},{"index":7,"size":30,"text":"Se quiere conocer las razones que tienen los agricultores del grupo 1 (quienes ':Con.servan el suelo\") y las que tienen los agricultor'es del grupo 2 (quienes \"no conservan el suela'I)."}]},{"head":"2.","index":2,"paragraphs":[{"index":1,"size":28,"text":"Se intenta averiguar si hay una relación entre la orientación de los surcos y el porcentaje de la pendiente de los lotes o el tipo de suelo encontrado."}]},{"head":"Hipótesis","index":3,"paragraphs":[{"index":1,"size":11,"text":"En cuanto formulado a los dos primeros objetivos las siguientes hipótesis:"},{"index":2,"size":5,"text":"del estudio se han 1."},{"index":3,"size":24,"text":"Las ag r i c:u 1 tores tener la siembra conocen el efec to nega ti VD que en el sentido de la pendiente."},{"index":4,"size":2,"text":"puede 2."},{"index":5,"size":21,"text":"Los agricultores quienes siembran en el sentido de la pendiente lo hacen para facilitar las subsiguientes labores culturales (deshierbe y aporque)."}]},{"head":"3.","index":4,"paragraphs":[{"index":1,"size":35,"text":"No hay interacción entre la orientación de los surcos y algún otro aspecto pertinente del lote (como pendiente, tipo de suelo). La orientación de los surcos depende, entonces, ónicamente de la decisión de los agricultores."}]},{"head":"Metodologia","index":5,"paragraphs":[{"index":1,"size":5,"text":"El estudio se basa en:"},{"index":2,"size":11,"text":"(1) La observación directa de lotes de frijol (con pet1diente) (2)"},{"index":3,"size":72,"text":"Una encuesta corta a 105 agricultores Se han visitado 28 agricultores (y 30 lotes) en los muniCipios de San Gil (16) Y Villanueva (12).  (3) lotes con surcos de una orientación intermedia (\"inclinados\"). No se ha buscado obtener un dato sobre la distribución real de los tres grupos en la zona frijolerao. La meta más bien era tener un número suficientemente grande de cada categoria para poder comparar entre los grupos ."}]},{"head":"2.","index":6,"paragraphs":[{"index":1,"size":7,"text":"Orientación de surcOS y grado de pendiente"}]},{"head":"I i","index":7,"paragraphs":[{"index":1,"size":159,"text":"Partiendo de la hipótesis (3) que descarta la influencia del grado de pendiente sobre la decisión del agricultor de sembrar en una determinada forma, se agruparon los 30 campos visitados en las siguientes categorias: A parte de esto, no fue posible tampoco detectar otro aspecto de los lotes que haya podido explicar la decisión sobre como orientar los surcos. En cuanto a los suelos encontrados en los lotes visitados, no se ha podido detectar una influencia sobre la orientación de los surcos. Todos los suelos son de textura suelta y de un drenaje rápido. La estructura de los suelos es generalmente (861.) de bloques (angulares y subangulares). Los pocos casos (141.) de suelos de estructura granular se encuentran en los tres grupos de orientación de surcos (D, 1 p.3ra la Forma de siembra Razón Atravesado 1 1 Para evitar que el aguacero se lleve la tierra 2) Si no, corre el agua y arranca las matas y el abono"},{"index":2,"size":22,"text":"3) Es mejor porque el ª.gua se atranca cuando llueve recio 4) Asi dieE!n qUE! es mejor, p\",ro es maluco para tr.3bajar"},{"index":3,"size":57,"text":"Inclinado 1) El agua se gueda, se conserva la humedad 2) Si no, el agua se lleva la tierra y las matas 3) Si no, el agua se lleva el abono 4) Para evitar que el aguacero se lleve I la tierra Derecho 1 ) Mejor para el deshierbe ( y otras labores culturales) -----------------------------------------2  , ."},{"index":4,"size":113,"text":"• pal abras, los agr icu 1 tores quienes siembran derecho no lo hacen por la falta de percepción del fenómeno de procesos erosivos. Tampoco la hay en cuanto a las medidas propuestas por los agricul tares para controlar la erosiÓn. En ambos grupos se mencionaron principalmente las siguientes soluciones: (i) la siembra en surcos atravesados, (ii) la elaboración de zanj as de desviación y (i ii) 1 a siembra de árboles (véase anexo 4). Entonces se comprueba la hipótesis que la decisión discutida dep',\",flde princ:ipalmefl\"te de~so rela1::,,~vo que tiene ,PE!::,.\"\" el aqricul tor la me,flgr incomodi<J\"ad <tel trabajo por un .... Jado, y la reducción de los procesos erosivos por otro lado."},{"index":5,"size":55,"text":"En este contexto es importante recordar nuevamente qUE> el porcentaje de siembras \"derechas\" en la realidad no es tan alto como en el estudio (37X), en el cual se ha estratificado la muestra, aumentando de esta manera el porcentaje de lotes con surcos derechos. En la zona, sin embargo, se ha observado solamente en aproN."},{"index":6,"size":36,"text":"10X de, los casos lotes con surcos derechos.• Entonces, no deb~rta preocuparnos tanto el efecto de las prácticas de siembra 'de los agricultores sobre la erosión. Pero cómo es el caso de la preparación del terreno?"}]},{"head":"4.","index":8,"paragraphs":[{"index":1,"size":8,"text":"La preparación del terreno con tractor 1 0"},{"index":2,"size":79,"text":"Mientras la siembra se realiza a mano, se efectúa la preparación del terreno con tractor. A diferencia de la siembra hecha por el mismo agricultor (o sus trabajadores), los tractores son manejados por tractoristas extraños a la finca. Como en el caso de la siembra, se quiso conocer en Que sentido el tractor realizaba la arada (y la rastrillada).~Q  En base a los datos sobre la siembra y la preparación de la tierra llegamos a la siguiente conclusión 1."},{"index":3,"size":19,"text":"A diferencia de la siembra con surcos derechos que se observa en un porcentaje relativanl~rlle baju de los ca~c)s"},{"index":4,"size":16,"text":"(aprox, 101.), se realiza gran parte (92%) de las aradas en el sentido de la pendiente."},{"index":5,"size":1,"text":"2."},{"index":6,"size":50,"text":"La decisión la agricultores). toman tractoristas (según los 3, En muchos lotes se siembra dos '\"Vec.es al año frijol, lo que implica dos aradas por año. No es raro encontrar campos que vienen siendo cultivados con frijol desde hace varios años, resul tanda un número correspond iente de aradas seguidas."}]},{"head":"4.","index":9,"paragraphs":[{"index":1,"size":11,"text":"Les agricultores, en su mayoria (79X), consideran esta practica como necesaria."}]},{"head":"5.","index":10,"paragraphs":[{"index":1,"size":82,"text":"El frecuente uso del tractor tiene efectos ... neqa.\\:ivos? tropicales y templados\"\"'. En este contexto han sido introducidos los conceptos de \"labranza minima\" y de \"cero labranza\". En una oportunid.ad se ha identi fic.ado la acción del tractor (arada en el sentido de la pendiente) como el elemento más d.añino en cuanto a la conservación del suelo y de su fertilidad en l.a zon.a de San Gil~3. Y los agricultores? Cuál es la percepción de ellos al respecto? Veámos el cuadro B."},{"index":2,"size":12,"text":"Arar l.a tierra con frecuencia tiene algún efecto negativo? Agricultores Si 581."}]},{"head":"No","index":11,"paragraphs":[{"index":1,"size":2,"text":"Cuadro 8"},{"index":2,"size":118,"text":"Casi 6 agricultores de cada 10 perCiben un efecto negativo de la arada frecuente, lo que contrasta con el dato anterior sobre la necesidad de la misma arada (cuadro 6) .'. Ahora, después de 10 años del \"milagro\" del frijol, se ha iniciado la discusión sobre los efectos ecológicos negativos del cultivo permanente de frijol:l.C\" Parece interesante que los mismas agricultores -o mejor dicl\"lO una ligera mayoría de ellos-observan algunos efectos negativos en la arada permanente. Sin embargo, las opiniones son divididas. Hay quienes insisten en que el cultivo de frijol (+ gallinaza + t~actor) ha abierto el paso a la siembra de otros cultivos (como tabaco y maíz) en campos que antes no habian podido ser sembrados."},{"index":3,"size":172,"text":"Los ag~icultores han invertido la riqueza adicional creada por el cultivo de frijol en la mejora de su nivel de vida (electrodomésticos, vehículos, compra de fincas) y no en el • que si hay problemas ecológicos\"?', los agricultores de San Gil han realizado en el pasado \"soil mining\" (explotación del suelo) para mejorar su nivel de vida. Y este \"soll míning\" lo han hecho en tierras que an tes eran de poco uso y dI? poco valor. Esto es una situación muy distinta a la de un recurso natural (suelo) que ha sido de mucha utilidad primero y que después se iba deteriorando por mal manejo  Entre los tres grupos de lotes con orientación distinta de los surcos (0, 1, A) no SE? ha podido encontrar' \\,Jna diferencia grande en la densidad de siembra. Varía un poco la distancia entre surcos, pero con los ligeros cambios entre sitios se impide ver una tendencia entre lbs tres grupos. Beltrán (1990)  encontró un dato comparable en un proyecto de seguimiento a parcelas de agricultores."},{"index":4,"size":1,"text":":"},{"index":5,"size":11,"text":"\" u \" e o . . (no entra el sol)"},{"index":6,"size":8,"text":"La planta necesita que entre el viento 97."}]},{"head":"Cuadro 12","index":12,"paragraphs":[{"index":1,"size":47,"text":"Los agricultores quienes piensan que seria posible aumentar la densidad de siembra, siempre tienen sus reservaS: \"Si llueve bastante\", Il pero en verano se acaloran las plantas 'l , Iltal vez sale más menudo (el grano), pero hay que fertiliza!'\" bien\", son algunos comentarios hechos por ellos."},{"index":2,"size":25,"text":"En otras palabras, agricultor entrevi~tado está realmente convencido de que se podría aumentar la densidad de siembra .. pero en este contexto se trata de:"},{"index":3,"size":28,"text":"(ii ) una época seca que se presenta dentro de un ciclo cultivo, fenómeno que se presenta inesperadamente y forma parte de los riesgos que deben enfrentar agricultores."}]},{"head":"de que los","index":13,"paragraphs":[{"index":1,"size":76,"text":"Entonces en el verano -según la definición (ii)-, las plantas compiten por la poca humedad q.ue queda disponible y entre más cerca estén sembradas las plantas vecinas, mayor es la posibilidad de que se acaloran {\"las hojas duermen\", \"la mata se seca\")~ el 50% de los agricultores quienes no están de acuerdo con una densidad de siembra más alta, llegaron a este punto de vista en base a pruebas realizadas por ellos mismos. Los demás (50%)"},{"index":2,"size":68,"text":"o 10 han visto donde un vecino o saben l!antiguamente H que no se puede aumentar la densidad. Los que si hicieron una prueba con una densidad más alta, coinciden en que no era adecuada esta práctica. 80% observaron una merma en la cantidad y calidad de la producción, 40% manifiestan que se habían acalorado las plantas y al 25% se le presentaron dificultades en el deshierbe> ."},{"index":3,"size":2,"text":"Anexo 3"},{"index":4,"size":6,"text":"P~eparación del te~reno con tractor 1."},{"index":5,"size":37,"text":"El tractor se emplea solamente en la preparación de la tierra (arada y rastrillada). Como son muy pocos los agricultores que poseen tractor, tienen que contratar a tractoristas. Hay tres tipos de tractoristas operando en la zona:"},{"index":6,"size":9,"text":"Tracto~istas particulares de la zona Tractoristas de la cooperativa"},{"index":7,"size":1,"text":"(1)"},{"index":8,"size":9,"text":"Tractoristas de otra zonas (m*s que todo de Boyacá)"},{"index":9,"size":1,"text":"2."},{"index":10,"size":23,"text":"En 1990 se sembró frijol en 6.000 has., 3.600 has. en la siembra de año (1990A) y 2.400 has. en la atraviesa (1990B)."},{"index":11,"size":62,"text":"Esto significa unas 28.800 horas de uso de tractor en 1990A y otras 19.200 horas en 1990B, o sea un total de 48,000 horas\"'-'-. La hora de tractor vale 53. 500/hora\"'''' , lo que dá un monto de 5100'800.000. en 1990A y 567'200.000. en 1990B. o sea un valor total de 5168'000.000. en el año a nivel de toda la zona frijolera."}]},{"head":"3.","index":14,"paragraphs":[{"index":1,"size":97,"text":"Una buena parte de este dinero sale de la regiÓn debido a la presencia de tractoristas de Boyacá. A parte de la Inano de obra adicional que obtienen los productores de frijol de San Gil en otr-<lS zonaS de la provincia (p.e. Mogotes) y de la gallinaza pr-oducida en galpones cerca de Bucaramanga, este es el tercer factor económico que implica un flujo importante de valores hacia fuera de la zana~ Actualmente las cooperativas de Villanueva y 8arichara están gestionando la compra de maquinaria agricola adicional, lo que les permitiría participar más en este sector de servicíos_"}]},{"head":"4.","index":15,"paragraphs":[{"index":1,"size":107,"text":"Los agricultores dependen actualmente casi en su totalidad del servicio prestado por Jos tractor-istas. Con la introducción de Jos tractores y la desaparición de la yunta de bueyes, perdieron la \"autonomia\" en cuanto a la preparación de la ti\",rra a cambio de una labor más eficiente que permitió a desaparecer la yunta de bueyes. Hoy se observa en la zona frijolera de San Gil solamente un número reducido de yuntas~ Tal vez una en el municipio de San Gil, posiblemente ninguna en el municipio de Villanueva y no más de 10 en el municipio de Barichara (veredas de San José Alto, El Salitre y Parami to) ."},{"index":2,"size":40,"text":"En algunas partes del area de estudio no es posible el uso del tractor, sea por una pendiente demasiado fuerte o sea por la presencia de piedras grandes en el lote. En este caso la preparación del terreno es manual."}]},{"head":"• Anexo 4","index":16,"paragraphs":[{"index":1,"size":69,"text":"Erosión y medidas de control según los agricultores \" , La gran mayoría de los agr~cul tares está famil iarizado con el fenómeno de erosión, aunque no todos utilizan esta misma palabra. 92% de los agricultores quienes han identificado procesos erosivos en su finca manifiestan que el agua no solamente se lleva la tierra,. si no qUE.? puede afectar la prodL1cción ~or!!I.5~~.~~.f.L!~tEl (mediante pérdidas de abono y plantas principalmente)."},{"index":2,"size":18,"text":"Cuáles son las medidas de control propuestas por los agricultores? Medidas de control de erosión (Según los agricultores)"},{"index":3,"size":6,"text":"Hacer zanjas (de drenaje, desviación) 60¡:"},{"index":4,"size":3,"text":"Sembrar inclinado/atravesado 50/."},{"index":5,"size":65,"text":"Sembrar árboles 25% Cuadro 13 ..... _ ...... ~-----._----Llama la atención que el establecimiento de ocupa el primer lugar. Se trata en muchos casas de zanjas en la parte alta del lote, lo que deberia reducir la cantidad de agua que entra en el campo. También se pueden ver zanjas que pasan por todo el lote, recolectando y desviando al agua producida an lluvias fuertes."},{"index":6,"size":68,"text":"En una zona relativamente seca, con una distribución írregular de la precipitación, 10s agricultores están sujetos tanto al daño ocasionado por la falta de humedad cl¡~mc también al daño causado oor el exceso de humedad. Sin embargo, la solución actual para el segundo problema podría aliviar el primero: Al almacenar El agua de las lluvias tormentosas, se podría contar con una forma sencilla de riego en semanas secas5~~ "}]}],"figures":[{"text":"D \"Derecho\", o sea los surcos van en el sentido de la pendiente A \"Atravesado\", o sea los surcos cortan la pendiente en aprox. 90° 1 \"Inclinado\", o sea una inclinaciÓn intermedia entre O y surcos sea directamente influenciada por la pendiente de 1 lote. Sin embargo. se observa que los lotes sembrados completamente atravesados tienen un límite superior menor (321.), comparado con los campos sembrados inclinados zona, a partir de una cierta inclinación del terreno (aprox. > 301.) escogen solamente entre Del y ya no siembran completamente atravesado6~ "},{"text":" Et... TRACTOR BOLAI\"le:N'fe: AR:A BAJANDO EL LOTt!. De:sPuJil::S SUElrz PA~A 'TRASLADARSE AL ~R6x~MO e1T~O %N1CEAL y OTRA VEZ ARA aAJANDO. principales en favor de la arada se encuentran las siguientes:La tierra queda muy dura (después de una siembra) Por la maleza El frijol no produce sin arar Para que la tierra coja "},{"text":" manejo sostenible de las tierras recién abiertas para el cultivo. En otras palabras, y siempre partiendo del supuesto AQuí NO INFLUY~ LA ~STRAT~FXCACIÓN De LA MUESTRA. LA HISTORXA DEL LOTE NO DEPeNDE DE LA ORIENTAcx6N DE Loa SURCOS. "},{"text":" seca en tre dos épocas 11 uv iosas, fenómeno que ocurre con regularidad entre díLiembre y marzo cada año y por lo tanto es ¡:E':,evi\",ible\" "},{"text":" extender la frontera agricola. Hace més o menos 20 a~os empezó EL C~LCULO SE HACE EN BASE A 8 HORAS DE TRACTORADA POR HECT~R~A. "},{"text":"EXISTEN ACTUAL.r-:ENTE EN LA ZONA PROYECTOS FOI'1E\".ITADOS POR EL SEPAS, ClUE aUSCAN FORMA6 DE UN ME~OR USO DEL AGUA DE LLUVIAS. ALGUNOS AOPICULTORESJ POR E~EMPLO, y~ HAN XNVBRT~DO EN LA CONSTAUCC10N DEJAWEYES. "},{"text":"DEC:IR QUE PRECJ:SAI'IENTE Et-.I EL CASO DE LAS PENDIENTES l\"lAYQRES NECEeXTA~iAN Loe SURCOS ATRAVESADOS. SZN EI'1BAROO, LA LABOR DEL APORQUE SE D2FZCULTA BASTANTE EN CUANTO AL AMONTONAR LA TIERRA DESDE LA PARTE BA~A. ADEl'lÁs LA POSI:CIÓN DEL TRABA.3ADOR QUEDA MUY INCOMODA.   y Al. La ¡::JLfl .. f.y.ndidad_ de los suelos oscila entre 0.5 y 0.8 m y y Al. La ¡::JLfl .. f.y.ndidad_ de los suelos oscila entre 0.5 y 0.8 m y  es la misma en los tres casos de or-ientación de surcos. es la misma en los tres casos de or-ientación de surcos.  Tampoco se puede distinguir una tendencia en cuanto al color- Tampoco se puede distinguir una tendencia en cuanto al color-  de los suelos, que es generalmente pardo ó amarillo. de los suelos, que es generalmente pardo ó amarillo.  Entonces, es oportuno preguntar a los mismos agrícultor-es cÓmo Entonces, es oportuno preguntar a los mismos agrícultor-es cÓmo  justi f iean ellos su decisión de sembrar en una determinada justi f iean ellos su decisión de sembrar en una determinada  forma? forma? •  • 3. Razones que tienen los aqricul tares para 1.3 orient.3cíón de los 3.Razones que tienen los aqricul tares para 1.3 orient.3cíón de los  surcos surcos  Los agricul tares indicaron las siguientes razones Los agricul tares indicaron lassiguientes razones  siembra en una determinada forma (eu.3dro 2). siembra en una determinada forma(eu.3dro 2). •  •  Se: , PODRIA Se:, PODRIA  De: 301. se: De:301. se:  "},{"text":"prácticamente son las mismas y tienen que ver por un lado~ con  ) Para que el aguacero fuerte no ) Para que el aguacero fuerte no arrastre el cultivo arrastre el cultivo Las pr in ci po>'! es razones para sembrar a trav §'..5_acJe:>. o Las pr in ci po>'! es razones para sembrar a trav §'..5_acJe:>. o la intención de evit.3r o reducir 1.3 pérdida de SLU?lo, el la intención de evit.3r o reducir 1.3 pérdida de SLU?lo, el  "},{"text":" del abona y las dañas al cultivo y por otro lado, con el manejo de la humedad del suelo.La principal justificación de sembrar derecho, sin embargo tiene que ver con el deseo de reducir la incomodidad en las labores culturales. El deshierbe, por ejemplo, queda más fácil para el trabajador-de campo, si no se encuentra en una posición inclinada el mismo.7    Los agricultores quienes siembran atravesado a inclinado conocen bien la razÓn principal en favor de la siembra \"derecha\" (labores culturales más fáciles). Así lo muestra la razÓn 114 ft dentro del grupo I!Atravesado\" y asi lo han aclarado los agricultores con comentarios adicionales. Pero cÓmo es en el caso contraria? Qué opinión tienen los agricultores quienes siembran derecho sobre los procesos erosivos? El siguien te cuadra nos puede indicar si hayo na una diferencia en el pensamiento entre los dos grupos (O por un lado y A/I por otra 1 ado) . •            •   I siembran:       en mi finca en mi finca I siembran:en mi fincaen mi finca   Derecho         7 2 , Derecho72,   Atravesado f       Atravesado f   lncl inado        lncl inado   Cuadro 3          Cuadro 3   Na hay diferencia significativa en la percepción del fenómeno Na hay diferenciasignificativa en la percepción delfenómeno   de erosión entre  los das grupos de agricultores e . En otras de erosión entrelos das grupos de agricultores e .En otras   SlJPUESTAMENTE ANTIECOLÓO:ICA SE ,..UEOE OBSERVAR TAI'1Bl:~N EN LA S%ER/Q'A SlJPUESTAMENTEANTIECOLÓO:ICASE,..UEOEOBSERVARTAI'1Bl:~NENLAS%ER/Q'A   PERUANA, DONPE Loa  CAI\"lPESl:NOa,  A VECES ANTXCXPANDO UNA .tPOCA MUY PERUANA,DONPELoaCAI\"lPESl:NOa,AVECESANTXCXPANDOUNA.tPOCAMUY   LLUV10I!3A, CAMlJ1AN LA OA'lI!';NTAClÓN pI!'; LOe. eUACOe. EN CL ee:NT1DO Pe: LA LLUV10I!3A,CAMlJ1ANLAOA'lI!';NTAClÓNpI!';LOe.eUACOe.ENCLee:NT1DOPe:LA • . . PENDII!:NTE\" 8EOÚN LLEVA LA 'lERRA, e l NO A LA VEZ E5TÁ AFECTANDO LA PRODUCCIÓN, SE LLeGA •. .PENDII!:NTE\" 8EOÚN LLEVA LA 'lERRA,e l NO ALA VEZ E5TÁ AFECTANDO LA PRODUCCIÓN,SE LLeGA  "},{"text":" EaTA OBSERVACIÓN eH! Fte:f:\":rERE Al.. eeMESTRE 1991A .. SIN EMBARGO, EN f)ASE; A De quién depende la decisión sobre la or'\"ientaciÓn de la arada (según los agricultores)En muchos campos de la zona frijolera de San Gil y Villanueva se viene sembrando frijol tras frijol desde hace varios años (véase anexo 1). Como se hace la preparación del terreno antes de cada una de las dos siembras de frijol, resultan dos aradas Orientación de la Arada con Tractor    Orientación de la Arada con Tractor   Atravesado  I   Oí'.   AtravesadoIOí'.   Inclinado     4%   Inclinado4%   Derecho      96%   Derecho96% •             •   Cuadra 4         Cuadra 4 Indistintamente de la orientación de las surcos en la siembra, Indistintamente de la orientación de las surcos en la siembra, se realiza la arada practicamente en todos los casos en el se realiza la arada practicamente en todos los casos en el sentido de la pendiente y únicamente baJando 1 1 • sentido de la pendiente y únicamente baJando 1 1 • Según los agricultores, los responsables de la decisión de Según los agricultores, los responsables de la decisión de CÓmo arar son en primer lugar 105 tractoristas mismos. Las CÓmo arar son en primer lugar 105 tractoristas mismos. Las tractor istas temen el vo 1 camien to de 1 a maquinar ia. razón tractor istas temen el vo 1 camien to de 1 a maquinar ia. razón fácilmente entendible. Pero también en los casos de fácilmenteentendible.Perotambiénenloscasosde agricultores quienes manifiestan poder indicar al tractorista agricultores quienes manifiestan poder indicar al tractorista cómo arar, la arada se efectuó bajando (en el sentido de la cómo arar, la arada se efectuó bajando (en el sentido de la pendi en te) .           pendi en te) .  Tractorista        83%  Tractorista83%        !      !  Dueño del terreno      13%  Dueño del terreno13%  Cosechero         4%  Cosechero4%  Cuadro 5           Cuadro 5 UN DATO OaTI:'!N'1l)O EN !!:L 1!.:5TUDXO, eu~: PUEDE SUPONER QUí!!: NO HA\";\"'\" MUCHO UNDATOOaTI:'!N'1l)OEN!!:L1!.:5TUDXO,eu~:PUEDESUPONERQUí!!:NOHA\";\"'\"MUCHO CAMSXO AL ReSPECTO EN Loe ~LTZMoe SE~IEeTREa. por año y varias aradas seguidas en muchos lotes. Se le EL DATO ~~ EL SIOUZENTa: CAMSXO AL ReSPECTO EN Loe ~LTZMoe SE~IEeTREa. por año y varias aradas seguidas en muchos lotes. Se le EL DATO ~~ EL SIOUZENTa: UN ALTO PORCENTAJE: DE Loe AGFtICUl..TORE5 (81 .. 5%) INDICAN qUE ~~\":1. MAaÍAN preguntó a los agricultores, si esta pri'lctica (arada UN ALTO PORCENTAJE: DE Loe AGFtICUl..TORE5 (81 .. 5%) INDICAN qUE ~~\":1. MAaÍAN preguntó a los agricultores, si esta pri'lctica (arada CAMEIADO LA MANERA DE SEMBRAR DESDE aue: HABíAN COMENZADO A CULTIVAR EL frecuente) era inevitable. CAMEIADO LA MANERA DE SEMBRAR DESDE aue: HABíAN COMENZADO A CULTIVAR EL frecuente) era inevitable. LOTE ..            LOTE .. EN ALOUNOS CAeoa (13%), LA PR!!PAAACl:ÓN DEL TERRf;t-IO se:: HIZO A l'1ANQ ~ POR EN ALOUNOS CAeoa (13%), LA PR!!PAAACl:ÓN DEL TERRf;t-IO se:: HIZO A l'1ANQ ~ POR SUPUESTO NO se HA lNCLUfoo ESTOS CAsoe EN LA SXOUIENTE OISCUS:rÓN SOBRE: SUPUESTO NO se HA lNCLUfoo ESTOS CAsoe EN LA SXOUIENTE OISCUS:rÓN SOBRE: LA ARADA CON TRACTOR.         LA ARADA CON TRACTOR.  "},{"text":"estas tierras, permitiendo ingresos adicionales que Estas obse~vaciones de un g~upo de los agriculto~es parecen coincidir con la observación técnica hecha por el especialista de suelos. Vale la pena conocer la opinión del otro grupo de agricultores quienes no ven algo dañino en el uso frecuente del tractor. Ellos manifiestan que el tractor más bien ar~egla la tierra, la vuelve cultivable. Qué hay detrás de este punto de vista? lejos de recompensar solamente por las pérdidas en el  Como lo muestra el anexo 1, los lotes visitados vienen siendo Como lo muestra el anexo 1, los lotes visitados vienen siendo  cutivados desde hace pocos años. Solamente en dos casos los cutivados desde hace pocos años. Solamente en dos casos los  agricultores indicaron que se había cultivado \"siempre\" el agricultores indicaron que se había cultivado \"siempre\" el  lote. Este dato obtenido en el estudio representa bien la lote. Este dato obtenido en el estudio representa bien la  realidad en la zona.~o Antes de la introducción espontánea realidad en la zona.~o Antes de la introducción espontánea  del cultivo de frijol, muchos campos no habían sido delcultivo defrijol,muchoscampos nohabíansido  cultivados, tratándose mas bien de \"sabanas H o \"desiertos H cultivados, tratándose mas bien de \"sabanas H o \"desiertos H  apenas aptas para el pastoreo. Debido al cambio tecnológico apenas aptas para el pastoreo. Debido al cambio tecnológico  (frijol + gallinaza + tra(tor) realizado por los mismos (frijol + gallinaza + tra(tor) realizado por los mismos  agriculto~es después de la \"caída\" del tabaco hace agriculto~esdespuésdela\"caída\"deltabacohace  aproximadamente 10 años, se ha podido extender la frontera aproximadamente 10 años, se ha podido extender la frontera  agrícola. Este fenómeno implicó, por un lado, una mejora en el agrícola. Este fenómeno implicó, por un lado, una mejora en el  nivel de vida de los agricultores y por otro lado un aumento nivel de vida de los agricultores y por otro lado un aumento  en el valor de las tierras. Entonces, compartiendo la en el valor de las tierras. Entonces,compartiendo la  perspectiva del agricultor se t~ató en los últimos años de perspectiva del agricultor se t~ató en los últimos años de         4 Cuáles 4 Cuáles  son 1 as observaciones más importantes que han hecho los son 1 as observaciones más importantes que han hecho los  agricultores que si perciben un efecto negativo? agricultores que si perciben un efecto negativo?     Se lI es teriliza'! la tie>rra, la Se lI es teriliza'! la tie>rra, la     tierra tiene menos fuerza 43i'. tierra tiene menos fuerza43i'.     La tierra se vuelve más fina, La tierra se vuelve más fina,     más polvosa  211. más polvosa211.     La tierra se suelt.a más La tierra se suelt.a más   Cuadro 9     Cuadro 9 ,,'\" LAL 1989.     ,,'\"LAL 1989.  PUNTO De: \\,lleTA QUE HA EX\"\"A'ESADD ALVARO GÓMEZ (CENICAFE), EN UNA V¡Sl:TA PUNTO De: \\,lleTA QUE HA EX\"\"A'ESADD ALVARO GÓMEZ (CENICAFE), EN UNA V¡Sl:TA  A LA ZONA (JORGE ALON,,\"O BELTRÁN, COMUNICACX~N PE!lqSONAL) .. ALA ZONA(JORGE ALON,,\"O BELTRÁN,COMUNICACX~N PE!lqSONAL) ..  "},{"text":"tabaCD 1 han venido mejorando la economía rural.   "},{"text":"t va DE. 1\"l'1li1: JOL y I o DE: SU MA\"'ft,JO. SE TRA'T A MÁe: SI EN DE EROSIÓN NATURAL.. Eso NO mUIERE DEC:IR QUE NO SE PUEDE o NO BE DEBE HACER ALoa PARA RECUPERARLOS.    2. d) Otras característícas de los lotes vísitados Dueños y Ubicación de los lotes: 2. d)Otras característícas de los lotes vísitados Dueños y Ubicación de los lotes: • • • No. • sustainable tecnologias c;¡ i l. 1990. ~lanuscrito. Lal, Rattan. Conservation tillage for Bibliografía Beltrán, Jorge Alonso. Evaluación de Caso del sistema de fríjol en San 1990. Tropics ve~sus temperate environments. 42, 1989: 85-197. ~: Advances agriculture: CIAI. in Agronomy, CABE MENC;tOt-IAA mUE 1...06 e:rT:¡OS ~ EA05:IONAPOe DE LA ZONA NO LO SON POR CUL.\"'A DE:L o • 3 4 a _ • _a NUMERO DE ANOS b) DESDE CUANDO BE ESTA SEMBRANDO FRIJOL? • 234~1!\"8' _3 NUMERO DE ANOS muot. TIIJNX) 'ruOA _ PMIO _. CULTIVOS ANTERIORES CAMPANA 19908 el) CUALES HAN SIDO LOS CULTIVOS ANTERIORES EN 199OA? FfIJOL TNJN;O YUOA MAIZ PMl'O _8 CULTIVOS ANTERIORES CAMPANA 1990A _. \"\"\" CULTIVO < 0.25 ha. 4 0.25 ha. 8 0.50 ha. 7 0.75 ha. 4 1.00 ha. 3 > 1.00 ha. 3 29 Media del tamaño, 0.57 ha. el La visita a los lotes se ha efectuado cuando el cultivo de frijol estaba entre R7 y R8 • CUL T:Anexo 1 1. C) CUALES HAN SIDO LOS CULTIVOS ANTERIORES EN 1990B? .) QUE PIENSA 8EMBRAR EN LA ATRAVIESA? al En 401. de los lotes se encont~ron árboles en los bordes . Historia de los lotes visitados b) Tamaño de los lotes 1ef : .) DESDE CUANDO SE ESTA CULTIVANDO ESTE LOTE? AGRICULTORES VEREDA :MUNICIPIO : • • •No.• sustainable tecnologias c;¡ i l. 1990. ~lanuscrito. Lal, Rattan. Conservation tillage for Bibliografía Beltrán, Jorge Alonso. Evaluación de Caso del sistema de fríjol en San 1990. Tropics ve~sus temperate environments. 42, 1989: 85-197. ~: Advances agriculture: CIAI. in Agronomy, CABE MENC;tOt-IAA mUE 1...06 e:rT:¡OS ~ EA05:IONAPOe DE LA ZONA NO LO SON POR CUL.\"'A DE:L o • 3 4 a _ • _a NUMERO DE ANOS b) DESDE CUANDO BE ESTA SEMBRANDO FRIJOL? • 234~1!\"8' _3 NUMERO DE ANOS muot. TIIJNX) 'ruOA _ PMIO _. CULTIVOS ANTERIORES CAMPANA 19908 el) CUALES HAN SIDO LOS CULTIVOS ANTERIORES EN 199OA? FfIJOL TNJN;O YUOA MAIZ PMl'O _8 CULTIVOS ANTERIORES CAMPANA 1990A _. \"\"\" CULTIVO < 0.25 ha. 4 0.25 ha. 8 0.50 ha. 7 0.75 ha. 4 1.00 ha. 3 > 1.00 ha. 3 29 Media del tamaño, 0.57 ha. el La visita a los lotes se ha efectuado cuando el cultivo de frijol estaba entre R7 y R8 • CUL T:Anexo 1 1. C) CUALES HAN SIDO LOS CULTIVOS ANTERIORES EN 1990B? .) QUE PIENSA 8EMBRAR EN LA ATRAVIESA? al En 401. de los lotes se encont~ron árboles en los bordes . Historia de los lotes visitados b) Tamaño de los lotes 1ef : .) DESDE CUANDO SE ESTA CULTIVANDO ESTE LOTE? AGRICULTORES VEREDA :MUNICIPIO :    13 \". 13 \".  "},{"text":" ~S N • • _ 0' ____________________ ~ __ ~ _____ 1_5_Y._. ________ ~    Se podría aumentar la densidad de siembra Se podría aumentar la densidad de siembra    (encontrada en los lotes visitados)? (encontrada en los lotes visitados)?    I  85% I85%   La gran mayoría rechaza la idea de aumentar la densidad de La gran mayoríarechazala idea de aumentar la densidad de   siembra en base a las siguientes razones (se indican las siembra en basea lassiguientes razones (se indican las   principales):   principales):  - Si llega el verano, se ar:alol\"\"an las plantas •199<;;-557. -Si llega el verano, se ar:alol\"\"an las plantas•199<;;-557. DJ..t4l;n<;11< . n t r . .... reo. (cm.) -(En verano) produce menos por planta 66 .. & 70 .. ;!\\ D1..t .... nci • • rtt,... .tt1ow ( c-m .. } 30~;;;:: :::8.0 -El deshierbe es más dificil 71 \" Ie\\ ::9.;;:: I ! 70 .. 0 27\"1. 30 .. 1 14% ! ! DJ..t4l;n<;11< . n t r . .... reo. (cm.) -(En verano) produce menos por planta 66 .. & 70 .. ;!\\ D1..t .... nci • • rtt,... .tt1ow ( c-m .. } 30~;;;:: :::8.0 -El deshierbe es más dificil71 \" Ie\\ ::9.;;::I !70 .. 0 27\"1. 30 .. 1 14%!! t>.n.:l.d .... d -En invierno Se pudre I se hiela 2Q d . 99 .. 600. 10:1 .. 300. 9~.eOO. <;>':;.900 • 97. t>.n.:l.d .... d -En invierno Se pudre I se hiela 2Q d . 99 .. 600. 10:1 .. 300.9~.eOO.<;>':;.900 • 97. (2 Q r .... no. po, . : l t I o )   ! (2Q r .... no. po, . : l t I o )!  -     - b)  La densidad de siembra encontrada en campos de agricultores b)La densidad de siembra encontrada en campos de agricultores   difiere, sin embargo, de la densidad recomendada por el leA. difiere, sin embargo, de la densidad recomendada por el leA.   El lCA recomienda 60 cms entre surcos y 20-25 cms entre El lCA recomienda 60 cms entre surcos y 20-25 cms entre   sitios. Sembrando 2 granos por sitio, resulta una densidad de sitios. Sembrando 2 granos por sitio, resulta una densidad de   siembra de 133,000 a 166,700 granos/ha, o sea entre 33% y 66% siembra de 133,000 a 166,700 granos/ha, o sea entre 33% y 66%   encima de la densidad \"local\",\"'\" encima de la densidad \"local\",\"'\" cl  En vista de esta diferencia entre tecnología local y clEn vista de esta diferencia entretecnologíalocaly   tecnología recomendada, se le preguntó a los agricultores, sí tecnología recomendada, se le preguntó a los agricultores, sí   se podría aumentar la densidad de siembra encontrada en los 30 se podría aumentar la densidad de siembra encontrada en los 30   lotes visitados. Las respuestas se presentan en el siguiente lotes visitados. Las respuestas se presentan en el siguiente   cuadro:   cuadro:   1 CA V:IENE HACIENDO ENSAYOS DE A.3USTe:: TECNOLÓOICO PARA 1 CA V:IENE HACIENDO ENSAYOS DE A.3USTe:: TECNOLÓOICO PARA   DENSIDAD RECOMENPADA. SIN EMSARQO, NO S~ CUENTA CON MUCHA ACEPTACl6N POR DENSIDAD RECOMENPADA. SIN EMSARQO, NO S~ CUENTA CON MUCHA ACEPTACl6N POR   PAR~E DE ~os AG~ICULTORE6.  PAR~EDE ~os AG~ICULTORE6.  "}],"sieverID":"059199ac-fce2-4a44-add9-67657a005fe6","abstract":""}

data/part_1/0557ac979d2986de0c07219cb4961023.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0557ac979d2986de0c07219cb4961023","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/41cd1f23-afb3-4be1-8245-735aa542a048/retrieve"},"pageCount":7,"title":"News and updates from AfricanBioServices, a European Union-funded research project investigating ecosystem services in the greater Serengeti-Mara ecosystem in eastern Africa","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":78,"text":"On 1 May 2017, we submitted our first periodic report to the European Union (EU). The EU services have already reviewed the submitted report (21 months), and as a part of the review process, the Executive Committee was in Brussels on 12-13 June 2017 to discuss the report with the commission. During the meeting, we were given oral feedback from two reviewers, from our EU project advisor (Christophe Coudon) and from a group of other EU project advisors."},{"index":2,"size":161,"text":"In mid July, the EU gave us formal feedback which was overall positive. We are on the right track, but of course they want us to make a few changes which will be discussed by the Executive Committee and the General Assembly over the next few months. One of the critical remarks was that we need to ensure we achieve sufficient generalization of our predictions; for instance, can other ecosystems (i.e. in Europe) benefit from the extended knowledge from AfricanBioServices? Furthermore, we must ensure that key datasets are uploaded in the relational database as soon as possible because, as discussed above, the database will be a very important output from this project. Everybody must therefore assist us in this effort. Mapping of livestock movement to understand their role in foot-and-mouth disease transmission dynamics has also started in four villages and will be extended to more villages in order to have a comprehensive overview of the movement of livestock in the area."},{"index":3,"size":49,"text":"We plan to initiate a foot-and-mouth disease outbreak monitoring scheme from September 2017 to characterize circulating viruses. Animals suspected to be infected with the disease will be sampled and reported through the official channels. The frequency of outbreaks and factors that may be associated with occurrence will be assessed."},{"index":4,"size":73,"text":"We are grateful to the Maasai farmers who participated in the seroprevalence survey and the local authorities for their assistance in mobilizing the farmers. We look forward to finalizing the remaining work and writing up the publications. The database containing the collected data from these four rounds of surveys, accompanied by a description of the variables, constitutes Deliverable 5.1 that is to be submitted to the EU by the end of September 2017."}]},{"head":"Contributed by Daniel Nthiwa, Silvia Alonso and Bernard Bett","index":2,"paragraphs":[{"index":1,"size":44,"text":"Staff from ILRI and TAWIRI specialized in geographical information systems (GIS) are also working on Deliverable 5.2, which combines spatial data layers collected under Work Package 1 with GIS maps produced from the data collected in the 1000-household survey on dependence on ecosystem services."},{"index":2,"size":46,"text":"Xi and Solomon are currently working on three publications related to household reliance on ecosystem services, illegal grazing in the protected areas, and livelihood strategy choices in relation to road development. Two of these will be presented at the biannual TAWIRI conference scheduled for November 2017."},{"index":3,"size":36,"text":"The University of Copenhagen is grateful to ILRI and TAWIRI for the invaluable assistance received in implementing the household surveys in Kenya and Tanzania. We look forward to finalizing the remaining fieldwork, deliverables and joint publications."},{"index":4,"size":89,"text":"Contributed by Xi Jiao, Solomon Z. Walelign and Martin R. Nielsen How does fire affect the forage of rhinos? Philbert Ngoti defended his Master's project at NTNU in June 2017. His study included identifying the plant species rhinos prefer to eat and examining how these plant species are associated with fire. The black rhinoceros (Diceros bicornis) is a critically endangered savanna species restricted to protected areas representing about 5% of its historical range. In Serengeti, a small population of about 40 animals lives in the south of the park."},{"index":5,"size":80,"text":"Ngoti observed and recorded the plant species that the animals were eating. He also compared the vegetation where the animals were eating to the vegetation of the areas in general and collected dung of rhinos. The dung was analysed for DNA content of plant species. Based on his results, Ngoti concluded that nine shrub and forage species were preferred and made up a large share of the forage of rhinos in this area, in particular, species of the genus Indigofera."},{"index":6,"size":63,"text":"Ngoti also studied how the preferred plant species were associated with fire history. Examining satellite image-generated fire maps and recording the distribution of plant species led to the conclusion that the rhinos seem to prefer plant species that are not burned too often. Plots that had been burned only once during the past 10 years had the highest cover of preferred plant species."},{"index":7,"size":35,"text":"The results of Ngoti's thesis are now incorporated into a submitted paper and will hopefully generate more knowledge on how to manage the vegetation species preferred by wild rhinoceroses and thus help their populations increase. "}]}],"figures":[{"text":"Finally , I have some good news from our institution, the Norwegian University of Science and Technology (NTNU). Between June and August 2017, we witnessed the graduation of five Masters and three PhD students supported by the project. The Masters students and the titles of their theses are as follows: Philbert Ngoti: Feeding ecology of Eastern black rhinoceroses (Diceros bicornis michaeli) in southern Serengeti National Park, Tanzania Michael Joseph Tarimo: Sustainable gravel construction and maintenance in Serengeti National Park Damari Samwel: Assessment of illegal harvesting of resident ungulates in Serengeti ecosystem Ingrid Aase Lingaas Fossum: Dietary composition, overlap and competition between impala and domestic goat as revealed by DNA meta-barcoding Tuva Setsaas: Human impact on population dynamics and behaviour of impala (Aepyceros melampus) in and around Serengeti National Park, Tanzania The first three Masters students are employed by Tanzania National Parks (TANAPA) and based in Serengeti. Thus, TANAPA has also directly benefitted from the AfricanBioServices project. The three PhD students and the titles of their theses are as follows: Emmanuel Masenga: Behavioural ecology of free-ranging and reintroduced African wild dog (Lycaon pictus) packs in the Serengeti ecosystem, Tanzania Emmanuel Clamsen Mmassy: Ecology and conservation challenges of the Kori bustard in the Serengeti National Park Richard Daniel Lyamuya: Depredation of livestock by wild carnivores in the eastern Serengeti ecosystem, Tanzania All three PhD students are employed by the Tanzania Wildlife Research Institute (TAWIRI). Over the coming two years, we hope to produce many more Masters and PhD students through the project. Eivin Røskaft Coordinator, AfricanBioServices project Integrating ecosystem dynamics with disease control strategies: foot-and-mouth disease as a case study As one of the activities under Work Package 4, a survey on foot-and-mouth disease seroprevalence has been conducted in five villages under different land use types in the Maasai Mara ecosystem in Kenya. A total of 1170 head of cattle were randomly sampled from 390 herds across the villages and samples screened for foot-and-mouth disease antibodies at the International Livestock Research Institute laboratories. Further characterization of circulating serotypes is being carried out at the ISZLER Food and Agriculture Organization laboratory in Italy and will be completed soon. Daniel Nthiwa at work in the ILRI laboratory, screening samples for foot-and-mouth disease antibodies. Questionnaires exploring animal management strategies (e.g. grazing patterns, sharing of watering points, market sources and other predictor variables) have been compiled and a metafile (dataset ID 1115) uploaded to the project repository as at 9 February 2017. Preliminary analyses of datasets have been carried out and will be presented at the upcoming TAWIRI conference in November 2017. "},{"text":"Four rounds of household questionnaire surveys successfully completed The team from Work Package 5 has successfully completed four quarterly household questionnaire surveys covering some 1000 households in 25 villages across the greater Serengeti-Mara ecosystem in Tanzania and Kenya. Enumerators and researchers from the TAWIRI and the International Livestock Research Institute (ILRI) collected the field data under the supervision of two postdoctoral researchers, Xi Jiao and Solomon Zena Walelign, from the University of Copenhagen. Before each round of field surveys, workshops were held to train the enumerators on the use of new instruments and refresh their knowledge on quarterly income surveys. Data collection at the household level comprised the following surveys: (i) two annual household surveys covering demographics, assets and shock experience; (ii) four quarterly household income surveys covering all types of income in detail, including environmental income; (iii) focus group discussions and choice experiment surveys evaluating household livelihood strategy responses to road development, effects of varying meat prices on demand, and risk and time preference; (iv) local natural resource management institutions and the violence in resource conflicts (designed by Ole Magnus Theisen from the NTNU); and (v) unmatched count technique surveys into illegal bushmeat hunting and grazing. "},{"text":" This project was carried out in collaboration with T. Michael Anderson, Mawazo L. Nzunda and Daniel M. Griffith from Wake Forest, and James D.M. Speed, Frode Fossøy, Eivin Røskaft and Bente J. Graae, AfricanBioServices researchers from NTNU. The project had substantial support from National Geographic. Ngoti is now back in his position with TANAPA. Ngoti recorded vegetation composition in sites with different fire history (A) and (B) and which kind of vegetation the rhinos preferred to visit (C), and observed and recorded the plant species that the rhinos eat. He was then able to list the preferred species and analyse how they are associated with different fire regimes (photo credit: Phil Perry and Luisa Arenedo). "}],"sieverID":"8ae0237e-105f-45c1-9d59-18d575476586","abstract":"Our AfricanBioServices project has reached a milestone as we are already midway to the final date. During the first half of the project, we have collected a variety of data and there is time to start analysing these data. We are, however, all committed to upload our data to our joint relational database through the repository. This database will be one of the most important outputs from this project. I am sure that most of you have collected many exciting scientific results that will be published in highly reputed international scientific journals. I look forward to the next phase when all these outputs will be published."}

data/part_1/056960391c44c0a2d3133f5ad2be0206.json

@@ -0,0 +1 @@
+{"metadata":{"id":"056960391c44c0a2d3133f5ad2be0206","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/51e351c9-6424-4b26-9714-d441ff273432/retrieve"},"pageCount":94,"title":"Sustainable potato production GUIDELINES FOR DEVELOPING COUNTRIES","keywords":[],"chapters":[{"head":"C","index":1,"paragraphs":[{"index":1,"size":55,"text":"elebrated in 2008, the United Nations International Year of the Potato (IYP) highlighted the important role of the potato in agriculture, the economy and world food security. IYP also had a very practical aim: to promote the development of sustainable potato-based systems that enhance the well-being of potato producers and consumers, especially in developing countries."},{"index":2,"size":110,"text":"This technical guide is a contribution to achievement of the International Year's broader development objective. Today, potato production and consumption is booming worldwide, with ever greater quantities being processed for the convenience food and snack industries, while its importance as a subsistence crop continues to expand. Many developing countries wish to enter lucrative emerging markets for potatoes and potato products, but to do so need to make major improvements in the productivity, profitability and sustainability of their potato subsectors. For example, potato yields in the developing world average around 10 to 15 tonnes per hectare, less than half of average yields achieved by farmers in Western Europe and North America."},{"index":3,"size":61,"text":"The present guide builds on experience gained through partnerships forged during IYP implementation to address critical aspects of sustainable potato production. It represents the first inter-partner effort, post-2008, aimed at producing technical guidelines that can be used by decision makers in developing countries to improve the sustainability of potato production and boost the potato subsector's contribution to social and economic development."},{"index":4,"size":105,"text":"The guide presents a summary review of factors that constrain the potato subsector in tropical and subtropical countries, principles of Good Agriculture Practices, and GAPs relevant to potato production. It provides indicators and recommendations for action in key areas -from the conservation and utilization of potato biodiversity and improvements in seed systems, to management of soil fertility, insect pest and diseases, water use, the importance of storage, and the opportunities created by value addition. It also provides \"snapshots\" of selected best practices and examples of successful approaches in developing countries. It concludes with a series of useful fact sheets on key issues in potato development."},{"index":5,"size":45,"text":"While aimed primarily at decision makers at institutional level, the guide will also be of use to technicians, potato growers and processors. We trust that it will help further IYP's goal of helping to realize the potato's full potential as a \"food of the future\". "}]},{"head":"T","index":2,"paragraphs":[{"index":1,"size":90,"text":"he potato is the world's most important root and tuber crop worldwide. It is grown in more than 125 countries and consumed almost daily by more than a billion people. Hundreds of millions of people in developing countries depend on potatoes for their survival. Potato cultivation is expanding strongly in the developing world, where the potato's ease of cultivation and nutritive content have made it a valuable food security and cash crop for millions of farmers. Developing countries are now the world's biggest producers -and importersof potatoes and potato products."},{"index":2,"size":46,"text":"Once harvested, potatoes can be used for a variety of purposes: as a fresh vegetable for cooking at home, as raw material for processing into food products, food ingredients, starch and alcohol, as feed for animals, and as seed tubers for growing the next season's crop."},{"index":3,"size":59,"text":"Around the world, consumer demand is shifting from fresh tubers to processed products and ever greater quantities of potatoes are being processed to meet rising demand for convenience food and snacks. The major drivers behind this trend include expanding urban populations, rising incomes, diversification of diets, and lifestyles that leave less time for preparing the fresh product for consumption."},{"index":4,"size":87,"text":"The development of a vibrant, profitable and sustainable potato subsector in developing countries depends on measures to overcome a number of persistent constraints. Those measures include improvements in the quality of planting material, potato varieties that have reduced water needs, greater resistance to insect pests and diseases, and resilience in the face of climate changes, and farming systems that make more sustainable use of natural resources. Not least, potato developmentand agricultural development in generalrequires empowerment of small farmers through improved access to production inputs, credit and markets."},{"index":5,"size":72,"text":"These guidelines present a compilation of potato management practices in use in tropical and subtropical developing countries that have helped increase potato production and productivity. They can be refined to address particular conditions in specific locations. The publication provides indicators of sustainability, and highlights potential areas of improvement for potato development. While aimed primarily at decision makers, the manual tries as much as possible to use language familiar to farmers. SECTION 1"}]},{"head":"Introduction","index":3,"paragraphs":[]},{"head":"Factors constraining the potato subsector","index":4,"paragraphs":[{"index":1,"size":47,"text":"In the years ahead, world potato production is expected to grow at a rate of 2.5 per cent a year, presenting opportunities for expanded utilization and opening up new market segments. To realize the full potential of this crop, developing countries must address both supplyand demand-side constraints."}]},{"head":"The potato's biological characteristics","index":5,"paragraphs":[{"index":1,"size":87,"text":"Many constraints derive from the biological characteristics of the potato itself. These include the low multiplication rates of seed tubers, and the technical difficulties and costs associated with maintaining seed quality through successive multiplications, owing to the potato's susceptibility to soil and seed-borne insect pests and diseases. Seed tubers are also bulky: two to three tonnes per hectare is the typical seed requirement. Stringent phytosanitary restrictions limit the movement of potato germplasm, seed tubers and fresh ware potatoes. Potatoes have high fertilizer requirements but low utilization efficiency."},{"index":2,"size":15,"text":"Post-harvest, fresh potato tubers deteriorate quickly in tropical and subtropical environments, especially in the lowlands."}]},{"head":"Lack of efficient seed systems","index":6,"paragraphs":[{"index":1,"size":109,"text":"Many developing countries lack efficient systems for the regular multiplication and distribution of certified seed tubers and the rapid deployment of new, improved varieties. Causal factors include the limited technical capacity of human resources, lack of managerial expertise and inadequate resource allocations to seed systems and the potato subsector in general. As a result, farmer-based seed systems are still common, and have managed to supply planting material of limited quality over the years, and contributed to expanding cultivation of the crop. Farmer seed systems face many challenges, but also offer an opportunity to improve seed supply, provided suitable training is available and links with the formal sector are established. "}]},{"head":"Diseases and insect pests","index":7,"paragraphs":[]},{"head":"High production costs and lack of credit","index":8,"paragraphs":[{"index":1,"size":78,"text":"Compared to other food crops, production of potatoes is capital-intensive, requiring the purchase of large quantities of bulky seed and the application of high-cost inputs such as fertilizers and pesticides. With limited access to credit and few means of mitigating the risks of taking out loans, small-scale farmers find it difficult to compete in potato production. The current global financial crisis could leave a great number of farmers with little money and no credit to invest in production."}]},{"head":"Price instability","index":9,"paragraphs":[{"index":1,"size":42,"text":"With potato becoming increasingly a cash crop, small-scale potato growers are vulnerable to abrupt changes in input and output prices. Seasonal and year-to-year price movements can affect individual small growers who lack the financial resources and resilience of larger producers and cooperatives."}]},{"head":"Inefficiency of local markets","index":10,"paragraphs":[{"index":1,"size":63,"text":"Potato prices are usually determined by supply and demand, not the vagaries of international markets as in the case of cereals. It is, therefore, a crop that can help low-income farmers and consumers to ride out episodes of food price inflation, such as that experienced worldwide in 2007-08. However, the profitability of potato depends on efficient local markets and measures to control overproduction."}]},{"head":"Limited access to higher value markets","index":11,"paragraphs":[{"index":1,"size":78,"text":"To be successful, small-scale potato growers need access to profitable emerging domestic markets -such as the rapidly growing processing segment -as well as to potato export markets. However, access to domestic markets is often restricted by the marketing power of foreign suppliers, while exports are constrained by trade barriers in developed countries to processed products from the developing world. However, there are encouraging \"success stories\" that illustrate how small-scale producers can increase production and expand their market share."},{"index":2,"size":72,"text":"In India, potato growers who adapted new technology with the support of McCain Foods Ltd more than doubled their yields and incomes. Other private industries, including small businesses, have launched potato chips made from coloured native potatoes that were prototyped by CIP in order to promote the sustainable use of biodiversity in the Andean Region. Recent legislation in the USA and Europe provide greater access to agricultural products from the developing world."}]},{"head":"15","index":12,"paragraphs":[]},{"head":"FACTORS","index":13,"paragraphs":[]},{"head":"CONSTRAINING THE POTATO SUBSECTOR","index":14,"paragraphs":[]},{"head":"Socio-economic factors","index":15,"paragraphs":[]},{"head":"Neglect of the potato subsector","index":16,"paragraphs":[{"index":1,"size":105,"text":"With a few notable exceptions -such as Ethiopia -most developing countries have policies toward the potato subsector, and especially small-scale producers, that can be best characterized as \"benign neglect\". Little or no public investment is targeted at integrated strategies for crop improvement, value addition and marketing schemes or the potato production-processing-marketing chain. Many countries lack adequate seed production systems backed by certification and seed laws. Breeding rights are often not respected, reducing incentives to breeders to create new adapted and resistant varieties. In many areas, poor infrastructural facilities and poor access to markets are also major challenges to expansion of potato production and its profitability."}]},{"head":"Inadequate capacity building initiatives","index":17,"paragraphs":[{"index":1,"size":96,"text":"The potato has attracted private sector investment in the crucial area of seed multiplication and seed systems in only a few countries. Support for programmes for the diffusion of new varieties and for the scaling up of existing integrated disease and insect pest management technologies and methodologies is generally inadequate. Programmes to upgrade the skills of potato growers need to be matched by government efforts to create, monitor and enforce regulations on pesticide use and the spread of pesticide or fertilizer residues into water supplies, which are major constraints to the sustainability of potato production systems. "}]},{"head":"Lack of support to farmer organizations and entrepreneurs","index":18,"paragraphs":[]},{"head":"Good Agricultural Practices and potato production","index":19,"paragraphs":[{"index":1,"size":43,"text":"The term Good Agricultural Practices (GAPs) refers to principles and codes of practice that are applied to on-farm production and post-production processes and aim at ensuring safe and healthy food and non-food agricultural products, while taking into account economical, social and environmental sustainability."},{"index":2,"size":144,"text":"With most GAP applications, production costs are lower, losses reduced, and use of inputs rationalized as a better management system is put in place. The cost of private GAP standard certification (e.g. for GlobalGAP or Tesco Nature's Choice) may be higher owing to stricter requirements. However, this does not necessarily have to be the case with adoption of good practices per se. Generally, there is no higher cost to the consumer -that is why retailers and commercial farming are rapidly adopting GAPs. Where adoption of GAPs entails additional costs, the benefits in economic, social or environmental terms are usually higher. GAP applications are being developed by governments, NGOs and the private sector to meet the needs of growers and processors and for other specific purposes. They provide the opportunity to assess and decide on which to follow at each step of the production process."}]},{"head":"The cost of GAPs","index":20,"paragraphs":[{"index":1,"size":105,"text":"It is important that GAPs are applied in a coordinated way. For each agricultural production system, GAPs should be part of a comprehensive management strategy, providing for adjustments when needed in response to changing conditions. The implementation of such a management strategy requires knowledge, planning, measuring, monitoring and record-keeping at each step of the production process. Adoption of GAPs may sometimes result in higher production, processing and marketing costs, and higher prices for the consumer. To minimize costs, while maintaining the quality and safety of food products, participatory technical training and advice can be used to inform farmers of new technologies that will benefit them."},{"index":2,"size":32,"text":"Information on options for GAP adoption would be facilitated through the use of common databases and information exchange platforms on available enabling technologies and integrated production techniques for different major agroecological areas. "}]},{"head":"21","index":21,"paragraphs":[]},{"head":"GOOD","index":22,"paragraphs":[]},{"head":"Environment and production zones","index":23,"paragraphs":[{"index":1,"size":47,"text":"The potato is essentially a \"cool weather crop\", with temperature being the main limiting factor. In tropical areas, potato should be grown where the climate is tempered by altitude (1 500 -4 200 m) or at lower altitudes provided the crop is grown during the cool season."},{"index":2,"size":66,"text":"The ideal condition for tuberization is a night temperature of around 16°C, while optimum yields are obtained where mean daily temperatures are in the 18-20°C range. Loose, moist and well-drained slightly acid soil (with pH of 5.0-5.5) or volcanic upland soils are preferred. The water supply for the potato crop should be regular, especially from the stage of tuber initiation until the end of tuber enlargement."}]},{"head":"Cultivation methods","index":24,"paragraphs":[{"index":1,"size":49,"text":"A successful potato crop depends on judicious cultural practices. These include good knowledge of variety purity and characteristics such as dormancy duration, the physiological condition of seed potato tubers (well sprouted and 30-80 g in weight, depending on variety) and resistance to the main transmissible potato diseases and nematodes."},{"index":2,"size":67,"text":"Potatoes are best grown in rotation. In the Andes, it is usually the first crop in the rotation. In other regions, it can be planted after cereals and before legumes, but not with crops (e.g. tomato and other solanaceae) that are susceptible to the same pathogens as the potato. Sometimes natural fallow is necessary to prevent soil impoverishment and the build-up of potatospecific diseases and insect pests."},{"index":3,"size":37,"text":"Soil preparation for the potato crop should be adequate with minimum soil disturbance. Naturally loose soils, and loamy and sandy loam soils that are rich in organic matter with good drainage and aeration, are the most suitable."},{"index":4,"size":33,"text":"Planting depth, density and spacing depend on the variety chosen and tuber size, and should allow for shallow inter-row ridging, when required. Usually, about two tonnes of seed tubers are planted per hectare."},{"index":5,"size":88,"text":"To give the crop a competitive advantage, weeding should be performed after full crop emergence (about 4 weeks after planting) and after the plants have reached a height of about 20 cm. Shallow ridging is done subsequently to prevent the stolons becoming aerials, and to protect tubers against insect pests, disease infection and greening. Crop rotation and careful chemical control with herbicides, applied at minimum lethal doses, may be part of an integrated weed management system, although in most developing countries weed management is usually carried out manually."},{"index":6,"size":14,"text":"A few basic precautions against insect pests and diseases can help avoid great yield"}]},{"head":"25","index":25,"paragraphs":[]},{"head":"GOOD AGRICULTURAL PRATICES AND POTATO PRODUCTION","index":26,"paragraphs":[{"index":1,"size":61,"text":"Production decision factors and quality losses. They include crop rotation, use of resistant varieties and healthy, certified seed tubers (if available or at least seed from a reputed source or through positive selection), and integrated disease and insect pest management, which involves regular monitoring of aphid and thrips vectors, other insects and natural enemy populations, and chemical spraying only when necessary."},{"index":2,"size":80,"text":"Fertilizer application during the stages of pre-planting, planting or crop growth should be determined by soil nutrient availability, taking into account the potato's high demand for potassium, phosphorus and magnesium deficiencies in acid soils. The NPK ratio 1-1-1 is usually a wise choice to avoid spoiling tuber quality. The potato can benefit from the application of organic manure at the start of a new rotation as it provides a good nutrient balance and protects soil structure from compaction and erosion."},{"index":3,"size":27,"text":"As soil moisture must be maintained at a relatively high level in production of potatoes, compared to other crops, irrigation may be required where rainfall is limited."}]},{"head":"Harvesting","index":27,"paragraphs":[{"index":1,"size":86,"text":"For most commercial varieties, yellowing of the potato plant's leaves and easy separation of tubers from stolons indicate that the potato crop has reached maturity. If the potatoes are to be stored rather than consumed immediately, they are left in the soil to allow their skin to harden -hard skin also help seed potatoes to resist storage diseases. However, leaving tubers for too long in the ground increases their exposure to the fungal disease black scurf and increases the risk of losing quality and marketable yield."},{"index":2,"size":88,"text":"To facilitate harvesting and stop tuber growth, potato vines should be removed two weeks before the potatoes are dug up. Depending on the scale of the production, potatoes are harvested using a spading fork, a plough or commercial potato harvesters that unearth the plant and shake or blow the soil from the tubers. During harvesting, especially if it is done mechanically, it is important to avoid bruising or other injuries, which provide entry points for storage diseases and reduce the commercial, processing quality and storability of the tubers."},{"index":3,"size":40,"text":"In suitable environments and where growing conditions are adequate, commercial yields are in the range of 40-60 tonnes per hectare. In many developing countries, however, they are far below this figure, with national averages of about 10-20 tonnes per hectare."}]},{"head":"27","index":28,"paragraphs":[]},{"head":"GOOD AGRICULTURAL PRATICES AND POTATO PRODUCTION","index":29,"paragraphs":[]},{"head":"Storage and transport","index":30,"paragraphs":[{"index":1,"size":95,"text":"In the tropics and where refrigerated storage is not available, seed tubers should be stored under diffuse light in order to maintain their sprouting capacity and to encourage development of vigorous sprouts. In regions with only one cropping season per year and where storage of tubers from one season to the next is difficult without the use of costly refrigeration equipment, off-season planting may offer a solution. Importation of seed tubers is common in these regions, but may entail higher costs and risks of late delivery and deterioration in tuber quality along the marketing chain."},{"index":2,"size":76,"text":"Ware potatoes should be kept at a temperature of about 6 to 8°C, in a dark, well ventilated environment with high relative humidity (85 to 90 percent). For processing purposes, such as the production of french fries, storage temperatures may range up to 10°C to reduce the risk of increasing sugar levels, which are responsible for a dark colour during frying. Potato darkening can also be caused by an excess of nitrogen in the fertilization formula."},{"index":3,"size":145,"text":"During transport of seed tubers and ware and processing potatoes, it is important to avoid bruising by reducing drop height, lining containers with rubber or other soft material, and avoiding extreme temperatures. Tubers should be protected against unexpected rainfall and snow, which can occur at high altitudes. T he potato has the richest genetic diversity of any cultivated plant. Potato genetic resources in South American include wild relatives, native cultivar groups, local farmer-developed varieties (\"landraces\"), and hybrids of cultivated and wild plants. These varieties contain a wealth of valuable traits, such as resistance to insect pests and diseases, nutrition value, taste and adaptation to extreme climatic conditions. To control insect pests and diseases, increase yield and sustain production, especially on marginal lands, today's potato-based agricultural systems need a continuous supply of new, improved varieties, a process that requires access to the entire potato gene pool."},{"index":4,"size":111,"text":"Also at national level in regions outside the Andes, maintenance of and increase in the genetic variability of available potato varieties are needed in order to ensure there is a sufficient broad genetic base for adaptation of the plant to local environmental conditions, such as temperature, day-length, moisture availability, and insect pest and disease pressures. Good quality seed is essential to high yields and is usually the most costly input to potato cultivation, accounting for 30-50 percent of production costs. The improvement of seed quality will contribute to enhancing farmer efficiency and competitiveness. The most important seed quality characteristics are variety purity, physiological stage, seed size, seed health and physical aspect."}]},{"head":"Crop genetic diversity","index":31,"paragraphs":[]},{"head":"Seed production","index":32,"paragraphs":[{"index":1,"size":69,"text":"3Supply seeds that meet strict quantity, timing, and quality-control requirements. 3Grow seed in the best and coolest areas or time of the year in order to avoid insect populations that can transmit diseases. 3Where potatoes can be grown year-round, encourage farmers in a seed production area to include a \"potato-free\" period in the farming calendar in order to break cycles of insects that act as vector for virus diseases."}]},{"head":"Purity of variety","index":33,"paragraphs":[{"index":1,"size":18,"text":"The use of varieties with better quality and greater adaptability to marginal environments will help to enhance potato"}]},{"head":"Good practices","index":34,"paragraphs":[{"index":1,"size":38,"text":"production and ensure the sustainability and competitiveness of potato-based farming and utilization systems. 3Seed should be of the same variety as that by which it is sold. 3Use varieties that are adapted and stable in term of yields."},{"index":2,"size":41,"text":"Where appropriate and where farmers currently use mixes of different varieties, ensure the added benefits of such mixtures in terms of tolerance to diseases and ensure that farmers have adequate knowledge, infrastructure and guidelines to apply best practices for seed production."}]},{"head":"Physiological stage","index":35,"paragraphs":[{"index":1,"size":35,"text":"Physiological development of a seed tuber is categorized as follows: 3Phase I = dormant period; 3Phase II=apical sprouting; 3Phase III=period of normal sprouting; 3Phase IV=period of thin sprouts; 3Phase V= incubated -too old seed tubers."},{"index":2,"size":77,"text":"As the physiology of the seed is a major factor in seed quality, storage systems and storage duration are critical aspects to be considered. To obtain a high yielding crop, seed should be at the correct physiological age and sprouting stage at planting, depending on the purpose of the crop. In principle, seed should be at least three months old before it is planted, and no older than 5-11 months (depending on variety, storage system and temperature)."}]},{"head":"37","index":36,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":37,"paragraphs":[{"index":1,"size":103,"text":"Seed production and seed quality Direct sunlight on potato seed should be avoided. Therefore: 3For long-term storage, store seed potatoes either at 2-4°C or, when stored at higher temperatures, in diffused light. 3The period between planting and emergence should be kept as short as possible in order to make best use of the available growing season. Therefore, at planting time the seed should be at a physiological stage that allows a quick emergence. 3For planting, the best stage is phase III (robust sprouts having their typical varietal colour), the \"normal multisprouting\" phase. 3Put bulked seed potatoes in trays to stimulate more uniform sprouting."},{"index":2,"size":253,"text":"Seed size 3Use seed of uniform size, ranging from 25 to 50 mm or weighing between 30 to 80 g, depending on tuber size and shape. 3Plant tubers which have little variation in size. Using seed with a wide variation in size will not produce a uniform crop and makes it more difficult to predict the plant density and properly manage the crop. 3Use large tuber seed when soil and weather conditions at planting are unfavourable, the growing season is short, or where there is the risk that during the first part of the growing season, the crop may be damaged by night frost, hail or drought. 3Large tubers may be cut into smaller pieces for planting to reduce seed costs and favour a more uniform crop. This should be done at least two weeks before planting in temperature conditions of between 10 and 22°C to allow wound healing prior to planting. However, precautions are needed to avoid transmission of viruses via the cutting blades. 3Disinfect storage structures every year by spreading lime (use of dangerous chemicals such as formalin is not necessary). 3Clear away potato residues, sacks and other waste, as these can be breeding grounds for potato tuber moths and diseases. 3Remove and destroy seed tubers infected by diseases or insect pests during storage. 3Make routine observations to identify insect pest-and disease-infected tubers in storage. 3Routinely control the temperature in the potato heap (bulk) to ensure that no rotting occurs. Rot processes are likely to emerge when bulk temperature suddenly increases."}]},{"head":"Seed health","index":38,"paragraphs":[{"index":1,"size":208,"text":"In tropical areas such as the Central African highlands, where cold storage is unavailable or too costly, smallholder growers store their seeds on the farm. The efficiency of their simple home storage facilities could be dramatically improved with use of diffuse light technology. Diffuse light stores (DLS) are most suitable where temperatures are moderate (no frost or extreme high temperatures) and seed has to be stored for more than four months. By using DLS, farmers are able to store their own seed stocks, instead of buying them from distant suppliers. However, the loading capacity of DLS is limited since all tubers must be exposed to the diffuse light. These stores are suitable generally for small seed units and not for large scale seed production schemes. Seed potatoes stored in diffuse light give a more vigorous crop than seed that has been stored for relatively long periods in the dark at higher temperatures. However, the DLS must be protected against aphids (e.g. with an aphid proof screen) to avoid the risk of infection and transmission of viruses such as potato virus Y and potato leaf roll virus. Since the aphid population increases throughout the storage phase, stringent control measures need to be put in place to reduce seed degeneration."},{"index":2,"size":53,"text":"A technique known as \"positive selection\" was pilot-tested by smallholder potato farmers in the Narok district of Kenya as a way of improving the quality of their seed potatoes. showed that more than one quarter of the farmers trained had adopted the positive selection method. These farmers reported that their yields had doubled."}]},{"head":"Capacity-building for seed potato selection","index":39,"paragraphs":[{"index":1,"size":7,"text":"Diffuse light storage for seed potato tubers"}]},{"head":"I","index":40,"paragraphs":[{"index":1,"size":78,"text":"n most developing countries, the vast majority of smallholder farmers use farm-saved seed potato obtained from non-specialized seed growers, owing to the lack of commercial seed production systems or, where they exist, to the high price of certified seed. Farmer-based informal seed systems are generally unable to maintain seed quality or eliminate diseases such as bacterial wilt or viruses. Poor functioning seed systems are consistently ranked by CIP as being among the major constraints to improved potato production."},{"index":2,"size":48,"text":"3Train seed growers in seed quality maintenance and managing bacterial wilt and viruses. 3In order to avoid multiplying different categories of seed in the same locality and to sustain the replenishment of quality planting stock, promote a permanent \"flush-out\" system that prevents multiplication of lower categories of seed."},{"index":3,"size":46,"text":"Much effort has been made in the past to improve seed potato production in developing countries, usually through specialized seed companies. However, commercially produced seed potatoes remain beyond the reach of many smallholder producers, especially in sub-Saharan Africa, where producers rely on farm-saved seed. Simple, low-cost"}]},{"head":"Good practices","index":41,"paragraphs":[{"index":1,"size":29,"text":"Potential areas of improvement technologies are therefore needed to help developing countries produce and distribute the healthy and high quality seed tubers needed for sustainable and profitable potato production."},{"index":2,"size":128,"text":"3Develop participatory research and promote appropriate technologies to improve the quality of farm-saved seed in sub-Saharan Africa and other parts of the world. 3Identify localities with low vector pressure and communicate the value of positive and/or negative selection (rouging) practice for the production of potato seed 3Determine the degeneration rate of seed potatoes, by variety and location, so as to determine how much basic seed needs to be produced annually. 3Introduce laboratories for disease diagnostics to identify seed-borne viruses, bacteria and fungi. 3Introduce rapid multiplication techniques and encourage small enterprises to produce healthy material. 3Develop new methods to ensure the production and delivery of high quality potato planting material and improve formal and farmer-based seed systems. 3Develop legislation and accreditation systems for seed certification adapted to local conditions."}]},{"head":"43","index":42,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":43,"paragraphs":[{"index":1,"size":2,"text":"Seed systems"}]},{"head":"FROM THE PHOTO ESSAY, \"BELARUS SOLDIERS EAT POTATOES.\" (PHOTO: VIKTOR DRACHEV)","index":44,"paragraphs":[{"index":1,"size":45,"text":"M aintaining a high yielding potential in potatoes requires soil health and fertility management. Soil health depends on physical and chemical properties and functions, organic matter and biological activity, which are fundamental to sustaining agricultural production and determine, in their complexity, soil fertility and productivity."},{"index":2,"size":61,"text":"Crop fertilization requirements need to be correctly estimated according to the expected yield, the potential of the variety planted and the intended use of the harvested crop. Before application of fertilizers, farmers should perform, where possible, a soil test to identify soil characteristics, nutrient content and soil contaminants. Soil tests help assess fertility and indicate deficiencies that need to be addressed."},{"index":3,"size":55,"text":"Potato should be planted with organic fertilizer, such as farmyard manure where possible and as appropriate. As well as supplying nutrients to the crop, organic fertilizer often increases the efficiency of inorganic fertilizers, improving crop yields substantially, and also improving soil health, which could have a positive effect by helping to reduce soil borne diseases."},{"index":4,"size":30,"text":"Farmyard manure 3Of all field crops, potato has the best response to farmyard manure. Use welldecomposed farmyard manure at a rate of 10 tonnes per hectare or more, if available."}]},{"head":"Good practices","index":45,"paragraphs":[{"index":1,"size":48,"text":"3Precautions should be taken to reduce nitrogen applications by 30 percent, if inorganic fertilizers are applied at the same time. 3Avoid using fresh, incompletely decomposed manure because it will become active too late in the season and may reduce dry matter content, delay maturity and transmit diseases (e.g."}]},{"head":"Rhizoctonia solani).","index":46,"paragraphs":[]},{"head":"Fertilizers","index":47,"paragraphs":[{"index":1,"size":81,"text":"3Prior to planting, make a planting bed with some 20 cm of loose soil mixed with fertilizer and/or manure to allow proper rooting and hilling. 3In moist soil, apply fertilizers at the root zone (25-28 cm) where they are most effective. 3To be more effective, place phosphates in the root area because, unlike nitrogen and to some extent potassium, phosphates have limited movement in the soil and within plants. 3Use of fertilizers is advantageous when levels of soil fertility are low."},{"index":2,"size":32,"text":"3Promote conservation agriculture approaches to soil health and fertility management. 3Support integrated crop, soil health and fertility management programmes. 3Conduct research and development based on adequate use and conservation of natural resources."}]},{"head":"Potential areas of improvement","index":48,"paragraphs":[]},{"head":"45","index":49,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":50,"paragraphs":[{"index":1,"size":72,"text":"Soil health and fertility management S ustainable nutrient management involves a set of management practices designed to conserve soil resources, maintain or enhance productivity, and help reduce growers' reliance on chemical fertilizers. Due to its relatively poorly developed and shallow root system, the potato demands a high level of soil nutrients. Without balanced fertilization management, growth and development of the crop are poor and both yield and quality of tubers are diminished."},{"index":2,"size":72,"text":"The type and extent of nutrient management depends on the production potential of the area in which potatoes are cultivated and farmers' productivity objectives. Farmers should be advised to perform a soil test before application of fertilizers -fertilization is highly dependent on location and blanket recommendations are not applicable. They should also be aware of the effect of the soil pH on nutrient supply and the type of fertilizer to be used."},{"index":3,"size":43,"text":"Crop response to fertilizers varies from field to field. The fertilizer ratio of N-P-K often recommended and practiced is usually 1:1:1. However, high yields and enhanced quality of tubers can only be sustained through the application of optimal nutrient doses in balanced proportions."},{"index":4,"size":16,"text":"Nitrogen. The amount of nitrogen applied to a potato crop varies from 100 to as much"}]},{"head":"Good practices","index":51,"paragraphs":[{"index":1,"size":108,"text":"as 300 kg/ha depending on the purpose of the crop and soil characteristics. 3Avoid high or excessive nitrogen dressing as it stimulates haulm growth, delays tuber formation and affects tuber quality (low dry matter content, high reducing sugar content and high protein and nitrate content). 3Apply nitrogen shortly before, or at, planting time. However, if there is a risk of leaching (e.g. with heavy watering on light soils), or if the application of large quantities of fertilizer under dry conditions may cause scorching, a split application may be better. The second nitrogen application should, in general, be given no later than three to five weeks after crop emergence."},{"index":2,"size":62,"text":"Phosphorus. Phosphorus contributes to the early development of the crop and early tuberization. It increases the crop's dry matter content and improves the tuber's storage quality. Often more than 100 kg/ ha is applied, while on phosphorus-fixing soils much higher doses are used. 3Apply the total amount of phosphorus before or during planting. 3Apply phosphorus in the planting furrow in P-fixing soils."},{"index":3,"size":16,"text":"Potassium. Potassium not only improves yields but also improves tuber quality (size, starch content and storability)."},{"index":4,"size":16,"text":"An adequate supply of potassium can help reduce internal blackening and mechanical damage, and has been"}]},{"head":"47","index":52,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":53,"paragraphs":[{"index":1,"size":2,"text":"Nutrient management"}]},{"head":"HARVESTED POTATOES BEING LOADED INTO CRATES. (PHOTO: PASCAL BASTIEN)","index":54,"paragraphs":[{"index":1,"size":15,"text":"associated with increased stress tolerance. 3Apply the total amount of potassium before or during planting."}]},{"head":"Magnesium","index":55,"paragraphs":[{"index":1,"size":34,"text":"3Close attention should be paid to magnesium requirements, particularly when potatoes are grown on light acid soils. High rates of potassium, and nitrogen application in the form of ammonium, reduce the uptake of magnesium."}]},{"head":"Calcium","index":56,"paragraphs":[{"index":1,"size":44,"text":"3Potatoes are tolerant to soil acidity. Below pH 4.8, however, the crop may fail due to calcium deficiency. Liming may be necessary. 3Seed potatoes, in particular, need to be grown in soils with sufficient calcium. Calcium deficient seed tubers may fail to sprout properly."}]},{"head":"Foliar fertilizers","index":57,"paragraphs":[{"index":1,"size":49,"text":"3Foliar fertilizers contain major nutrients and also micronutrients. They are applied to and absorbed by the leaves and have therefore an immediate effect on plant growth. They may help to overcome apparent nutrient deficiencies, especially of micronutrients, and support plant recovery following stress events, such as frost and drought."},{"index":2,"size":201,"text":"3Promote the establishment of laboratories where soil mineral content can be assessed prior to planting. Laboratories can also verify the claimed concentrations of N-P-K in commercial products. 3Promote the development and use of decision support systems that help growers apply fertilizers according to soil mineral content and crop needs. 3Encourage fertilizer companies to market compound fertilizers with compositions of N, P and K tailored to different soil types. 3Support integrated crop management (ICM) programmes and integrated nutrient management systems for potatoes. 3For the fertilization of crop mixtures that include potato, the Nutrient Supplementation Index (NSI) concept can help estimate the additional percentage of N, P, K and Ca needed to satisfy the needs of a 1:1 row intercrop (e.g. potato-corn). NSI estimates total fertility input needs for the multiple cropping system based on the nutrient uptake of each crop component relative to their monoculture uptake. With NSI, intercrop fertilizer needs can be estimated from established sole crop response curves for the component species. Alternatively, fertilizer needs for the multiple crop system can be estimated for a given planting pattern using the response equations of one or more of the component crops. 3Develop nutrient management practices for potato production under conservation agriculture. "}]},{"head":"Potential areas of improvement","index":58,"paragraphs":[]},{"head":"S","index":59,"paragraphs":[{"index":1,"size":88,"text":"oil erosion on tillage-based cultivated lands is a problem that continues to threaten the sustainability of both subsistence and commercial agriculture in potato growing areas around the world. Potato cultivation usually involves intensive soil tillage throughout the cropping period, which often leads to soil degradation, erosion and leaching of nitrates. During soil preparation, the entire topsoil is loosened and -particularly on sticky clay soils -pulverized into small aggregates to avoid the formation of clods in the potato beds. Mechanical weeding and mechanized harvesting also entail intensive soil disturbance."},{"index":2,"size":51,"text":"The use of mulch at planting and the \"notill\" land preparation method are recommended to reduce soil degradation, erosion and nitrate pollution and to restore degraded soils and achieve good potato yields with reduced need for fertilizer. The mulch protects the soil from erosion during the first weeks of the crop."},{"index":3,"size":83,"text":"A green manure crop can be seeded towards the end of the crop, as the potato plants are drying off. The cover crop will help to dry out the potato beds, contributing to healthier tubers with reduced risk of damage during harvest. Nevertheless, while mulch planting of potatoes reduces the risk of erosion and nitrate leaching, it may have some disadvantages (e.g. excessive moisture and reduced soil temperature leading to Good practices retarded plant emergence). Hence it should not be a blanket recommendation."},{"index":4,"size":101,"text":"The \"no-till\" potato is pressed into the soil surface, and then covered with a thick layer of mulch, preferably straw, which is fairly stable and does not rot quickly. The young potato tubers form under the mulch but above the soil surface. In some casesfor example in dry areas under drip irrigation -black plastic sheets can also be used as mulch. Holes are punched in the plastic to allow the potato plant to grow through it. During harvesting, the sheets are removed and the potatoes are simply \"collected\". Currently, the \"no-till\" potato is only grown in small fields using manual labour."},{"index":5,"size":10,"text":"3Promote conservation agriculture approaches as a resource-saving crop production system."}]},{"head":"Potential areas of improvement","index":60,"paragraphs":[]},{"head":"51","index":61,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":62,"paragraphs":[]},{"head":"Soil conservation","index":63,"paragraphs":[{"index":1,"size":103,"text":"Incorporation of the following practices into the production scheme should result in optimal health of the potato crop: 6 Plant healthy seed tubers from reliable sources. 6 Select and prepare planting site, and choose cultivars, planting and harvest dates with disease and insect pest management in mind. 6 Handle and plant seed potatoes to ensure rapid emergence, and protect foliage using a holistic crop protection approach or integrated production and pest management. 6 Minimize tuber infection by timely killing or removal of vines before harvest; avoid tuber injury and cure tubers before long term storage. 6 Manage storage conditions to minimize post-harvest deterioration."}]},{"head":"Principles of potato plant health management","index":64,"paragraphs":[{"index":1,"size":3,"text":"POTATO PLANT (CIP)"}]},{"head":"P","index":65,"paragraphs":[{"index":1,"size":16,"text":"otato diseases are spread by insect vectors, seed and wind, running water, soil, sacks and implements."},{"index":2,"size":38,"text":"Seed is generally the main source of infection. Combating insect pests, diseases and weeds with intensive use of insecticides, fungicides and herbicides can harm the environment and pose a serious threat to the health of producers and consumers."},{"index":3,"size":79,"text":"Regular field monitoring for pests and the broader agro-ecosystem is the basis for ecological-based plant protection and pest management. For example, aphid monitoring and consequent adjustment of planting and harvest dates would deserve special attention as a feasible knowledge-based practice in the context of insect pest management. However, the management of potato late blight is difficult without fungicides. Therefore, the use of biocides is acceptable, and often considered as a component of integrated insect pest and disease management schemes."},{"index":4,"size":71,"text":"3To increase potato production while protecting producers, consumers and the environment, use insect pest and disease management strategies that encourage biological control of insect pests, varieties with insect pest and/or disease resistance, planting of healthy seed potatoes, the growing of potatoes in rotation with other crops, and organic composting to improve soil quality. 3Whenever possible, use rotations that reduce insect pest and disease problems and avoid those that may increase them."},{"index":5,"size":50,"text":"In general, avoid solanaceous crops as rotation choices. 3Control volunteer potato plants and weeds in the rotation crop. 3Avoid build up of weed seeds in the soil by removing weeds before they flower and set seeds. 3Reduce or eliminate weed seeds in soil through conservation agriculture approaches to weed management."}]},{"head":"Good practices","index":66,"paragraphs":[]},{"head":"53","index":67,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":68,"paragraphs":[]},{"head":"Pest management","index":69,"paragraphs":[{"index":1,"size":1,"text":"In "}]},{"head":"I","index":70,"paragraphs":[{"index":1,"size":44,"text":"n potato production, shortages of water are usually one of the most important constraints to higher yields. Achieving better yields requires an adequate water supply from planting until maturity. The main effect of drought or water stress on potato is yield and size reduction."},{"index":2,"size":156,"text":"Frequent irrigation reduces the occurrence of tuber malformation. For the potato, the critical period for water deficit is during tuber development. Water deficit in the early phase of yield formation increases the occurrence of spindled tubers (more noticeable in oval than in round tuber varieties) and, when followed by irrigation, may result in tuber cracking or tubers with \"hollow hearts\". Therefore, water supply and scheduling have important impacts on potato growth, yield and tuber quality. 3Match water application to the potato crop's water requirements and maintain adequate soil moisture to maximize yield. For best yields, a 120 to 150 day crop requires from 500 to 700 mm (20 to 27.5 inches) of water. 3Avoid water deficits in the middle to late part of the growing period -deficits during stolonization, tuber initiation and bulking tend to reduce yield. 3Allow higher depletion toward the ripening period (a practice that may also hasten maturity and increase dry matter content)."}]},{"head":"Good practices","index":71,"paragraphs":[{"index":1,"size":24,"text":"3Where water supply is limited and salinity might become a problem, use of a technique known as \"partial root-zone drying\" increases water use efficiency."},{"index":2,"size":39,"text":"Potatoes are planted in furrows so that one side can be irrigated and the other kept dry in one watering cycle; the opposite furrows are watered in the following cycle. 3Use no-till and soil cover to minimize soil evaporation."},{"index":3,"size":19,"text":"3Support research aiming at developing drought tolerant and resistant varieties. 3Improve irrigation and fertilization techniques using conservation agriculture approaches."}]},{"head":"Potential areas of improvement","index":72,"paragraphs":[]},{"head":"57","index":73,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":74,"paragraphs":[{"index":1,"size":2,"text":"Water management"}]},{"head":"S","index":75,"paragraphs":[{"index":1,"size":43,"text":"ince harvested tubers are living tissues and therefore subject to deterioration, proper storage is essential, both to prevent post-harvest losses of potatoes destined for fresh consumption or processing, and to guarantee an adequate supply of seed tubers. The storage of potatoes is intended:"},{"index":2,"size":42,"text":"• to preserve them in first class condition for consumption by the grower and customers; • to add value and increase profit through off-season sales or during the more lucrative high-price season; • to preserve tubers for planting in the next season."},{"index":3,"size":96,"text":"For ware and processing potatoes, storage aims at preventing \"greening\" and losses in weight and quality. In potato storage, the two critical environmental factors are temperature and humidity. Adequate and unrestricted air movement is necessary to maintain constant temperature and humidity throughout the storage pile, and to prevent excessive shrinkage from moisture loss and decay. The storage temperature affects curing and wound healing processes, the spread and severity of disease, sugarstarch balances, and respiration. Respiration, in turn, influences dormancy or sprouting, and weight loss. High humidity is essential for optimum wound healing during the curing period."},{"index":4,"size":26,"text":"It is also essential throughout the storage period in order to minimize tuber weight loss -weight loss rapidly increases at relative humidity levels below 90 percent."},{"index":5,"size":193,"text":"Depending on variety and conditions during growth, at 10-13°C and 93 percent humidity, potatoes store for 1-3 months; at 8-10°C and 93 percent humidity for 2-5 months; at 5-8°C and 93 percent for 4-8 months; at 2-5°C and 93 percent humidity for 7 months. 3Store well cured potatoes that were harvested when ripe (2 weeks after foliage death) in a well-ventilated, dark, cool place at about 4°C (where refrigeration is an option) with humidity around 90 percent. The potatoes will store for roughly three to six months. 3Store only tubers that are mature and free of diseases, insect pest and physical damage such as bruising. Research has demonstrated that potatoes from healthy plants are much more resistant to storage decay than potatoes from plants that have been weakened from physiological stresses. 3Handle the tubers carefully throughout the harvesting and pre-storage operations in order to minimize bruising, skinning and cutting. Ideally, the harvest should be carried out in temperatures of between 10-18°C. Do not harvest when tuber pulp temperature is less than 8°C or more than 20°C. 3Remove soil and plant residues before placing potatoes in storage. 3A wound healing or curing period is"}]},{"head":"Good practices","index":76,"paragraphs":[]},{"head":"59","index":77,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":78,"paragraphs":[{"index":1,"size":127,"text":"Post-harvest management necessary to prevent the entry of rot organisms and to reduce water loss. Wound healing occurs most rapidly at 15-18°C, with 95 percent humidity, and requires 5-20 days. 3Pile potatoes without refrigeration in several small piles rather than in one large heap. Large amounts tend to heat because ventilation cannot reach the centre of the pile, thus lowering quality and shortening storage life. 3Never store potatoes in close proximity to fruit -hormones produced by ripening fruits will cause the potatoes to sprout or rot prematurely. 3Storing ware potatoes at a temperature of less than 6°C stimulates the conversion of starch into sugars, giving the tubers an unnaturally sweet taste. Moreover, sugars will interact with free amino acids during frying, producing dark products with poor taste."},{"index":2,"size":41,"text":"3Promote improvements in harvest technologies to minimize bruising, improve tuber quality and storability. 3Develop and promote low-cost storage technologies suitable to small-scale farms in the tropics and subtropics. 3Carry out ex-ante cost-benefit studies on small or large scale refrigerated storage capacity."}]},{"head":"Potential areas of improvement","index":79,"paragraphs":[]},{"head":"61","index":80,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":81,"paragraphs":[{"index":1,"size":191,"text":"A study was conducted recently across the East African region to estimate the potential size of the market for fresh and processed potato in selected cities in Burundi, Ethiopia, Kenya, Rwanda, Tanzania and Uganda. Learning to innovate and engage with markets, and to become more competitive are main challenges facing small-scale farmers. However, in many lowincome developing countries, potatoes are typically marketed through fragmented chains with little coordination and poor information flows, giving rise to high supply risks and high transaction costs. Average yields remain far too low to enable small-scale potato growers to produce a marketable surplus, preventing them from increasing their participation in potato marketing systems. In addition, limited storage and transport facilities can adversely affect the quality of tubers after harvest. Efforts to enhance the value chain will only be successful provided there are substantial levels of public and private investment in the subsector, such as in breeding programmes, infrastructural improvements and initiatives to support and coordinate activities along the chain. Policy-makers should increase support to the subsector, by -for exampleextending to the potato subsector policies and resources traditionally focused on cereals and on cash crops for export."}]},{"head":"Adding value in East Africa","index":82,"paragraphs":[]},{"head":"Enhancing the value chain and markets","index":83,"paragraphs":[{"index":1,"size":5,"text":"The Participatory Market Chain Approach"}]},{"head":"W","index":84,"paragraphs":[{"index":1,"size":102,"text":"ith its adaptability to a wide range of uses, the potato has a potentially important role to play in the food systems of developing countries. In fact, in many countries, growth in urban populations, rising incomes and dietary diversification have led to rapidly increasing demand for potatoes from the fresh market, fast food, snack and convenience food industries. The structural transformation of agriculture-based economies into more urbanized societies opens up new market opportunities for potato growers and to their and processing partners in the value chain. In order to tap such potential, an efficient value chain for potato needs to be established."},{"index":2,"size":66,"text":"Often potatoes are purchased in the countryside by traders from cities, with very limited negotiation and with prices decided at the farm gate, resulting in an uneven distribution of income along the value creation chain. This leads to insufficient buying power among potato growers and the draining away of capital that could be invested in rural areas to build infrastructure such as roads and improve education."},{"index":3,"size":22,"text":"3Carry out consumer surveys to identify growing market segments and types of products likely to be in demand in the near future."}]},{"head":"Good practices","index":85,"paragraphs":[{"index":1,"size":84,"text":"3Develop and select cultivars that are preferred by consumers, processing industries or local exporters. 3Use appropriate post-harvest practices and storage facilities to keep tubers in their most edible and marketable condition. 3To increase value, provide high quality ware potatoes or potato products to consumers. 3Use simple market-oriented technologies that transform potato tubers into stable high quality products. 3Encourage farmer participation in producer groups and organizations in order to increase their market competitiveness and bargaining capacity and strengthen their position within the potato value chain."},{"index":2,"size":78,"text":"3Support participatory market chain approaches for potato (see box). 3Develop innovative marketing and utilization techniques linking small scale potato producers to new market opportunities. 3Promote mechanisms and approaches to link technology suppliers with farmers' needs, based on opportunities identified within a market chain framework. 3Organize growers in cooperatives for joint purchase of inputs such as fertilizers and for joint processing and trading so that a greater proportion of the potato value chain remains in the hands of producers."}]},{"head":"Potential areas of improvement","index":86,"paragraphs":[]},{"head":"63","index":87,"paragraphs":[]},{"head":"KEY INDICATORS OF SUSTAINABILITY","index":88,"paragraphs":[{"index":1,"size":74,"text":"Value addition and markets T he health, safety and welfare of farmers and consumers are vital assets for the sustainable development of the potato subsector and agriculture throughout the world. Particular attention must be paid to reducing risks associated with the use of pesticides, tools and machinery, and to ensuring that potatoes are produced and handled in a manner that does not harm the environment and the health, and safety of farmers and consumers."},{"index":2,"size":94,"text":"Creating awareness of food safety and environmental issues should be part of community education programmes in rural areas. Train farmers in the efficient and safe use of pesticides, fertilizers, tools and machinery Encourage them to invest in potato farming, and in improving their living standards. Use decision support tools to reduce the amounts of biocides used in potato production and thus reduce the risks of dangerous levels of residues in harvested or stored produce. Ensure that medical doctors and hospitals in rural areas are able to recognize symptoms of agrochemical poisoning and treat it."}]},{"head":"Good practices","index":89,"paragraphs":[{"index":1,"size":133,"text":"Farmers groups should consider developing partnerships with public sector and development organizations to address health and safety issues. Create services that collect pesticide packing material and unused redundant stocks for centrally organized destruction. Inform farmers and households about proper pesticide labelling and the designation of containers used to mix pesticides, and the use of properly functioning protective equipment and clothing. Establish a list of chemicals that are generally safe for various crops and a \"black list\" of chemicals that are dangerous and are forbidden. Set maximum residue levels for agrochemicals that are permitted for use in the country. Organize farmers groups in cooperatives to promote their interests and call for positive marketing regulations, lower duties and taxes on imported tools and equipment, and better access to credit to improve their self-reliance and welfare.  "}]},{"head":"G","index":90,"paragraphs":[{"index":1,"size":125,"text":"lobally, potato production is growing at a rate of 2 percent annually while in developing countries, growth is estimated at around 5 percent. Sustaining the exceptional growth in potato production of the past two decades -from 268 million tonnes in the early 1990s to 325 million tonnes in 2007 -and the expansion of potato domestic trading in developing countries depends on choosing the right policy and research options for development of the agricultural sector and potato-based farming systems. The policy and research agenda is expected to shift from the traditional focus on raising productivity to a broader approach that makes a real contribution to the fight against hunger, poverty and environmental degradation by improving rural income, livelihoods, nutrition, health, and conserves the natural resource base."},{"index":2,"size":51,"text":"Policy reforms are a needed if developing countries wish to develop and promote a sustainable potato industry and agricultural sector. This implies overcoming current trade barriers, including the lack of harmonized transit charges and customs documentation. It also implies overcoming current barriers to sustainable production intensification based on good agricultural practices."},{"index":3,"size":75,"text":"Policy makers need to be more aware of the contribution that the potato is already making to development and food security, and of its importance as a staple food and cash crop in developing countries. In the process of revising poverty reduction strategy papers (PRSPs), and in formulating strategies for agricultural development, they should take into account the needs and potentials of the potato subsector and support its more active engagement in the development process."},{"index":4,"size":65,"text":"One important policy aim in developing countries should be to enhance the value of potato production by establishing links between farmers and food processors, improving credit availability, and fostering public-private partnerships for technology innovation. By engaging interested partners from the public and private sectors and civil society, policy can facilitate the development of focused country-level programmes, projects and activities to support a sustainable potato subsector."},{"index":5,"size":39,"text":"Policy should also create a regulatory environment conducive to sustainable potato development through support for knowledge enhancement and research, application of best management practices, and sharing and promotion of proven and advanced potato technologies through education, extension and training."},{"index":6,"size":48,"text":"Policy should address constraints on potato-based production systems by favouring the introduction of good quality planting material and potato varieties more resistant to insect pests, diseases, water scarcity and climate change, farming systems that can make optimum use of natural resources, seed certification schemes and soil testing laboratories."},{"index":7,"size":42,"text":"Policy will also have to secure financial commitments from national governments, donors and the private sector to invest in potato-based systems and value chains. In doing so, policy makers should encourage a stronger commitment by the potato community to potato subsector development."}]},{"head":"69","index":91,"paragraphs":[]},{"head":"IMPLICATIONS FOR POLICY AND RESEARCH","index":92,"paragraphs":[{"index":1,"size":126,"text":"Building support at policy level The way forward for potato research in developing countries will include a number of priority areas. First, the lack of adequate quantities of clean seed is a major bottleneck to improved productivity. Promising results have been obtained through extension efforts that promote the use of \"positive selection\" and small-scale seed plots. Other research work aimed at improving the quality of farmers' seed through novel technologies such as aeroponic production of clean seed tubers has yielded positive results. Strong consideration should be given to fostering public-private sector partnerships as a strategy for getting potato seed systems moving in developing countries. Also recommended are ex-ante assessments of the potential return on investments by calculating the impact of new adapted varieties and cleaner seed."},{"index":2,"size":39,"text":"In many countries, investments are needed in laboratories for the diagnosis of potato diseases, for measuring mineral concentrations in soils, manure and fertilizers, and for determining the composition and concentration of active compounds in herbicides, pesticides, fungicides and nematicides."},{"index":3,"size":33,"text":"Legislation is needed in many countries to set quality standards for seed and to introduce or enforce mechanisms for certification through accredited laboratories. Legislation may also be needed to protect potato breeders' rights."},{"index":4,"size":109,"text":"The potential effects of climate change pose a threat to the levels and stability of potato yields. Heat and drought resistance should be considered in breeding programmes along with other key traits such as late-blight resistance, virus resistance, earliness and culinary qualities. Hence, research needs to provide a broader range of genetic material that meets sitespecific criteria, is adaptable to changing environments, and meets new demands from emerging markets for processed food products, non-food ingredients and starch for industry. The growing demand for potato with specific characteristics for a particular processed product must be taken into consideration, but should only be pursued after a careful analysis of market prospects."},{"index":5,"size":55,"text":"The potato subsector faces a growing challenge from more aggressive strains of late blight and many developing countries have a limited capacity to control the disease through fungicide application. Continued research on resistance breeding and integrated management strategies is essential, while support is needed for scaling up LB control technologies and methodologies developed by CIP."},{"index":6,"size":19,"text":"It is unlikely that resistance to latent bacterial wilt infection will be available through conventional breeding in the near"}]},{"head":"71","index":93,"paragraphs":[]},{"head":"IMPLICATIONS FOR POLICY AND RESEARCH","index":94,"paragraphs":[{"index":1,"size":102,"text":"Research for development agenda future. Research on integrated management to control bacterial wilt needs to focus on designing improved detection technologies, developing recommendations that farmers are willing and able to adopt, and exploring options for suppressing the disease through improved soil fertility and health management (e.g. sanitation measures and clean seed). Participatory approaches to farmer empowerment and learning, such as Farmers' Field Schools (FFS) for IPM and IDM, are required in order to reach a significant number of potato growers. Progress in the sequencing of the bacterial wilt genome might lead to new ways of controlling the disease in the long term."},{"index":2,"size":26,"text":"The development of conservation agriculture technologies and practices for potato-based systems presents opportunities for both public and private sector research. All aspects require increased research support."},{"index":3,"size":86,"text":"Finally, improving the incomes of smallscale potato growers depends on increasing demand-driven opportunities and developing value-chains which include all market chain actors, from input suppliers to consumers. Linking farmers to markets, especially high-value supermarkets and restaurant chains, can substantially increase the profitability of the potato cultivation. This requires technological innovation at many points in the value chain, including introduction of improved varieties and more efficient post-harvest processes, as well as technical assistance to ensure timely production and supply of adequate quantities of high quality potato products."},{"index":4,"size":224,"text":"Potato seed producers arguably constitute the most critical link in the potato chain. For it is their role to ensure that the chain has access to sufficient quantities and qualities of planting material to meet the needs of potato growers, processors and traders. In order for this group to successfully participate in the value chain, they need yield-improving and input-saving technologies to help close the persistent potato \"yield gap\" and to reduce per tonne production costs. Production initiatives can be strengthened greatly by germplasm research focused on specific end uses, tissue culture, rapid multiplication of planting material, insect pest and disease resistance (including enhancing resistance to prevalent diseases such as late blight by combining conventional plant breeding techniques with biotechnology) and the formation of producer groups to share expertise and to strengthen bargaining power. The continuous generation and diffusion of improved varieties is important if the potato subsector is to flourish. The expansion of potato cultivation will also be facilitated by improved irrigation supply, chemical fertilizers, cold storage facilities, and transport infrastructure. In addition, the market price of potato is often subject to very limited negotiation and is often decided at the farm gate. Inefficient and unfair pricing often results in producers failing to respond to market incentives, stifling efforts to increase productivity and undermining the necessary on-farm investments in production. (PHOTO: FERNADIE LILI)"}]},{"head":"Challenge of a better functioning value chain","index":95,"paragraphs":[]},{"head":"E","index":96,"paragraphs":[{"index":1,"size":77,"text":"xtending the benefits of potato subsector in developing countries requires action on a wider front. The best strategy for achieving this is to engage the international community in agricultural development that benefits small-scale farmers, who make up the majority of the world's most poor and hungry. Such commitment will make a strong contribution to achievement of the first of the United Nations Millennium Development Goals, to half the proportion of those living in extreme poverty and hunger."},{"index":2,"size":57,"text":"As a lead UN agency for agriculture and rural development, FAO will be a key partner in that process, by advising on policies and strategies to modernize the potato subsector, sharing its extensive knowledge of potato farming systems, promoting appropriate technology for sustainable intensification of production, and forging links among decision makers, producers, processors and marketing chains."},{"index":3,"size":105,"text":"CIP will play a key role through its campaign for a new research for development agenda that puts potato science at the service of the poor. The new agenda seeks to boost potato yields in developing countries by working with them to provide higher quality planting material, better varieties drawn from a broader base of potato genetic resources (including the rich storehouse of Andean varieties), and improved crop management practices. CIP is calling for a renewed sense of responsibility for conservation of the potato gene pool and take concrete steps to ensure that developing countries acquire the capacity to utilize it in a sustainable manner."}]},{"head":"75","index":97,"paragraphs":[]},{"head":"IMPLICATIONS FOR POLICY AND RESEARCH","index":98,"paragraphs":[{"index":1,"size":9,"text":"Partnerships for policy and research BAMBOO BOAT, THE PHILIPPINES."},{"index":2,"size":5,"text":"(PHOTO: MARLENE SINGH) SECTION 5"}]},{"head":"Potato fact sheets","index":99,"paragraphs":[{"index":1,"size":29,"text":"To deepen understanding of the potato's role in world agriculture, the economy and global food security, FAO specialists compiled a series of factsheets on key issues in potato development."}]}],"figures":[{"text":" hectare Potato Park located in the Andes near Cusco is one of the few conservation initiatives in which local communities are managing and protecting their potato genetic resources and traditional knowledge of cultivation, plant protection and breeding. CIP has repatriated to the park hundreds of virus-free varieties of native potatoes which are now in full production and yielding 30 percent more than potatoes that have not been cleaned of viruses. The Potato Park helps preserve indigenous knowledge and ancient technologies, while ensuring that the production of native varieties remains under local control. The approach could serve as a model for other indigenous communities because biological diversity is best rooted in its natural environment and managed by indigenous peoples who know it best. A potato park in the Andes PAPA HALLAY, PERU (PHOTO: O.S. BUTRON RIOS) "},{"text":" Conservation agriculture (CA) aims at enhancing natural biological processes both above and below ground. It is based on three principles: minimum mechanical soil disturbance, permanent organic soil cover, and diversified crop rotations for annual crops and plant associations for perennial crops. By minimizing soil disturbance, CA creates a vertical macro-pore structure in the soil, which facilitates the infiltration of excess rainwater into the subsoil, improves the aeration of deeper soil layers, and facilitates root penetration.The advantages of conservation agriculturePOTATO FARMING IN ARGENTINA. (PHOTO: H.C. CUEVAS) "},{"text":"\" Papa pan\", a pro-potato policy solution POTATO STARCH. (PHOTO: JANGSU CORP.) "},{"text":" development of the potato subsector in developing countries requires increases in the productivity, profitability and sustainability of potatobased farming systems. This implies a new and vigorous research for development agenda. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"SORTING OF POTATO IN INDIA.  APs may be applied to a wide range of farming systems and at different scales. They are applied through sustainable agricultural methods, G such as integrated pest management, APs may be applied to a wide range of farming systems and at different scales. They are applied through sustainable agricultural methods, G such as integrated pest management, integrated water and fertilizer management, integrated water and fertilizer management, and conservation agriculture. GAPs are and conservation agriculture. GAPs are based on four principles: based on four principles: 1. to economically and efficiently produce 1. to economically and efficiently produce sufficient quantities of safe and sufficient quantities of safe and nutritious food; nutritious food; 2. to sustain and enhance ; 2. to sustain and enhance ; 3. to maintain viable farming enterprises 3. to maintain viable farming enterprises and contribute to livelihoods; and contribute to livelihoods; 4. to meet the cultural and social needs of 4. to meet the cultural and social needs of society. society. (PHOTO: RINI MAJUMDAR) (PHOTO: RINI MAJUMDAR)  "},{"text":"AGRICULTURAL PRATICES AND POTATO PRODUCTION GAP concepts and principles Maintain soil structure by limiting heavy and sometimes unnecessary tillage practices, and through use of cover crops such as pulses. Soil management 6 Reduce wind and water erosion through hedging and ditching. 6 Apply fertilizers at appropriate moments in adequate doses (e.g. based on soil analysis and crop requirement) to avoid extra costs and possible run-off and leaching. 6 Maintain or restore soil organic content through application of manure, use of grazing and/or crop rotation . 6 Reduce soil compaction by avoiding use of heavy machinery. pplied to the potato subsector, GAP principles imply that potato production: 1. takes place in an economically efficient way; 2. contributes to food security by providing quantity and nutritional quality for a balanced food supply; 6. enhances potato biodiversity and ensures a sufficient genetic base for varietal adaptation and resistance; 7. supports viable farming enterprises and contributes to livelihoods; 8. meets the cultural and social needs of society. Several approaches can be utilized to operationalize GAP principles in potato 6 Water use efficiency A production. The most stringent one attaches 3. along with post-harvest handling and criteria to each principle, with indicators processing, ensures a safe food supply to and indicator values. For example, the consumers; following table summarizes criteria, 4. conserves the natural resource base; indicators, indicator values and GAPs that Soil management 6 Reduce wind and water erosion through hedging and ditching. 6 Apply fertilizers at appropriate moments in adequate doses (e.g. based on soil analysis and crop requirement) to avoid extra costs and possible run-off and leaching. 6 Maintain or restore soil organic content through application of manure, use of grazing and/or crop rotation . 6 Reduce soil compaction by avoiding use of heavy machinery. pplied to the potato subsector, GAP principles imply that potato production: 1. takes place in an economically efficient way; 2. contributes to food security by providing quantity and nutritional quality for a balanced food supply; 6. enhances potato biodiversity and ensures a sufficient genetic base for varietal adaptation and resistance; 7. supports viable farming enterprises and contributes to livelihoods; 8. meets the cultural and social needs of society. Several approaches can be utilized to operationalize GAP principles in potato 6 Water use efficiency A production. The most stringent one attaches 3. along with post-harvest handling and criteria to each principle, with indicators processing, ensures a safe food supply to and indicator values. For example, the consumers; following table summarizes criteria, 4. conserves the natural resource base; indicators, indicator values and GAPs that 5. does not lead to emissions that endanger could be used in implementing principle 5. does not lead to emissions that endangercould be used in implementing principle the environment and biodiversity; 4 above: the environment and biodiversity;4 above:  "},{"text":"23 GOOD AGRICULTURAL PRATICES AND POTATO PRODUCTION GAPs in the potato subsector Conserving the natural resource base  Criteria    Criteria conserve soil percentage of 5% organic apply compost, manure or green manure conserve soilpercentage of5% organicapply compost, manure or green manure organic matter soil organic matter to keep soil organic matter at the desired organic mattersoil organicmatterto keep soil organic matter at the desired  matter  level matterlevel ensure depth of the 5 m below  ensuredepth of the5 m below replenishment water table topsoil level  replenishmentwater tabletopsoil level of groundwater    of groundwater used by    used by irrigation    irrigation avoid soil surface run-off 0 kg soil loss per apply contour farming, make terraces avoid soilsurface run-off0 kg soil loss perapply contour farming, make terraces erosion of soil particles square meter per and use minimum or zero-tillage erosionof soil particlessquare meter perand use minimum or zero-tillage   year implements yearimplements  "},{"text":"do not over-irrigate from deep wells and tap other water sources or grow potatoes during a wetter period of the year if the threat of disease is not high.  Indicators Indicator values GAPs IndicatorsIndicator valuesGAPs  "},{"text":"SUSTAINABLE POTATO PRODUCTION \"PACHAMAMA HUELLA\"  LAND PREPARATION FOR POTATO IN BOLIVIA.  n potato-based systems in developing countries, the GAP concept can be associated with critical production I decision factors and recommendations. n potato-based systems in developing countries, the GAP concept can be associated with critical production I decision factors and recommendations. (PHOTO: MANUEL SEOANE (PHOTO: MANUEL SEOANE SALAZAR) SALAZAR)  "},{"text":"Potential areas of improvement 65    POTATO BAGS WAITING POTATO BAGS WAITING   TO BE SENT BY TRAIN TO BE SENT BY TRAIN   FROM SHIMLÀ, INDIA. FROM SHIMLÀ, INDIA.   (PHOTO: S. PAUL) (PHOTO: S. PAUL) Farmers' health, safety and welfare Farmers' health, safety and welfare Although the potato has been a potatoes or potato flour results in chain. More recently, the chief of Although the potato has been apotatoes or potato flour results inchain. More recently, the chief of staple food for Andean peoples for a soft, tasty bread that keeps well, Peru's Sierra Exportadora, which staple food for Andean peoples fora soft, tasty bread that keeps well,Peru's Sierra Exportadora, which millennia, many modern and is more nutritious and supports farmer co-operatives, millennia, many modernand is more nutritious andsupports farmer co-operatives, Peruvians prefer rice or bread cheaper than bread made from has called on Ministers to approve Peruvians prefer rice or breadcheaper than bread made fromhas called on Ministers to approve made from imported wheat. To wheat only. Since January 2008, the construction of 100 potato made from imported wheat. Towheat only. Since January 2008,the construction of 100 potato support domestic potato Peru's prisons and many public flour production plants to supply support domestic potatoPeru's prisons and many publicflour production plants to supply production, the Government of Peru has offered low-income SECTION 4 schools have been serving potato bread (papa pan). It is also sold by for policy to maintain production and encourages Peruvians to eat a greater proportion of potatoes, Implications small and medium bakeries and even to export potato flour to potato farmers emergency credit Plaza Vea, a Peruvian supermarket Europe, Japan and the USA. production, the Government of Peru has offered low-income SECTION 4 schools have been serving potato bread (papa pan). It is also sold by for policy to maintain production and encourages Peruvians to eat a greater proportion of potatoes, Implications small and medium bakeries and even to export potato flour to potato farmers emergency credit Plaza Vea, a Peruvian supermarket Europe, Japan and the USA. and research and research KEY INDICATORS Potato production in the developing OF SUSTAINABILITY world grew from 85 million tonnes in KEY INDICATORS Potato production in the developing OF SUSTAINABILITY world grew from 85 million tonnes in 1991 to 165 million tonnes in 2007. 1991 to 165 million tonnes in 2007. To sustain that exceptional growth, To sustain that exceptional growth, policy and research must shift from the policy and research must shift from the traditional focus on raising traditional focus on raising production to a broader approach production to a broader approach aimed improving rural incomes, aimed improving rural incomes, livelihoods, nutrition and health, while livelihoods, nutrition and health, while conserving the natural resource base. conserving the natural resource base.  "}],"sieverID":"c9e44e31-07c2-4a87-bef5-7963887491b9","abstract":"During the International Year of the Potato, celebrated in 2008, FAO and CIP helped forge partnerships worldwide to address critical aspects of sustainable potato production. This technical guide collates that experience to review technical, socio-economic, policy and institutional factors that currently constrain increased potato production and productivity in tropical and subtropical countries. It presents Good Agriculture Practices relevant to potato production, and indicators and recommendations for action in key areas, from the utilization of potato biodiversity and improvements in seed systems, to soil management, insect pest and disease control and opportunities for value addition. It outlines a new policy and research agenda for the potato subsector that aims at making a real contribution to the eradication of hunger and poverty."}

data/part_1/0587b5740e6ee437186f037d143e133f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0587b5740e6ee437186f037d143e133f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f3105136-8a45-4507-a993-6be5fc12fd17/retrieve"},"pageCount":1,"title":"Agricultural Policies and Investment Priorities for Managing Natural Resources, Climate Change and Air Pollution","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"Project Title : P1390 -Coordination of CoA 4.3 Description: <Not Defined>   Description: <Not Defined> Is new?: No   Is new?: No Stage of Maturity of the Process: Stage 1 Policy/Investment Type: Policy or Strategy Amount: <Not Applicable> Stage of Maturity of the Process: Stage 1Policy/Investment Type: Policy or StrategyAmount: <Not Applicable> Geographic Scope: National   Geographic Scope: National Country(ies):   Country(ies): • India   • India Outcome Impact Case Report:   Outcome Impact Case Report: • 3286 -WHEAT research identified factors and business models that positively impacted farmers' • 3286 -WHEAT research identified factors and business models that positively impacted farmers' adoption of sustainable intensification and climate smart farming practices in the Indo-Gangetic Plain. adoption of sustainable intensification and climate smart farming practices in the Indo-Gangetic Plain. (https://tinyurl.com/2yzwzbjr)   (https://tinyurl.com/2yzwzbjr) • 3929 -Early sowing of heat-tolerant wheat, new machinery and agronomic management enable • 3929 -Early sowing of heat-tolerant wheat, new machinery and agronomic management enable 1.1M farmers in South Asia: Greater resilience, productivity and climate change adaptation 1.1M farmers in South Asia: Greater resilience, productivity and climate change adaptation (https://tinyurl.com/2b5cy75l)   (https://tinyurl.com/2b5cy75l) • 3930 -WHEAT and MAIZE science, partnerships, outreach led to policies for conservation • 3930 -WHEAT and MAIZE science, partnerships, outreach led to policies for conservation agriculture and nutrient management in South Asia, mitigating climate change and increasing agriculture and nutrient management in South Asia, mitigating climate change and increasing smallholder income (https://tinyurl.com/22ddvqds)  smallholder income (https://tinyurl.com/22ddvqds)  "},{"text":"Innovations: <Not Provided> Narrative of Evidence: <Not Provided> This report was generated on 2022-08-19 at 07:51 (GMT+0) Milestones: <Not Provided> Milestones: <Not Provided> Sub-IDOs: Sub-IDOs: • 35 -Enabled environment for climate resilience • 35 -Enabled environment for climate resilience • 41 -Conducive agricultural policy environment • 41 -Conducive agricultural policy environment Contributing Centers/PPA partners: <Not Provided> Contributing Centers/PPA partners: <Not Provided> Contributing CRPs/PTF: Contributing CRPs/PTF: • CCAFS -Climate Change, Agriculture and Food Security • CCAFS -Climate Change, Agriculture and Food Security • Maize -Maize • Maize -Maize • Wheat -Wheat • Wheat -Wheat 1 1  "}],"sieverID":"8e024d5f-2e0d-41e0-9bea-a5576dc7915a","abstract":""}

data/part_1/06157e43400aa30e0ed5b38d96b3063c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06157e43400aa30e0ed5b38d96b3063c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3d109989-0229-4e50-a294-c22a1a0c103a/retrieve"},"pageCount":9,"title":"Reviewing research priorities in weed ecology, evolution and management: a horizon scan","keywords":["transdisciplinary research","integrated weed management","agroecology","weed adaptation","invasive plants"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":144,"text":"Weeds are defined here as any plants that have negative socio-economic and/or environmental impacts, threaten global food security, biodiversity, ecosystem services and human health. Crop yield losses to weed competition have been estimated as 9% globally (Oerke, 2006), leading to estimates of annual economic losses of $27 billion and $3.2 billion, in the USA (Pimentel et al., 2005) and UK (Pimentel et al., 2001) respectively. In natural ecosystems, non-native weeds have serious negative impacts on biodiversity and ecosystem functioning (Ehrenfeld, 2010;Simberloff et al., 2013). Invasive weeds may also result in serious consequences to human health through, for example, increased loads of allergenic pollen (Hamaoui-Laguel et al., 2015). Impacts of weeds in current systems are likely to get worse rather than better, due to increased long-distance trade, climate change, altered disturbance patterns, herbicide resistance and other factors, making improvements in weed management ever more urgent."},{"index":2,"size":215,"text":"The global human population is projected to increase to 9 billion people by 2050, with conservative estimates suggesting an associated increase in food consumption and demand of 50% (Royal Society of London, 2009). This demand will need to be satisfied without increasing the global area of agricultural land, with fewer inputs and with a lower environmental impact, a concept described as 'sustainable intensification' (Royal Society of London, 2009;Tilman et al., 2011;Struik & Kuyper, 2017). For sustainable intensification to close the gap between theoretically attainable and realised crop yields (the 'yield gap ', van Ittersum et al., 2013) whilst reducing negative environmental impacts, weed management strategies will require continued innovation, particularly considering the evolution of resistance to existing control measures (Godfray et al., 2010) and the continued introduction and spread of novel weeds or weedy traits (Driscoll et al., 2014). Climate and environmental change may also alter competitive interactions between agricultural weeds and crops, meaning that, over time, the nature and distribution of the most yield-limiting weeds may change (Fuhrer, 2003). Additionally, the ecological impacts of invasive weeds are profound (Vil a et al., 2011) and are expected to worsen with global environmental change (Bradley et al., 2010). Existing management strategies for invasive plants are often proving ineffective at producing long-term benefits (Pearson et al., 2016)."},{"index":3,"size":113,"text":"The converging challenges of global food security, climate change, environmental degradation, escalating rates of plant invasion, evolution of resistance to herbicides and the systemic failure to adopt integrated weed management (IWM) pose a stark challenge to the fields of weed ecology and management. Current trends suggest that weed problems will worsen in the next 10-20 years, becoming an even more intractable barrier in efforts towards the sustainable intensification of agricultural production and the preservation of natural habitats. It is critical that future efforts be more coordinated, collaborative, innovative and conducive to adoption. These challenges provide a timely opportunity to readdress the question 'what are the future research priorities in weed ecology and management?'."},{"index":4,"size":164,"text":"In June 2014, a group of 35 scientists engaged in various aspects of weed research and practice, spanning agricultural and invasive weeds, genetics and evolutionary biology, ecology, weed management and social science assembled at a workshop in Benasque, Spain, to consider future dimensions in weed biology and management. To facilitate those discussions, a horizon scanning exercise was performed (Sutherland et al., 2006;Grierson et al., 2011;Ricciardi et al., 2017). Before the workshop, invitees were asked to submit three to five 'key questions' that they considered to be major challenges for the discipline of weed ecology, evolution and management in agricultural and invaded natural systems over the next five to ten years. Through individual reflection and facilitated group discussion, the 124 questions submitted were ranked in importance. The top 30 ranked questions are presented here (Table 1) and form the basis of the commentary that follows. A full list of the submitted questions is included as supporting information, together with further details of the ranking exercise."}]},{"head":"Horizon scanning priorities and opportunities in weed ecology and management","index":2,"paragraphs":[{"index":1,"size":19,"text":"In summarising the top-ranked research questions (Table 1), seven salient themes were identified, each of which is discussed below."}]},{"head":"Transdisciplinary research","index":3,"paragraphs":[{"index":1,"size":219,"text":"The two top-ranked questions (and two others) placed a strong emphasis on the need for broadening research horizons, such that multistakeholder approaches to tackle weed problems and their management are fostered. Within these transdisciplinary frameworks (Lang et al., 2012;Jordan et al., 2016), weed ecologists, weed scientists, land managers, farmers, economists and social scientists should work together with agricultural, industrial and governmental stakeholders with an interest in tackling intractable weed problems (Graham, 2013;Ervin & Jussaume, 2014). Narrow framing of weed problems is less likely to engage the full range of stakeholders needed to devise and implement innovative solutions, and weed research must be considered in the context of wider efforts towards the design of sustainable farming systems. Continued technological innovation will be a key requirement for developing, testing and promoting sustainable weed management strategies, though a better balance is required between public and private sector research, development and funding for weed science. Whereas the public sector has been more inclined to focus on a range of systemsbased approaches, the private sector has continued to seek to develop 'patentable', technological solutions. Transdisciplinary science can serve to facilitate publicprivate partnerships that ensure that the most promising technological advances are deployed in systems that preserve their efficacy, maintain weed management and agroecosystem diversity and limit the potential undesirable environmental impacts of weed management."}]},{"head":"Adoption of integrated weed management","index":4,"paragraphs":[{"index":1,"size":106,"text":"Two questions (ranked 6 and 21) identified the importance of continued efforts to increase, understand and incentivise adoption of IWM approaches (see Liebman et al., 2016). Underlying reasons for this lack of adoption are multifaceted and likely reflect a continued desire for 'simple' technological solutions, short-term planning horizons and a failure by researchers to demonstrate and communicate the benefits of more integrated approaches. In part, future research approaches can address these questions using transdisciplinary frameworks that enable codevelopment of weed control technology and IWM systems, socio-economic approaches to better understand farmer decision-making and a wider framing of weed management challenges and solutions, including through public-private collaborations."}]},{"head":"Weeds as agroecological actors","index":5,"paragraphs":[{"index":1,"size":343,"text":"A series of questions (ranked 5, 7, 10, 11, 17, 22) recognised the need for a greater research effort to reconcile the negative and positive impacts of weeds in agroecosystems. The interactions of weeds with other trophic levels and in relation to soil health and functioning can be important for delivering ecosystem services (Marshall et al., 2003). These services can include the provision of food, shelter and habitat for natural enemies of crop pests or for pollinating insects, the maintenance of vegetation cover during non-cropped phases of the rotation to control soil erosion and for the enhancement of soil structure and function (Navas, 2012). As such, weed functional diversity may play an important role in enhancing crop productivity by reducing losses due to insect pests and maintaining or enhancing soil health. Trophic interactions may also play important roles in regulating weed populations through, for example, weed seed predation (Westerman et al., 2005;Franke et al., 2009) and microbial degradation of viable seeds in the soil seedbank (Chee- Sanford et al., 2006;M€ uller-St€ over et al., 2016). Of course, weeds may also increase the negative impacts of other crop pests by acting as hosts, shelter and/or food sources for plant pathogens (Wisler & Norris, 2005) and herbivores. Understanding biotic interactions between weeds and organisms at other trophic levels will be important for designing weed management strategies that enhance the natural capacity for ecosystems to regulate weed and pest populations. In this way, weed management strategies must be considered in the context of multifunctional landscapes that optimise crop production and environmental integrity whilst maintaining provisioning, sustaining and cultural ecosystem services. More diverse weed floras, selected for by more diverse weed management and cropping systems, may buffer systems against dominance by one or a few aggressive, resistance-prone species, therefore increasing systemic resilience to weeds. Indeed, evidence from the long-term Broadbalk experiment at Rothamsted Research has identified a negative correlation between weed diversity and crop yield loss (Moss et al., 2004). This observation suggests that increased weed diversity may not always have a negative impact on crop yield."}]},{"head":"Weed evolution","index":6,"paragraphs":[{"index":1,"size":318,"text":"Workshop participants recognised a need to better understand the nature and importance of weed adaptation that underpins the evolution of weedy traits in agricultural and invaded natural systems (ranked 3, 9, 12 and 30). We are reminded of the words of Harper ( 1956) that 'Arable weeds constitute an ecological group selected and maintained in association by their fitness for existence under conditions of crop cultivation. They comprise species that have been selected by the very practices that were originally designed to suppress them'. The ability of weedy plants to rapidly adapt to novel environments and anthropogenic management has been proposed as a key facet of the 'weed syndrome' (Vigueira et al., 2012). In agricultural systems, weed management, particularly the use of herbicides, exerts extreme selection pressure, and the capacity for weeds to rapidly evolve resistance to herbicides has been demonstrated extensively (Powles & Yu, 2010). Further, one of our questions acknowledged the need to also understand adaptive potential in relation to cultural weed management. In invasion ecology (see below), it is suggested that the success of invasive plants may be due, at least in part, to their ability to rapidly adapt to novel environments (Prentis et al., 2008). In the light of these phenomena, it has been proposed that weedy plants provide excellent model systems for studying contemporary adaptation in plants (Baucom & Holt, 2009;Neve et al., 2009;Vigueira et al., 2012). The extent to which phenotypic plasticity versus genetic variation is implicated in this adaptive potential is also an open question and, added to this, there is increasing interest in the role of epigenetic regulation in rapid evolution in plants (Becker & Weigel, 2012). In practical terms, answering these questions will be important for understanding how weed populations and communities respond to management strategies that aim to disrupt contemporary evolution through the design of heterogeneous landscapes, crop rotations and through the optimisation and adoption of IWM strategies."}]},{"head":"Invasiveness","index":7,"paragraphs":[{"index":1,"size":177,"text":"Important questions relating to a better understanding of weed invasiveness (ranked 13, 23, 27), drew on themes developed in the two preceding sections. To what extent are invasions facilitated (or hindered) by interactions (or lack of) across trophic levels? What is the importance of post-invasion evolution to invasion success? Invasion of an ecosystem by one species may be facilitated by native species or by previous invaders with sequential, facilitated invasions potentially leading to 'invasional meltdown' (Simberloff & von Holle, 1999). The success of invading species may be due to release from natural enemies, present in their native habitat, but absent in the invaded range (Williamson, 1996;Mitchell & Power, 2003), though reports of pathogen accumulation and subsequent population decline of invasive plant species after initial establishment have also been noted (Flory & Clay, 2013). Interactions between plants and soil microbes can also contribute to invasiveness (Klironomos, 2002;Callaway et al., 2004). Likewise, the failure of some species to invade may be due to the absence of mutualistic organisms in environments into which they are introduced (Richardson et al., 2000)."}]},{"head":"Climate change","index":8,"paragraphs":[{"index":1,"size":185,"text":"Global climate change (ranked 4, 8, 16, 18, 26) will impact the dispersal of weedy plants, the invasibility of agricultural and natural habitats and competitive interactions. Climate change is clearly recognised as a major driver for increased rates of plant invasion (Diez et al., 2012), and in agricultural situations, the geographical range over which weeds are highly competitive versus crops (the 'damage niche') may shift in response to altered cultivation practices associated with climate change (McDonald et al., 2009;Stratonovitch et al., 2012). The ability to better predict the introduction pathways and invasive potential of plants under climate change is critically important, so that those species likely to have the greatest negative environmental and socio-economic impacts can be identified and anticipated. The ability to predict those plant traits that will be most impacted by climate change will help to understand which species will become more invasive under climate change. However, it is also important to recognise that a changing climate may result in wider ecosystem change and, in this context, the concept of what defines 'native' and 'invasive' species may also change (Webber & Scott, 2012)."}]},{"head":"Weed science","index":9,"paragraphs":[{"index":1,"size":314,"text":"A final set of questions (ranked 14, 24, 25, 29) raised several important issues relating to the future scope, definition, ambitions and approaches for the discipline of weed science (biology, ecology, management). A narrowing of focus was highlighted, invoking arguments about a 'critical juncture' for the discipline (Mortensen et al., 2012) and acknowledging that the advent and unprecedented adoption of herbicides for weed management have resulted in a discipline that has approached weed science from an increasingly narrow plant physiological versus a broader plant ecological perspective (Neve et al., 2014). Two questions addressed a similar issue about the need for our discipline to find a better balance between 'applied' and 'fundamental' science, and there was a consensus that much weed research 'fell between the cracks' in this regard. This may reflect a general perception that the study of weeds, even when focused on fundamental questions of weed biology, is an overtly 'applied' science, sometimes limiting access to more basic science funding. This 'problem' is less evident in plant invasion biology where scientific questions are successfully framed in the wider context of community assembly and ecosystem functioning and where the study of plant invasions is recognised as a means to address fundamental questions in plant ecology. In the future, the discipline of agricultural weed science should recognise and rise to the challenge of framing fundamental questions in plant ecology and evolution around the study of weeds in agroecosystems. Presenting weed science in transdisciplinary terms will similarly open up opportunities for those focused on the biology and management of weeds to expand the scope and focus of the discipline. These endeavours will facilitate wider efforts to attract the best scholars into the weed science discipline, with associated benefits in terms of raising the profile of the discipline, conducting fundamental science with 'impact' and addressing many of the challenges and opportunities highlighted by this horizon scanning exercise."}]},{"head":"Discussion","index":10,"paragraphs":[{"index":1,"size":159,"text":"The overarching question that we have sought to address is how can we achieve weed management that is effective, economical, minimises negative environmental consequences and is robust to weed adaptation and future environmental change? From the preceding discussion, a single, unifying 'meta-theme' has emerged: the need for more-diversified agroecosystems to tackle intractable weed problems in ways that are economically and environmentally sustainable. Indeed, we observe that most of the research themes outlined above are pertinent to diversified agroecosystems and are largely of uncertain relevance in low-diversity agroecosystems. The severe problems of weed management in low-diversity systems are clear, and we call for a shift to focusing on critical scientific questions about weed management in more-diversified systems. This effort will add impetus to wider efforts to enhance diversification in agriculture, which remains highly challenging in the face of many factors that favour more simplified cropping systems, production technologies and market drivers, even though such simplified systems now show limited sustainability."},{"index":2,"size":151,"text":"Transdisciplinary approaches (Jordan et al., 2016) acknowledge the social, economic and political dimensions of weed management, engaging multiple stakeholders in the cocreation and codesign of IWM systems, overcoming potential barriers to subsequent adoption (Llewellyn, 2007;Wilson et al., 2009;Liebman et al., 2016) and ensuring a closer integration between public and private sector perspectives and drivers in weed management. More system-based approaches to weed management can help to address some of the tensions and trade-offs between economic, environmental and societal objectives, recognising the need for a closer integration between 'technological-' and 'agroecological'-based solutions (Jordan & Davis, 2015). In this sense, we see opportunity and potential in drawing parallels with global healthcare challenges. Indeed, the concept of 'one health' in human and animal healthcare demonstrates an emerging consensus for a more holistic approach (Hueston et al., 2013) that recognises a strong environmental component and ecological interactions in the epidemiology of human and animal disease."},{"index":3,"size":439,"text":"A more systemic, diversity-oriented focus acknowledges that weeds can perform positive as well as negative roles in agroecosystems (Marshall et al., 2003;Navas, 2012), interacting with species at other trophic levels to deliver provisioning and regulating ecosystem services. Similar arguments can apply in natural systems invaded by non-native weedy plants where there needs to be a clearer focus on those species which have the greatest ecological impact, accepting that some invasive species have few long-term negative impacts. It is critical to recognise that these agroecological approaches do not envision cropping systems that tolerate large populations of competitive weeds. Instead, we argue that more diverse management systems that support and maintain a higher level of weed diversity will select against one or a few dominant, competitive species that typically come to dominate low-diversity management systems. Whilst the notion of tolerating a more diverse weed flora may remain anathema to many, we point to the extensive evidence that current technological approaches have, with few exceptions, led to the dominance of one or a few, highly competitive, herbicide resistance-prone species (see D elye et al., 2010;Ward et al., 2013;Owen et al., 2014). The move towards more-diversified weed management is wholly consistent with the need to better understand and manage weed evolution. Low-diversity weed management systems with heavy reliance on herbicides and without sufficient crop rotation impose strong directional selection for weedy traits, and a central tenet of IWM must be to diversify selection pressures to avoid the dominance of agricultural fields by one or a few highly adapted species, whether they be native or invasive in origin. Global and regional climate change will continue to drive changes in plant species distributions and competitiveness, likely increasing the invasiveness of some species (Dukes & Mooney, 1999) and leading to new weed problems in agricultural and natural ecosystems. These challenges similarly call for broadening horizons in weed management to better understand the ecological and evolutionary drivers of invasion under climate change. Designing weed management systems that are more resilient to future invasions requires a similar focus on transdisciplinarity that acknowledges the social, economic and political dimensions of weed problems and the need for systemic ecological approaches that limit the invasion and ongoing adaptation of new weed species. As a direct outcome of our Spanish workshop, we organised a follow-up meeting on transdisciplinarity in weed research in Canada in 2016. For this, we brought in a much wider range of disciplines and participants, including social scientists, extension scientists and local landowners. This workshop focused on establishing a common language and approach to integration of social and weed science to achieve the goals of effective long-term weed solutions."},{"index":4,"size":146,"text":"These challenges and their underlying research and philosophical questions present an opportunity for reinvention in weed/invasion science to broaden the scope of the discipline and, in doing so, to address emerging concerns about a disconnection between 'basic' and 'applied' science and the need to continue to attract the best scholars into the discipline. There is a healthy, ongoing debate about the future of the weed science discipline (Mortensen et al., 2012;Ward et al., 2014;Barrett et al., 2017;Harker et al., 2017). We should embrace that debate, avoiding fractious divisions that threaten to promulgate a false dichotomy between 'technological' and 'agroecological' approaches to weed management. The design of sustainable weed management systems that are robust to weed adaptation, weed invasion and future climate change and that place weed science in a broader context of sustainable intensification requires systembased approaches that integrate technological and agroecological principles in diversified agroecosystems."}]}],"figures":[{"text":"Table 1 The 30 top-ranked current and future research questions in weed ecology and management. Questions are grouped and discussed under seven research themes Rank Question RankQuestion  "},{"text":"Table 1 . (Continued)     Rank Question RankQuestion  "}],"sieverID":"ba1e8905-6d3c-4d0d-8dba-37a6f91ec011","abstract":"Weedy plants pose a major threat to food security, biodiversity, ecosystem services and consequently to human health and wellbeing. However, many currently used weed management approaches are increasingly unsustainable. To address this knowledge and practice gap, in June 2014, 35 weed and invasion ecologists, weed scientists, evolutionary biologists and social scientists convened a workshop to explore current and future perspectives and approaches in weed ecology and management. A horizon scanning exercise ranked a list of 124 pre-submitted questions to identify a priority list of 30 questions. These questions are discussed under seven themed headings that represent areas for renewed and emerging focus for the disciplines of weed research and practice. The themed areas considered the need for transdisciplinarity, increased adoption of"}

data/part_1/063e23022f1e718422fd30a0d4408916.json

@@ -0,0 +1 @@
+{"metadata":{"id":"063e23022f1e718422fd30a0d4408916","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a7683d89-30d3-4ca0-b4db-831817e151ba/retrieve"},"pageCount":5,"title":"Challenges and opportunities for the development of the Nationally Appropriate Mitigation Actions (NAMAs) in the livestock sector in Colombia and","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":78,"text":"LivestockPlus is one of four strategic initiatives designed at the International Center for Tropical Agriculture (CIAT) under CIAT's new strategy for the period 2014-2020 to open new paths to improve the development and impact of CGIAR's research. LivestockPlus specifically aims to improve sustainable intensification of livestock production, based on the use of improved forages (Rao et al., 2015). The LivestockPlus project is challenged to support, study, and test field strategies proposed by the NAMA to reach competitiveness levels."},{"index":2,"size":44,"text":"Thus far, both countries have faced challenges and opportunities during the conceptualization and piloting of the NAMAs. It is necessary to address and overcome limitations and take advantage of the opportunities the livestock sector offers to achieve the proposed livestock goals in both countries."}]},{"head":"What NAMAs are and their importance","index":2,"paragraphs":[{"index":1,"size":78,"text":"NAMAs commit to reductions in greenhouse gas emissions (GHG) below 'business as usual' levels, as projected by the countries implementing them, and are framed in the context of sustainable development. They emerged from a combination of the institutional crisis resulting from the non-compliance with the Kyoto Protocol, increasing GHG emissions from developing countries (UNEP, 2016), and as a way to conceptualize the mitigation contributions developing countries could make with the support of developed countries (Carbon Market Watch, 2015)."},{"index":2,"size":68,"text":"The term NAMA was first introduced in 2007 in Bali, within the framework of the Thirteenth Meeting of the Conference of the Parties (Lutken, Dransfeld, & Wehner, 2013). It was established that NAMAs should be tailored to the needs and conditions of each country, and they should also be measurable, reportable and verifiable, as well as supported and facilitated by technology transfer, funding, and capacity building (Mendieta, 2013)."},{"index":3,"size":83,"text":"At the national level, NAMAs must be framed within national climate change policies. Colombia and Costa Rica are excellent case studies for analyzing climate change programs in the land use, land-use change, and forestry (LULUCF) sector, which includes the transformation of rural soils, agriculture, and livestock production (Tubiello, 2014). Both countries have expressed to the international community their intentions to develop NAMAs in the livestock production sector to reduce adverse effects to the environment and contribute to economic development, particularly in rural areas."},{"index":4,"size":48,"text":"The LivestockPlus project, which is aligned with CGIAR strategy to improve productivity and sustainability of the livestock sector in the tropics, aims to support the aforementioned NAMA-related initiatives in the field through research to validate and share technologies that are both profitable for farmers and lower GHG emissions."}]},{"head":"Role of agriculture and livestock production in Colombia and Costa Rica","index":3,"paragraphs":[{"index":1,"size":70,"text":"In 2012, the LULUCF sector, also referred to as the agriculture, forestry and other land use (AFOLU) sector, accounted for 43% of Colombia's total GHG emissions (70 MtCO2 ). In the LULUCF sector, methane from bovine enteric fermentation accounted for 28%, transformation of land to pastures accounted for 36.1%, and urine and manure in grasslands, which covers emissions associated with nitrous oxide from managed soils, accounted for 17% (IDEAM, 2016)."},{"index":2,"size":64,"text":"In Costa Rica in 2012, emissions from the LULUCF sector were 1.1 MtCO2, only 10% of the total annual emissions in the Central American country. Emissions were balanced by significant reforestation dynamics that generated net emissions of -2.07 MtCO2. In Costa Rica, emissions from enteric fermentation were 0.1 MtCO2 and transformation of land to pastures resulted in emissions of approximately 3 MtCO2 (IMN, 2015)."},{"index":3,"size":99,"text":"In both countries, livestock production is significant in rural areas. Colombia has 23,000,000 heads of cattle, or 0.47 animals per capita (Fedegan, 2010), and Costa Rica has 1,300,000 heads of cattle, or 0.26 animals per capita (Corfoga, 2014).In Colombia livestock production represents 950,000 direct and indirect jobs, while in Costa Rica livestock production represents 180,000 jobs. In terms of demand, Colombian citizens consume approximately 20 kg of beef and 153 liters of milk per capita per year (Fedegan, 2010). In Costa Rica, consumption is 15.5 kg of beef and 200 liters of milk per capita per year (MAG, 2015)."},{"index":4,"size":113,"text":"Livestock production in Colombia accounts for 32% of the national territory, equivalent to approximately 37,000,000 ha of pasture. Costa Rica has approximately 1,100,000 ha of pasture, representing 21.5% of the national territory. Colombia's stocking rate is 0.61 animals per ha, while in Costa Rica it is 1.1 animals per hectare. Other production parameters of this activity can be found in Table 1. The importance of livestock production in both countries is evident. However, at the government level, livestock production tends to be regarded as having high environmental impact and not meeting its economic potential. Rural and environmental policy planning documents from the two countries indicate the intention of improving productivity and environmental indicators."},{"index":5,"size":1,"text":"In "}]},{"head":"Strategies to implement low emissions initiatives","index":4,"paragraphs":[{"index":1,"size":95,"text":"Both Colombia and Costa Rica have developed packages of livestock production techniques that aim to reduce emissions, while improving climate change adaptation and promoting growth in production. Such packages of measures were developed in order to reduce emissions and improve the competitiveness of the sector. In order to do so, they must improve the digestibility of diets, increase carbon sequestration in soils and plant biomass, and increase the efficiency of the nitrogen cycle in the system. If this is accomplished, they will increase carbon sequestration and make better use of the animals' urine and dung)."},{"index":2,"size":68,"text":"Both countries have proposed strategies in their NAMAs, such as implementation of silvopastoral systems, improvement of pastures, establishment of fodder banks, pasture rotation, reduced use of nitrogen fertilizers, and better use of urine and dung. Remarkable aspects of the national proposals are the intention of disengaging livestock production from deforestation in Colombia, and a clear commitment to improving cattle breeds in Costa Rica focusing on productivity and sustainability."},{"index":3,"size":36,"text":"An example of a pasture rotation strategy is shown in Figure 1. The strategy is the use of a system of cattle fattening located in a low area of the tropics at CIAT Headquarters in Colombia. "}]},{"head":"Challenges and limitations","index":5,"paragraphs":[{"index":1,"size":24,"text":"Currently, livestock production faces significant constraints in both Colombia and Costa Rica; both countries must transition to more equitable, competitive, and sustainable livestock production."},{"index":2,"size":53,"text":"The context is complicated in Colombia, where additional limitations such as concentration of land ownership, armed conflict, and informal land tenancy hinder access to credit and government services or subsidies, and discourage investment. It is thus difficult to promote technological transformations that could help reaching the goal of reducing emissions and increase production."},{"index":3,"size":68,"text":"Human capital is an additional constraint. In Colombia, only an estimated 20.6% of the rural working-age population has completed elementary school, and there is an increasing lack of interest of the young population to take over livestock production activities. Additionally, the average age of producers is 53.9 years in Costa Rica (INEC, 2015) and 47 years in Colombia, which further limits the adoption of measures and technological innovations."},{"index":4,"size":99,"text":"The challenge concerning the impact on emissions and carbon sequestration is to develop sound systems that will ensure transparent accounting with a reasonable level of uncertainty and at a cost that enables its operation. Many methods that monitor emission reductions from technical changes present cost-effectiveness or reliability issues. Alternatives that have received greater efforts are those associated with survey data collection through representative samples and with remote sensing that provides information about changes in livestock landscapes. However, the scientific evidence and costeffectiveness of such estimating alternatives is not clear yet, and so constitutes fertile ground to conduct applied research."},{"index":5,"size":84,"text":"On the other hand, the calculation of national GHG emissions is carried out following the methodological guidelines developed by the International Panel on Climate Change (IPCC), and is based on activity data or factors (magnitude of the emission-generating activity) multiplied by an emission factor, which is the amount of gas emitted into the atmosphere with such activity. This approximation presents technical weaknesses when applied to the tropics, where default values might over-or underestimate emissions and reductions due to the application of a particular technique."},{"index":6,"size":44,"text":"Research conducted by different entities -CIAT IDEAM in Colombia, and INTA/MAG in Costa Rica (including through the LivestockPlus Project) was generated last year to obtain specific factors (second-level methodology). Further research is necessary to improve the estimation of emissions, particularly to obtain sequestration factors."}]},{"head":"Opportunities","index":6,"paragraphs":[{"index":1,"size":38,"text":"Research has shown that there are six key enabling components that facilitate development of mitigation projects in the livestock production sector in tropical countries. Together, they create a positive environment for making such structural adjustments to livestock production."},{"index":2,"size":71,"text":"First of all, consumption patterns today show that consumers are increasingly demanding greater environmental and social responsibility from products, as evidenced by the proliferation of green seals providing traceability to production methods. Consumers in Colombia and Costa Rica are aware of such dynamics, and, the increasing demand of internal and external markets for products that are more environmentally responsible becomes an incentive for producers and producers' associations to accept technical transformations."},{"index":3,"size":225,"text":"The political scene for climate change in 2017 is complex, especially given skepticism about climate change expressed by high officials in the new United States government. However, the Paris Agreement signed at the end of 2016 represents a window of opportunity to foster national processes related to climate change. This international treaty entails a global consensus on the need to face climate change. In addition, Colombian and Costa Rican NDCs are international commitments that convey importance to climate change public policy associated to the reduction of emissions from cattle farming. Source: taken from González, et al. (2015) Another key component and an opportunity to implement NAMAs is the rapid penetration of digital technologies into rural areas. Connectivity in both Colombia and Costa Rica is increasingly facilitating the dissemination of technologies, management of farms, and surveillance of landscapes by authorities. Similarly, regulatory developments in these countries are regarded an opportunity; such is the case of bills related to climate change, the creation of payment schemes for environmental services, subsidies and credits for the transformation of agricultural practices into more sustainable ways to produce, and the creation of agencies to work exclusively on climate change issues in the agro-environmental sector, as evidenced in Table 2. All of the conditions described above create an enabling institutional framework to manage large-scale projects aiming at the reduction of GHG emissions."},{"index":4,"size":81,"text":"As seen in the previous Currently, the livestock NAMA for Costa Rica is in the stage of searching for support to scale it up, and the livestock NAMA for Colombia is the stage of searching for support to design it. It is hoped that these critical projects will go through the processes of raising funds from international sources and the harmonization of existing internal costs, while increasing general awareness that our diet is the foundation of our relationship with the planet."},{"index":5,"size":20,"text":" Mendieta, M. P. (2013). Acciones Nacionalmente Apropiadas de Mitigación (NAMAs) en Colombia. Bogotá: Ministerio de Ambiente y Desarrollo Sostenible."},{"index":6,"size":17,"text":" Rao, I., Peters, M., Castro, A., SCHULTZE-KRAFT, R., White, D., Fisher, M. Rudel, T. ( 2015)."},{"index":7,"size":20,"text":" LivestockPlus -The sustainable intensification of forage-based agricultural system to improve livelihoods and ecosystem services in the tropics. Tropical Grasslands."},{"index":8,"size":1,"text":" "}]}],"figures":[{"text":"Figure 1 . Figure 1. Pasture rotation in a silvopastoral system. Source: Tropical Forages Program CIAT HQ "},{"text":"  "},{"text":"  "},{"text":"Table 1 . Livestock production parameters for Colombia and Costa Rica Parameter Colom- Costa ParameterColom-Costa  bia Rica biaRica Birth rate (%) 0.58 0.64 Birth rate (%)0.580.64 Calving interval (days) 627 600 Calving interval (days)627600 Weight gain (g/day) 350 325 Weight gain (g/day)350325 Dual-purpose: Productivity (li-   Dual-purpose: Productivity (li- ters/head/year) 931 810 ters/head/year)931810 Specialized: Productivity (li-   Specialized: Productivity (li- ters/head/year) 3000 3950 ters/head/year)30003950 Source: FEDEGAN (2006); CORFOGA (2000); Barrientos & Villegas Source: FEDEGAN (2006); CORFOGA (2000); Barrientos & Villegas (2010)   (2010)  "},{"text":"Table 2 . Climate change mitigation and adaptation policies and regulatory measures from 1980 to 2016. Country: Regulatory measure and / or Policy        Country: Regulatory measure and / or Policy GHG mitigation frame- Climate change ad- Carbon price Promotion of low-car- Energy demand Transport sector Land use, land-use Agriculture and Regulation of GHG mitigation frame-Climate change ad-Carbon pricePromotion of low-car-Energy demandTransport sector Land use, land-useAgriculture andRegulation of work aptation framework fixing bon energy (inc. re-   change and forestry livestock pro- REDD+ activities workaptation frameworkfixingbon energy (inc. re-change and forestrylivestock pro-REDD+ activities    newable energies)   (LULUCF) duction  newable energies)(LULUCF)duction Colombia Institutional Strategy for National Plan for CONPES docu- Law 1715 regulates National Energy None presently National Strategy to None presently None presently ex- Colombia Institutional Strategy forNational Plan forCONPES docu-Law 1715 regulatesNational EnergyNone presentlyNational Strategy toNone presentlyNone presently ex- the Articulation of Cli- Adaptation to Cli- ment 3242 In- the integration and Plan 2006-2025 exists Reduce Emissions exists ists the Articulation of Cli-Adaptation to Cli-ment 3242 In-the integration andPlan 2006-2025existsReduce Emissionsexistsists mate Change Policies mate Change troduces the promotion of non- (2006)  from Deforestation   mate Change Policiesmate Changetroduces thepromotion of non-(2006)from Deforestation and Actions (established (2012) National Strat- conventional renewa- -Law 697 encour-  and Forest Degrada-   and Actions (established(2012)National Strat-conventional renewa--Law 697 encour-and Forest Degrada- by CONPES 3700)  egy of Pay- ble energy for the na- ages the rational  tion (2013)   by CONPES 3700)egy of Pay-ble energy for the na-ages the rationaltion (2013) (2011)  ments for Envi- tional energy system and efficient use of  -National Plan for   (2011)ments for Envi-tional energy systemand efficient use of-National Plan for   ronmental Ser- (2014). energy and pro-  Forest Development   ronmental Ser-(2014).energy and pro-Forest Development   vices through -Colombian Strategy motes the use of  (PNDF) (CONPES   vices through-Colombian Strategymotes the use of(PNDF) (CONPES   the Clean De- for Low-Carbon De- alternative ener-  2135 from 2001).   the Clean De-for Low-Carbon De-alternative ener-2135 from 2001).   velopment velopment gies (2001)     velopmentvelopmentgies (2001)   Mechanism       Mechanism   (2003).       (2003). Costa Rica National Climate National Climate Ministerial De- Law 7447/1994. Reg- Law 7447/1994. Executive Order Law 7575/1996. For- National Strat- -Executive Order Costa Rica National ClimateNational ClimateMinisterial De-Law 7447/1994. Reg-Law 7447/1994.Executive OrderLaw 7575/1996. For-National Strat--Executive Order Change Strategy (2008) Change Strategy cree 37296 ulation on Efficient Regulation on the 35091. Regula- estry Law egy for Low- 37352/2012 Change Strategy (2008)Change Strategycree 37296ulation on EfficientRegulation on the35091. Regula-estry Lawegy for Low-37352/2012  (2008) (MINAE). Cre- Use of Energy. Efficient Use of tion of Biofuels -Executive Order Carbon Live- (MINAET). Cre- (2008)(MINAE). Cre-Use of Energy.Efficient Use oftion of Biofuels-Executive OrderCarbon Live-(MINAET). Cre-   ates the Volun- -National Energy Plan Energy. (2009) 37352/2012 stock Produc- ates the Executive ates the Volun--National Energy PlanEnergy.(2009)37352/2012stock Produc-ates the Executive   tary Carbon 2008-2021 (2008) -Law 7200. Energy  (MINAET). Creates tion Support Agency tary Carbon2008-2021 (2008)-Law 7200. Energy(MINAET). CreatestionSupport Agency   Market (2013)  Law (1990)  the Executive Support Decree # for the Develop- Market (2013)Law (1990)the Executive SupportDecree #for the Develop-     -Decree No.  Agency for the Devel- 39482. 2016 ment and Imple- -Decree No.Agency for the Devel-39482. 2016ment and Imple-     36481-MINAET -  opment and Imple-  mentation of the 36481-MINAET -opment and Imple-mentation of the     Incentive to pro-  mentation of the  REDD Strategy for Incentive to pro-mentation of theREDD Strategy for     mote the organiza-  REDD Strategy for  Costa Rica. mote the organiza-REDD Strategy forCosta Rica.     tion of local com-  Costa Rica.   tion of local com-Costa Rica.     mittees and their  -National strategy ad-   mittees and their-National strategy ad-     unity.  dressing illegal log-   unity.dressing illegal log-       ging (2002).   ging (2002).       -PES that subse-   -PES that subse-       quently includes car-   quently includes car-       bon as an environ-   bon as an environ-       mental service   mental service  "},{"text":"table ,  between farming operations and protection of the between farming operations and protection of the environment. environment. Finally, a great opportunity for these NAMAs lies in the Finally, a great opportunity for these NAMAs lies in the experience both countries have implementing projects experience both countries have implementing projects related to this topic. Between 2000 and 2015, Colombia related to this topic. Between 2000 and 2015, Colombia developed 19 pilot projects involving the Forest Carbon developed 19 pilot projects involving the Forest Carbon Partnership Facility (FCPF) and 7 mitigation projects Partnership Facility (FCPF) and 7 mitigation projects focused on the livestock production sector, mainly focused on the livestock production sector, mainly financed by CIAT-CCAFS, the World Bank, GEF, financed by CIAT-CCAFS, the World Bank, GEF, FEDEGAN, TNC, FINAGRO, and ICF, and three of which FEDEGAN, TNC, FINAGRO, and ICF, and three of which were jointly submitted with Costa Rica and financed by were jointly submitted with Costa Rica and financed by LEAD and the Embassy of The Netherlands. Costa Rica LEAD and the Embassy of The Netherlands. Costa Rica has 6 FCPF projects and 2 mitigation projects focusing on has 6 FCPF projects and 2 mitigation projects focusing on the livestock production sector financed by FONTAGRO, the livestock production sector financed by FONTAGRO, CATIE, GEF, and JOINT PROJECTS. CATIE, GEF, and JOINT PROJECTS. an opportunity is also an opportunity is also presented through the development of policies or presented through the development of policies or regulatory measures governing the activities of the regulatory measures governing the activities of the agricultural and livestock sectors in both countries, and in agricultural and livestock sectors in both countries, and in Colombia, Transport and REDD. Additionally, the creation Colombia, Transport and REDD. Additionally, the creation and strengthening of support, training, and extension and strengthening of support, training, and extension programs have pulled together public and private efforts programs have pulled together public and private efforts to reach the proposed goals concerning agriculture and to reach the proposed goals concerning agriculture and livestock production. livestock production.  "},{"text":" Tubiello, F. (2014). Chapter 11, AFOLU. Cambridge: IPCC.  UNEP. (2016). The Emissions Gap Report 2016. Nairobi: United Nations Environment Programme. This brief is specifically focused on the progress made by the LivestockPlus The LivestockPlus Project works in Costa Rica and Colombia to support the design and implementation of the Livestock NAMA. It is hoped that the concepts presented will facilitate the active participation of policymakers, donors, the private sector, and other actors within the process, who contribute to the design of agricultural NAMAs worldwide. This brief is based on the evaluations and consultations with stakeholders conducted in October, 2015.  "}],"sieverID":"6153a5da-5f1b-4fbf-a4a1-1cf2c6593116","abstract":""}

data/part_1/066cebdee150a73a21d5e2827158dad6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"066cebdee150a73a21d5e2827158dad6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/76d6a495-5a74-418c-9f6d-f8dd9ccc815e/retrieve"},"pageCount":8,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":147,"text":"Les experts en technologie se sont avérés à plusieurs reprises être de mauvais pronostiqueurs quant aux emplois réels des NTIC. Leurs visions utilitaires sont en effet souvent dépassées par la créativité des utilisateurs de NTIC. Au milieu des années 1990, par exemple, les prévisionnistes présageaient une surabondance de capacité des réseaux de télécommunications internationales et ils s'attendaient à ce que les coûts des télécommunications soient réduits à presque zéro en 2005. Ce scénario a attiré l'attention de la communauté du développement international et il a été à l'origine de nombreuses politiques internationales et régionales visant à connecter les pays ACP -par Internet -aux marchés mondiaux et aux réseaux de connaissances internationaux. Cependant, en dépit d'énormes efforts internationaux, l'accès à Internet en 2004 demeure toujours très limité dans la plupart des pays ACP et notamment dans les zones rurales. De plus, le coût de l'accès reste très élevé."},{"index":2,"size":136,"text":"Les chercheurs et les praticiens agricoles des pays ACP ne sont pas restés inactifs malgré les contraintes imposées par cette faible connectivité. Ils ont commencé à ouvrir la voie à d'autres NTIC que celles basées sur les technologies Internet. Au Sénégal par exemple, des fournisseurs de services d'informations de marché ont décidé d'utiliser l'opportunité offerte par la prolifération rapide des téléphones portables. Ils offrent actuellement des services « multi-modaux » de téléphonie mobile qui fournissent aux agriculteurs et aux négociants les dernières informations relatives aux prix du marché. Au Kenya, des chercheurs utilisent des images satellite et des systèmes d'information géographique (SIG) pour prévoir les invasions d'insectes ravageurs. En Équateur, les représentants d'une institution de microfinancement utilisent des ordinateurs de poche (ou assistants numériques personnels) pour traiter les demandes de prêts lorsqu'ils visitent des villages isolés."},{"index":3,"size":74,"text":"Certains praticiens du développement rural ont également mis au point des systèmes qui consistent en plusieurs NTIC intégrées dans une seule application. En collaboration avec des éleveurs de bétail du Sahel, ils ont trouvé, par exemple, des solutions pratiques leur permettant d'utiliser des cartes issues de SIG, des systèmes de positionnement par satellite (GPS) de format de poche et des téléphones portables pour gérer les mouvements du bétail afin de lutter contre le surpâturage."},{"index":4,"size":80,"text":"Ces applications NTIC (et bien d'autres encore) « appropriées par la base » -c'est-à-dire conçues et développées sous des conditions qui émanent de la base et non de groupes spécifiques de spécialistes en technologie -ont été traitées dans des numéros récents d'ICT Update. Ces exemples prouvent qu'en dépit d'un accès limité à Internet, des applications NTIC « appropriées par la base » peuvent jouer un rôle non négligeable de soutien dans la revitalisation du secteur agricole dans les pays ACP."},{"index":5,"size":123,"text":"Il subsiste, bien sûr, le défi du développement de stratégies Internet pratiques et durables qui exploitent le potentiel offert par la technologie tout en respectant les contraintes infrastructurelles et réglementaires. Dans les années 1990, on a prédit qu'Internet allait concurrencer et même remplacer les médias traditionnels, tels que les livres, les magazines, les journaux, la radio et la télévision. Ce scénario de la première heure, qui semblerait un peu naïf avec du recul, a été remplacé par l'impératif d'utiliser Internet de pair avec les médias traditionnels. Les « universités ouvertes » par exemple proposent des cours diffusés à la télévision, soutenus par des manuels et du matériel de formation interactif sur CD-ROM, et complétés par des séances d'assistance en ligne pour les étudiants."},{"index":6,"size":98,"text":"Le CTA a tenu compte des opportunités et des défis de l'utilisation de différents médias lorsqu'il a défini la politique de diffusion de ses produits d'information, de façon à ce que ses L'équipe d'ICT Update félicite le CTA à l'occasion de son 20 e anniversaire. Ce numéro spécial diffère des autres numéros d'ICT Update dans la mesure où il s'intéresse de manière prospective à un thème particulièrement important, l'intégration des NTIC, retenu pour faire honneur au rôle pionnier que le CTA a joué en mettant délibérément les NTIC pour l'agriculture ACP en bonne place dans l'agenda politique ACP-UE."},{"index":7,"size":113,"text":"Les articles de ce numéro spécial explorent l'avenir des NTIC pour le développement rural dans les pays ACP. I l y a tout juste quatre ans, les agriculteurs ougandais qui voulaient vendre leurs récoltes étaient à la merci du bon vouloir des négociants. Ceux-ci pouvaient en effet faire baisser les prix comme ils le voulaient car les agriculteurs n'avaient pratiquement aucune idée des mouvements de prix et encore moins des tendances du marché. Les intermédiaires empochaient ainsi d'incroyables commissions en profitant des différences inutilement grandes entre des marchés voisins. Cette asymétrie dans l'accès aux informations de marché se traduisait par de faibles prix pour les producteurs et des prix élevés pour les consommateurs."},{"index":8,"size":66,"text":"De nos jours, les choses ont changé. FOODNET, 1 un réseau régional de développement agricole, a mis en place trois services de faible coût qui permettent aux agriculteurs, aux négociants et aux consommateurs d'obtenir des informations de marché à jour, au moment où ils en ont besoin. En Ouganda, les services d'informations de marché de FOODNET atteignent actuellement plus de 7 millions de personnes chaque semaine."},{"index":9,"size":101,"text":"Le service national d'informations de marché est géré par FOODNET en collaboration avec le ministère du Commerce, du Tourisme et de l'Industrie. Chaque jour, des agents recueillent des informations sur les prix de 32 produits de base sur quatre marchés de Kampala, la capitale, et chaque semaine des données sur 28 produits de base sur 19 marchés répartis dans tout le pays. Ces informations sont rapidement traitées et transmises à un vaste réseau de clients comprenant des agriculteurs, des négociants, des professionnels de l'agroalimentaire, des agences de développement et des responsables politiques, par radio FM, téléphones portables, courrier électronique et Internet. "}]},{"head":"Radio FM et téléphones portables","index":2,"paragraphs":[]},{"head":"Les implications pratiques","index":3,"paragraphs":[{"index":1,"size":434,"text":"Pour de nombreux agriculteurs, les services d'informations de marché de FOODNET signifient que pour la première fois ils ont accès à des données fiables sur les prix. Plusieurs études ont montré que les agriculteurs considèrent que les informations de marché sont leur deuxième grande priorité après l'existence de bonnes routes. Elles leur apportent en effet une aide considérable dans leurs négociations avec les acheteurs. Pour les associations d'agriculteurs, ces informations leur permettent de regrouper leurs produits et de calibrer plus facilement leurs récoltes. Les agriculteurs estiment que l'accès aux informations de marché s'est traduit par une augmentation de 5 à 15 % des prix à la ferme. L'analyse de marché conduite par l'Institut international de recherche sur les politiques alimentaires (IFPRI) a fait apparaître qu'au cours des quatre dernières années, le nombre de marchés dominés par les associations d'agriculteurs est passé de 4 à 8. C'est une évolution extrêmement positive.  En route vers son premier rendezvous, Moussa passe devant l'une des armoires de surveillance météorologique du district. Son ordinateur se connecte automatiquement et télécharge les informations enregistrées au cours du mois passé. Un signal sonore l'informe que le transfert des données s'est déroulé sans problème et il peut poursuivre sa route sans s'arrêter. Juste avant d'arriver à la ferme, le système Galileo avertit son PPA qui affiche alors devant lui, sur le pare-brise, le nom de la ferme et le but de sa visite. Il a été appelé pour aider Catherine Adoyo et sa voisine à résoudre un litige foncier. Après les salutations d'usage, il demande à Catherine d'inviter sa voisine, et ensemble ils se rendent à pied à la limite contestée de la propriété. Moussa utilise alors le récepteur Galileo de sa montre pour déterminer les limites exactes du domaine. Il allume son ordinateur portable, relié par une connexion sans fil à l'informatique embarquée de sa camionnette, se connecte à l'ordinateur du service du cadastre de Nairobi et télécharge les informations cadastrales relatives aux deux exploitations agricoles, y compris une carte détaillée. Moussa constate que les fermes sont situées dans une zone qui dépend des lois coutumières et lance une recherche de tous les documents oraux susceptibles de concerner les deux fermes. On l'informe qu'il existe une vidéo dans laquelle le chef du clan, décédé il y a cinq ans et respecté de tous, détaille les droits des deux femmes sur la propriété contestée. Elles décident de résoudre leur différend en respectant les explications du chef de clan décédé. A l'aide d'une webcam, Moussa scanne leur iris et insère ces signatures biométriques dans un formulaire électronique pour enregistrer l'accord entre les deux femmes."}]},{"head":"ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE","index":4,"paragraphs":[{"index":1,"size":244,"text":"La visite suivante de Moussa l'amène chez Joseph Wambui qui a fait une demande de prêt bancaire pour acheter un nouveau tracteur. La banque a demandé à   Malgré ces difficultés apparemment insurmontables, on discerne cependant dans le débat sur le développement un certain optimisme technologique qui semble avoir son origine dans la loi de Moore. On pourrait dire pour simplifier que cet optimisme pense que le rapide développement des technologies prédit par Moore se traduit en rapide développement sociétal grâce à l'introduction des technologies en question. Les critiques n'ont pas manqué de souligner que cela voudrait dire que les pays en développement ne seraient pas sur la bonne voie au de leur conception à leur mise en place. Quelques exemples suffisent pour s'en convaincre. Au niveau de la diffusion de l'information, les NTIC servent de mécanismes à part entière de fourniture des informations (sites portails, newsletters électroniques, serveurs de news, etc.) ou de mécanismes complétant les médias imprimés existants (par exemple : versions électroniques d'articles diffusés par e-mail). Dans le domaine de la communication, les NTIC permettent de créer des forums électroniques, ou de faire participer une communauté électronique beaucoup plus large à des séminaires physiques (par le biais de forums, weblogs et newsletters). En matière de renforcement du capital social, les NTIC sous-tendent les efforts de création et de renforcement de communautés électroniques (par exemple en matière d'aide à la formation) et de promotion de la diffusion des informations dans des réseaux thématiques."},{"index":2,"size":125,"text":"Quelles sont les perspectives pour l'avenir ? A ce jour, le développement des NTIC dans les pays ACP n'a pas connu la même croissance exponentielle que celle prédite par la loi de Moore. Ces cinq dernières années cependant, des évolutions significatives dans le secteur des télécommunications ont conduit à une forte croissance des réseaux de téléphonie mobile, ainsi qu'à l'extension et à la modernisation des réseaux de téléphonie fixe. La radiodiffusion numérique par satellite semble actuellement avoir toutes les chances de conquérir même les régions les plus isolées d'Afrique. Les télécentres vont sans doute tirer profit des développements d'infrastructures telles que services de faible coût et à double sens d'échanges vocaux et de données par satellite et liaisons sans fil à large bande passante (Wi-Fi)."},{"index":3,"size":100,"text":"Le potentiel de ces avancées technologiques ne pourra pas être mis en pratique en l'absence d'un environnement politique propice et approprié, ni sans amélioration des infrastructures de base et sans renforcement des capacités à tous les niveaux. La mise à profit de ces développements est par conséquent une tâche particulièrement ardue, mais sûrement pas irréalisable, qui devrait continuer à occuper les esprits des responsables politiques et des praticiens des NTIC dans les années à venir.  Gesa Wesseler revient sur le succès de GenARDIS et souligne l'importance d'une approche des NTIC pour l'agriculture ACP tenant compte de la question du genre."},{"index":4,"size":82,"text":"recherches pour le développement international (CRDI) se sont joints au CTA pour mettre en pratique cette recommandation et créer le fonds GenARDIS. L'objectif de ce fonds est d'accorder de petites subventions à des organisations développant des activités novatrices qui favorisent la compréhension et l'utilisation des NTIC dans les programmes de développement agricole et rural en tenant compte de la problématique hommesfemmes. L'attribution des fonds prend la forme d'un appel d'offres, les candidats retenus recevant une subvention unique de 5 000 euros chacun."},{"index":5,"size":68,"text":"Après l'annonce de sa création à la mimars 2003, GenARDIS a reçu pas moins de 360 demandes en moins de deux mois. La liste des premiers lauréats figurant cidessous donne un excellent aperçu de la diversité des applications et des approches utilisées pour traiter un domaine relativement restreint tel que la question du genre et l'agriculture dans la société de l'information. Les neufs projets récompensés sont décris ci-dessous."},{"index":6,"size":114,"text":"Les propositions de projets soumises au jury allaient de questions de l'ordre de la recherche (par exemple le rôle des NTIC dans la diffusion des informations agricoles pour le développement rural dans une zone donnée) à des projets commerciaux (par exemple la promotion parmi les femmes rurales d'une compagnie de téléphonie). On y trouvait également des évaluations de projets en cours, la mise en place d'une étude sociale empirique (par exemple pour évaluer les effets de la distribution de téléphones portables aux femmes vivant dans des zones rurales isolées) et l'investissement dans des équipements (par exemple pour acheter des ordinateurs permettant aux travailleurs sur le terrain d'améliorer la diffusion de l'information et la recherche)."},{"index":7,"size":35,"text":"Les neuf projets lauréats sont actuellement en cours de réalisation. Les lauréats présenteront les résultats de leurs projets lors d'un séminaire en août 2004. Cette rencontre marquera également le lancement de la deuxième campagne GenARDIS."},{"index":8,"size":15,"text":"Gesa Wesseler ([email protected]) est coordinatrice de programme au département Planification et Services communs du CTA."},{"index":9,"size":161,"text":"• Bénin : Renforcement des capacités des femmes fonctionnaires qui Bénin : Renforcement des capacités des femmes fonctionnaires qui Bénin : Renforcement des capacités des femmes fonctionnaires qui Bénin : Renforcement des capacités des femmes fonctionnaires qui Bénin : Renforcement des capacités des femmes fonctionnaires qui oeuvrent pour l'autonomisation économique des femmes rurales pour la oeuvrent pour l'autonomisation économique des femmes rurales pour la oeuvrent pour l'autonomisation économique des femmes rurales pour la oeuvrent pour l'autonomisation économique des femmes rurales pour la oeuvrent pour l'autonomisation économique des femmes rurales pour la sécurité alimentaire et la réduction de la pauvreté au Bénin sécurité alimentaire et la réduction de la pauvreté au Bénin sécurité alimentaire et la réduction de la pauvreté au Bénin sécurité alimentaire et la réduction de la pauvreté au Bénin sécurité alimentaire et la réduction de la pauvreté au Bénin, Alice Djinadou Igue Kouboura, Institut national des recherches agricoles du Bénin (INRAB)  Barbade (2000), île Maurice (2001, et Antigua (2003)."},{"index":10,"size":399,"text":"Formations à la publication Web Formations à la publication Web Formations à la publication Web Formations à la publication Web Formations à la publication Web Le CTA a organisé des cours de formation supérieure sur la conception de sites Internet, l'utilisation de bases de données et l'accès aux réseaux. Guyana (2001), Kenya (2001), Sénégal (2000, 2002, 2003), Tanzanie (2000) et Zimbabwe (2001) CTA : Qu'est-ce que c'est ? MJ : VSAT (Very Small Aperture Terminal) est un sigle facile à retenir utilisé pour désigner différents types de produits satellite, allant de petits composants à des systèmes complets. Un VSAT est un système de communication à double sens par satellite, composé de petites antennes paraboliques d'environ 1 mètre de diamètre utilisant une fréquence spécifique (bande Ku). A l'heure actuelle, le coût total de ce type de matériel est inférieur à 2 000 dollars et les frais de fonctionnement ne dépassent pas 100 dollars par mois. Un système de ce genre permet à une petite entreprise telle qu'un cybercafé par exemple, à une antenne gouvernementale ou à une ONG n'importe où en Afrique de se connecter à Internet, quelle que soit la distance qui les sépare de la plus proche connexion à une infrastructure de télécommunications terrestres. Combiné à la technologie Wi-Fi, un VSAT de ce type peut être utilisé par de nombreuses personnes dans le même village, ce qui leur permet de partager les coûts. Dans les cinq années à venir, si les législations nationales réglementant l'utilisation privée des VSAT et de l'Internet sans fil sont assouplies, cette technologie pourrait permettre de répondre à la demande croissante d'accès à Internet. Le CTA pourrait les aider en élaborant un « Manuel de défense de causes en matière de télécommunications » sur la meilleure manière de participer aux dialogues sur les politiques de télécommunications. Le CTA pourrait également leur apporter un soutien en développant leurs capacités à faire efficacement campagne en faveur de changements auprès des responsables des politiques de télécommunications. Il est intéressant de noter que l'un des rares effets positifs du processus du SMSI (Sommet mondial sur la société de l'information) a été de développer ce type de dialogues multi-acteurs sur les politiques de télécommunications. Les populations rurales des pays ACP ont beaucoup à gagner à des réformes menant à des politiques autorisant l'usage privé des technologies VSAT et sans fil. Nous devrions battre le fer tant qu'il est chaud."},{"index":11,"size":22,"text":"Installé en Afrique du Sud, Mike Jensen ([email protected]) est un conseiller de renom en matière de politiques de NTIC pour le développement."}]}],"figures":[{"text":"I l est 5 h 30 du matin et Moussa Ong'ayo, un agent de vulgarisation agricole du district de Kakamega, est déjà impatient de réaliser sa première vidéo-conférence sans fil dans l'un de ses villages. Il active son assistant portable personnel (PPA qui a remplacé depuis longtemps les PDA obsolètes) et lui ordonne par commande vocale de contrôler sa boîte à lettres électronique et d'afficher les nouveaux messages sur l'écran plat placé au-dessus de la table où il prend son petit déjeuner.Quelques instants plus tard, tout en buvant une tasse de thé, il lit son courrier et dicte les réponses que son PPA enregistre, traite et envoie automatiquement par courrier électronique ou par SMS. Il télécharge ensuite la carte météorologique du jour et demande à son PPA d'afficher en superposition les images satellite des cultures qui poussent en ce moment dans le district. Il étudie avec intérêt l'image composée et prend mentalement quelques notes à propos de ce qu'il dira aux agriculteurs lors de la réunion prévue pour aujourd'hui. Tout à coup, une alerte aux sauterelles en provenance du Centre national de lutte intégrée contre les ravageurs surgit à l'écran. Moussa dicte un message destiné à un confrère de l'Institut de recherche agricole du Kenya, à Limuru, spécialiste des pratiques indigènes, pour lui demander conseil sur la meilleure manière de protéger les cultures contre les sauterelles. Il met sa nouvelle montre multifonctions et regarde l'heure. Il va falloir qu'il se dépêche car il a une journée bien chargée. Son PPA affiche son emploi du temps : une réunion avec une association d'agriculteurs, quelques visites d'exploitations agricoles et quelques tâches à effectuer pour son unité d'assistance. Dès que son PPA a calculé son itinéraire optimal pour la journée, il envoie des SMS pour informer toutes les personnes mentionnées sur son emploi du temps. Il rassemble ensuite quelques prospectus (après une présentation vidéo, les agriculteurs demandent toujours des prospectus qu'ils souhaitent lire chez eux) et les charge dans sa camionnette. Il est toujours aussi enthousiasmé par son véhicule équipé d'une sonorisation publicadress, d'un écran vidéo escamotable et d'un ordinateur pourvu d'une station d'accueil pour son PPA. Lorsqu'il démarre le moteur, l'ordinateur s'allume et se connecte automatiquement à deux systèmes satellite : Afristar de WorldSpace pour une connexion Internet à large bande et le système de navigation par satellite Galileo. "},{"text":" Moussa de contrôler le degré de solvabilité de Joseph. Ce dernier explique ses projets d'avenir à Moussa qui entre ces informations dans son PPA. Il connecte ensuite son PPA à l'ordinateur de sa camionnette et dans les secondes qui suivent, la machine produit un plan d'entreprise et une évaluation de la faisabilité économique des ambitions de Joseph. Moussa ne peut s'empêcher d'être surpris par la rapidité du processus. En quelques secondes seulement, le PPA a rassemblé des informations relatives d'une part, aux performances économiques de Joseph au cours de l'année passée à partir de la banque de données des services fiscaux, et d'autre part, aux perspectives d'évolution des prix des matières premières pour les cinq prochaines années, diffusées par le marché à terme Kenya Agricultural Commodity Exchange. Moussa envoie par courrier électronique son rapport et ses recommandations à la banque, et reçoit un accusé de réception confirmant que la décision sera prise dans la semaine. Moussa ne veut pas être en retard pour son prochain rendez-vous : une réunion avec les dirigeants de l'association d'agriculteurs locale. Le député de la circonscription a promis de s'adresser aux participants à cette rencontre par l'intermédiaire d'une liaison vidéo, et il attendra pour cela dans son bureau de Nairobi. Tandis que Moussa installe l'équipement de la vidéo-conférence, son PPA établit une liaison avec le bureau du député. « Mesdames et Messieurs, l'honorable député Oscar Chavangi voudrait vous dire quelques mots depuis son bureau de Nairobi ». Le visage bien connu du député apparaît à l'écran. « Chers concitoyens, Moussa, l'agent de vulgarisation agricole de votre district, m'a invité à me joindre à vous aujourd'hui… ». Les agriculteurs sont bouche bée. Moussa rayonne. Il vient tout juste d'organiser la première vidéo-conférence sans fil du Kakamega. Rutger Engelhard est rédacteur coordinateur d'ICT Update et codirecteur de la société Contactivity bv à Leyde, Pays-Bas ([email protected]). Après le courrier électronique, Internet, les téléphones portables et les SMS, on s'attend à ce que l'Internet sans fil à large bande révolutionne le monde des NTIC. Toutes les autres applications mentionnées ci-dessus sont déjà utilisées dans les pays ACP et ont été décrites dans les numéros d'ICT Update. "},{"text":" (par exemple responsables politiques, organismes de réglementation, industriels, ONG, utilisateurs-bénéficiaires), les opinions diffèrent sur le choix des technologies et applications à adopter et la manière dont celles-ci devraient être soutenues, suivies et réglementées. Ce sont des problèmes auxquels on se heurte lorsqu'on veut intégrer les NTIC aux programmes. Il est sans doute utile de voir de quelle manière le CTA a tenté au fil des ans de répondre à ces questions. Lorsque le CTA a commencé ses activités en 1984, sa raison d'être était « de fournir aux États ACP un meilleur accès à l'information, à la recherche, à la formation et aux innovations dans le domaine agricole ». Durant les premières années, la grande priorité était surtout la diffusion de l'information, mais cette stratégie a été modifiée en 1995, en partie du fait du développement des NTIC à cette époque, pour mettre davantage l'accent sur le renforcement des capacités au sein des pays ACP afin d'aider les individus et les institutions à gérer eux-mêmes l'information et la communication de manière plus efficace. En fait, une plus grande place a été accordée à un dialogue dans les deux sens ainsi qu'à la facilitation des échanges Sud-Sud et entre pays ACP. Pour traiter les questions complexes d'encadrement de l'adoption des NTIC, le CTA a créé en 1998 un Observatoire des NTIC, un groupe de réflexion réunissant des experts techniques et des spécialistes des politiques dont le but est de contribuer aux stratégies du CTA en matière de NTIC liées aux programmes et de suivre les développements dans ce domaine dans le monde ACP. Aujourd'hui, l'intégration des NTIC dans les programmes du CTA est évidente, Enoncée pour la première fois il y a plus de 30 ans dans une revue confidentielle, la « loi de Moore », annonçant que la puissance de traitement des processeurs doubleraient tous les 18 mois, s'est révélée étonnamment juste. Elle est également devenue emblématique de la révolution des nouvelles technologies d'information et de communication (NTIC) et de l'irrépressible prolifération de nouvelles technologies et applications dans nos vies quotidiennes. Les rapides progrès technologiques se manifestent notamment dans les technologies de l'information (matériel, logiciels et périphériques), de télécommunication (radiodiffusion et télédiffusion, téléphonie) et de réseau (Internet, connectivité sans fil et à large bande passante). Bien que les avancées dans ces domaines soient considérables, les statistiques montrent clairement le fossé (le fameux « fossé numérique ») qui sépare ceux qui ont accès à ces technologies (vivant principalement dans les pays développés du Nord) et ceux qui n'y ont accès qu'en partie, voire pas du tout (vivant principalement dans les pays en développement du Sud). Une étude plus attentive des statistiques des pays en développement fait apparaître le fossé croissant entre l'accès aux NTIC dans les zones urbaines et dans les zones rurales, ces dernières étant des économies basées sur l'agriculture, généralement confrontées à une absence d'infrastructures de base et à de faibles niveaux d'alphabétisation. Dans de nombreux pays en développement, le fossé numérique est également un fossé entre hommes et femmes, un phénomène aggravé par une multitude de facteurs socioéconomiques et culturels qui marginalisent encore plus les femmes. "},{"text":" rôles sont déterminés culturellement et institutionnellement et peuvent évoluer avec le temps et varier en fonction de l'espace géographique. Les femmes jouent un rôle majeur dans la production agricole et les moyens de subsistance ruraux dans les pays ACP. Cependant, les femmes rurales ont beaucoup moins de chances d'avoir accès aux nouvelles technologies et techniques agricoles car elles sont généralement moins scolarisées et leur pouvoir économique et leur influence politique restent restreints. Du fait de leurs responsabilités spécifiques pour les enfants et les anciens, les femmes ont plus de mal que les hommes à décider d'émigrer à la ville. Le fossé numérique joue à l'encontre des femmes. Le fait que la connectivité soit surtout un phénomène urbain prive les femmes rurales, beaucoup plus que les hommes, de leur droit universel à communiquer. Leur situation est rendue encore plus difficile par les questions de langues et d'alphabétisme, par le fait que les nombreuses tâches qui leur incombent ne leur laissent que très peu de temps pour s'intéresser aux NTIC, et ce, dans un contexte culturel qui leur interdit de se rendre dans les points d'accès publics surtout fréquentés par des hommes. L'Observatoire sur l'agriculture et la question du genre dans la société de l'information, créé par le CTA en 2002, recommandait la mise en place d'un fonds accordant des subventions à des petits projets pour faire face à l'absence souvent signalée de ressources destinées à soutenir les initiatives tenant compte de la dimension hommes-femmes. L'International Institute for Communication and Développement (IICD) et le Centre de "},{"text":" cette deuxième génération de NTIC pour le développement ? MJ : Tout d'abord, ils pourraient favoriser le développement d'un meilleur accès à Internet, en particulier moins cher, à la fois dans les zones urbaines et dans les zones rurales, car sans accès correct à Internet la plupart des applications décrites dans ICT Update ne peuvent tout simplement pas être utilisées. Cela ne sert en effet pas à grand-chose d'encourager l'utilisation d'outils tels que les PDA (ou ordinateurs de poche) par exemple, si les communications sont d'un coût prohibitif. Deuxièmement, les responsables politiques devraient stimuler les efforts visant à renforcer les capacités locales d'utilisation des NTIC. Troisièmement, ils pourraient aider à sensibiliser les populations sur les avantages de ces nouveaux outils et le rôle qu'ils peuvent jouer pour renforcer l'audience et la qualité de nombreux services de développement rural. En particulier, ils pourraient montrer la manière dont ces outils peuvent servir d'aides à la prise de décision et d'autres applications pratiques telles que prévisions météorologiques et formation. Pour finir, je voudrais encourager les responsables politiques à prendre l'initiative et à commencer à investir dans des services d'e-gouvernement, dans des sites Internet fournissant une vaste gamme de services municipaux d'information. CTA : Le CTA dispose désormais d'un important réseau parmi les responsables des politiques de développement dans les pays ACP. Comment peut-il aider à faire prendre plus amplement conscience du rôle catalyseur des NTIC dans le développement économique et agricole ? MJ : Le CTA pourrait collaborer avec d'autres agences actives dans ce domaine, telles que le Farm Radio Network, la FAO, l'UNESCO et le DFID, pour développer une stratégie commune visant à inciter les responsables politiques à adopter des stratégies soutenant les NTIC et à investir dans ces stratégies. Les responsables gouvernementaux et les dirigeants des ONG devraient s'impliquer de manière beaucoup plus proactive dans le débat sur les politiques nationales de télécommunications afin de faire valoir les intérêts des populations rurales qu'ils représentent. "},{"text":" Spore, ICT Update, Agritrade) soient disponibles sous différentes formes et par le biais de différents médias tels que : presse écrite, courrier électronique, Internet, CD-ROM et plus récemment par satellite par l'intermédiaire de Worldspace. publications régulières (telles que Des NTIC novatrices et « appropriées » permettront d'améliorer la publications régulières (telles que Des NTIC novatrices et « appropriées » permettront d'améliorer la production agricole. De nouvelles stratégies d'information et de  production agricole. De nouvelles stratégies d'information et de communication, réunissant les médias traditionnels, Internet et  communication, réunissant les médias traditionnels, Internet et d'autres applications NTIC, transformeront les services de  d'autres applications NTIC, transformeront les services de vulgarisation agricole. Ce processus est déjà en cours. Les  vulgarisation agricole. Ce processus est déjà en cours. Les responsables politiques devraient promouvoir ces élans de  responsables politiques devraient promouvoir ces élans de changement, encourager les praticiens à continuer leurs emplois changement, encourager les praticiens à continuer leurs emplois inventifs et novateurs des NTIC, intégrer l'identification  inventifs et novateurs des NTIC, intégrer l'identification d'applications NTIC prometteuses dans leurs routines quotidiennes d'applications NTIC prometteuses dans leurs routines quotidiennes et avant tout, s'occuper des gens qui importent le plus, à savoir les et avant tout, s'occuper des gens qui importent le plus, à savoir les utilisateurs eux-mêmes. Les NTIC sont en effet l'avenir de  utilisateurs eux-mêmes. Les NTIC sont en effet l'avenir de l'agriculture ACP.  l'agriculture ACP. Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge ([email protected]) est directeur du CTA.  Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge Carl B. Greenidge ([email protected]) est directeur du CTA. Carl Carl Carl Carl Carl  Carl Carl Carl Carl Carl Greenidge Greenidge Greenidge Greenidge Greenidge, directeur du CTA, proclame que les NTIC sont  Greenidge Greenidge Greenidge Greenidge Greenidge, directeur du CTA, proclame que les NTIC sont l'avenir de l'agriculture ACP, mais que le développement  l'avenir de l'agriculture ACP, mais que le développement d'applications NTIC « appropriées » et efficaces doit être  d'applications NTIC « appropriées » et efficaces doit être conduit par les utilisateurs plutôt que par des groupes  conduit par les utilisateurs plutôt que par des groupes d'experts en technologie ou par des conférences  d'experts en technologie ou par des conférences internationales. Kevin Painting Kevin Painting Kevin Painting Kevin Painting Kevin Painting, coordinateur du  internationales. Kevin Painting Kevin Painting Kevin Painting Kevin Painting Kevin Painting, coordinateur du programme NTIC du CTA, évoque les questions relatives à  programme NTIC du CTA, évoque les questions relatives à l'intégration des NTIC et il analyse les challenges auxquels  l'intégration des NTIC et il analyse les challenges auxquels le CTA est confronté. R R R R Rutger Engelhar utger Engelhar utger Engelhar utger Engelhar utger Engelhard d d d d, rédacteur  le CTA est confronté. R R R R Rutger Engelhar utger Engelhar utger Engelhar utger Engelhar utger Engelhard d d d d, rédacteur coordinateur d'ICT Update, nous décrit ce que pourrait être  coordinateur d'ICT Update, nous décrit ce que pourrait être la journée de travail d'un agent de vulgarisation agricole en  la journée de travail d'un agent de vulgarisation agricole en 2020. Installé en Afrique du Sud, Mike Jensen Mike Jensen Mike Jensen Mike Jensen Mike Jensen, conseiller  2020. Installé en Afrique du Sud, Mike Jensen Mike Jensen Mike Jensen Mike Jensen Mike Jensen, conseiller en matière de politiques de NTIC pour le développement,  en matière de politiques de NTIC pour le développement, estime que les responsables gouvernementaux et les  estime que les responsables gouvernementaux et les dirigeants d'ONG devraient s'impliquer de manière  dirigeants d'ONG devraient s'impliquer de manière beaucoup plus proactive dans le débat sur les politiques  beaucoup plus proactive dans le débat sur les politiques nationales de télécommunications et plaider en faveur d'un  nationales de télécommunications et plaider en faveur d'un accès correct et bon marché à Internet dans les zones  accès correct et bon marché à Internet dans les zones rurales.  rurales. Ce numéro présente également deux initiatives  Ce numéro présente également deux initiatives novatrices en matière de NTIC, d'un grand intérêt pour  novatrices en matière de NTIC, d'un grand intérêt pour l'agriculture ACP. Shaun F Shaun F Shaun F Shaun F Shaun Ferris erris erris erris erris, coordinateur de FOODNET  l'agriculture ACP. Shaun F Shaun F Shaun F Shaun F Shaun Ferris erris erris erris erris, coordinateur de FOODNET Ouganda, décrit comment l'utilisation de la radio FM, de  Ouganda, décrit comment l'utilisation de la radio FM, de téléphones mobiles et d'Internet permet de fournir des  téléphones mobiles et d'Internet permet de fournir des informations de marché fiables à 7 millions de personnes.  informations de marché fiables à 7 millions de personnes. Gesa W Gesa W Gesa W Gesa W Gesa Wesseler esseler esseler esseler esseler, responsable du programme CTA sur la  Gesa W Gesa W Gesa W Gesa W Gesa Wesseler esseler esseler esseler esseler, responsable du programme CTA sur la question du genre, revient sur le succès de GenARDIS, un  question du genre, revient sur le succès de GenARDIS, un fonds créé en 2002, qui accorde de petites subventions à  fonds créé en 2002, qui accorde de petites subventions à des projets de développement utilisant les NTIC qui  des projets de développement utilisant les NTIC qui tiennent compte de la problématique hommes-femmes.  tiennent compte de la problématique hommes-femmes. Ce numéro spécial est accompagné d'un CD-ROM qui  Ce numéro spécial est accompagné d'un CD-ROM qui rassemble les 17 numéros du magazine Web publiés  rassemble les 17 numéros du magazine Web publiés jusqu'ici, y compris leurs nombreuses ressources  jusqu'ici, y compris leurs nombreuses ressources documentaires.  documentaires. ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 2004 3 3 3 3 3 ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 20043 3 3 3 3  "},{"text":" Rutger Engelhard décrit une journée de travail d'un agent de vulgarisation agricole au Kenya et les NTIC qu'il utilisera en 2020. niveau de l'introduction des NTIC et que les problèmes seraient avant tout d'ordre technologique -un point vivement contesté. Le consensus est que les NTIC ne peuvent être des moteurs de progrès économique et social que si elles sont adaptées aux conditions locales et assorties de mécanismes de soutien appropriés.Personne ne doute cependant de l'énorme potentiel que les NTIC présentent pour les pays en développement, un point finalement compris et admis par tous les forums internationaux. Le potentiel des NTIC dans trois domaines liés entre eux est particulièrement manifeste : pour la diffusion de l'information, pour la communication et pour le renforcement du capital social. La situation à ce niveau est assez complexe. Selon le groupe de parties prenantes ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE  ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans fil au K il au K il au K il au K il au Ken en en en eny y y y ya a a a a  2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans f 2020 : une vidéo-conférence sans fil au K il au K il au K il au K il au Ken en en en eny y y y ya a a a a ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 2004 5 5 5 5 5 ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 20045 5 5 5 5  "},{"text":" Kevin Painting analyse les challenges du CTA et de ses partenaires dans les pays ACP pour intégrer les NTIC à leurs programmes. Intégrer les NTIC : les challenges du CT Intégrer les NTIC : les challenges du CT Intégrer les NTIC : les challenges du CT Intégrer les NTIC : les challenges du CT Intégrer les NTIC : les challenges du CTA A A 'une importance fondamentale pour la réussite de ces programmes. Cela vaut en particulier pour tous les programmes de développement dans lesquels les NTIC, et leur énorme potentiel d'amélioration des moyens de subsistance ruraux, jouent un rôle non négligeable. La question du genre est le terme habituellement employé pour souligner que les hommes et les femmes remplissent des rôles différents dans la société. Ces  ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE  A A A A L'adoption d'une  L'adoption d'une approche tenant  approche tenant compte de la  compte de la dimension hommes-  dimension hommes- femmes dans la  femmes dans la formulation et la  formulation et la mise en oeuvre des  mise en oeuvre des programmes  programmes d'agriculture, de  d'agriculture, de sécurité alimentaire et de coopération  sécurité alimentaire et de coopération rurale est d  rurale est d  Kevin Painting ([email protected]) est Kevin Painting ([email protected]) est  coordinateur principal de programme au coordinateur principal de programme au  département Canaux et Services de département Canaux et Services de  communication du CTA. communication du CTA. 6 6 6 6 6 ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate : numér e : numér e : numér e : numér e : numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin , juin , juin , juin , juin 6 6 6 6 6ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate : numér e : numér e : numér e : numér e : numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin , juin , juin , juin , juin  "},{"text":" Afrique subsaharienne : Une étude de cas du nord de et la technologie en Afrique subsaharienne : Une étude de cas du nord de et la technologie en Afrique subsaharienne : Une étude de cas du nord de et la technologie en Afrique subsaharienne : Une étude de cas du nord de et la technologie en Afrique subsaharienne : Une étude de cas du nord de GenARDIS subventionne les petits projets liant genre et NTIC GenARDIS subventionne les petits projets liant genre et NTIC GenARDIS subventionne les petits projets liant genre et NTIC GenARDIS subventionne les petits projets liant genre et NTIC GenARDIS subventionne les petits projets liant genre et NTIC ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE  ARTICLE ARTICLE ARTICLE ARTICLE ARTICLE ICT Update ICT Update ICT Update ICT Update ICT Update domaine assez négligé jusqu'ici, à savoir « ICT Update ICT Update ICT Update ICT Update ICT Updatedomaine assez négligé jusqu'ici, à savoir « Le CTA publie notamment ICT Update, un La question du genre et l'agriculture dans la Le CTA publie notamment ICT Update, unLa question du genre et l'agriculture dans la bulletin d'alerte pour l'agriculture ACP. Cette société de l'information » et a contribué à bulletin d'alerte pour l'agriculture ACP. Cettesociété de l'information » et a contribué à publication bimestrielle se présente sous la mettre ce sujet à l'ordre du jour de la publication bimestrielle se présente sous lamettre ce sujet à l'ordre du jour de la forme d'un magazine Web, d'un bulletin communauté internationale. forme d'un magazine Web, d'un bulletincommunauté internationale. imprimé et d'une newsletter diffusée par e- En 2003, l'assemblée annuelle de imprimé et d'une newsletter diffusée par e-En 2003, l'assemblée annuelle de mail. Chaque numéro traite d'un thème l'Observatoire des NTIC a étudié comment mail. Chaque numéro traite d'un thèmel'Observatoire des NTIC a étudié comment spécifique lié aux NTIC pour le les NTIC pourraient renforcer l'efficacité des spécifique lié aux NTIC pour leles NTIC pourraient renforcer l'efficacité des développement agricole et rural des pays services de vulgarisation agricole. développement agricole et rural des paysservices de vulgarisation agricole. ACP, et contient des articles de fond Chacune de ces assemblées a rédigé un ACP, et contient des articles de fondChacune de ces assemblées a rédigé un présentant des initiatives au niveau local, rapport qui peut être consulté sur le site présentant des initiatives au niveau local,rapport qui peut être consulté sur le site une liste de projets, et bien d'autres choses Internet du CTA (www.cta.int). une liste de projets, et bien d'autres chosesInternet du CTA (www.cta.int). encore. Tous les numéros des magazines  encore. Tous les numéros des magazines Web, y compris leurs nombreuses RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES Web, y compris leurs nombreusesRENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES RENFORCEMENT DES CAPACITES ressources documentaires, ont été Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC ressources documentaires, ont étéAteliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC Ateliers de sensibilisation aux NTIC rassemblés sur le CD-ROM préparé Le CTA organise au niveau régional des rassemblés sur le CD-ROM préparéLe CTA organise au niveau régional des spécialement pour ce numéro publié à ateliers pour favoriser la prise de spécialement pour ce numéro publié àateliers pour favoriser la prise de l'occasion du 20 e anniversaire du CTA. conscience des dirigeants ACP quant à l'occasion du 20 e anniversaire du CTA.conscience des dirigeants ACP quant à  l'application stratégique et à la mise en l'application stratégique et à la mise en Numéros 1-7 (2000/01) Bulletins généraux place durable des NTIC. Côte d'Ivoire (1998), Numéros 1-7 (2000/01) Bulletins générauxplace durable des NTIC. Côte d'Ivoire (1998), No. 8 (oct. 2002) Genre et NTIC Afrique du Sud (1999), No. 8 (oct. 2002) Genre et NTICAfrique du Sud (1999), No. 9 (janv. 2003) Services d'information  No. 9 (janv. 2003) Services d'information sur les marchés agricoles  sur les marchés agricoles No. 10 (mars 2003) Connectivité rurale  No. 10 (mars 2003) Connectivité rurale No. 11 (mai 2003) Gestion des ravageurs  No. 11 (mai 2003) Gestion des ravageurs No. 12 (juillet 2003) Gestion de l'eau  No. 12 (juillet 2003) Gestion de l'eau No. 13 (sept. 2003) Microfinancement  No. 13 (sept. 2003) Microfinancement No. 14 (nov. 2003) Vulgarisation agricole  No. 14 (nov. 2003) Vulgarisation agricole No. 15 (janv. 2004) L'élevage  No. 15 (janv. 2004) L'élevage No. 16 (mars 2004) La pêche  No. 16 (mars 2004) La pêche No. 17 (mai 2004) Régimes fonciers  No. 17 (mai 2004) Régimes fonciers Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour l'agriculture ACP l'agriculture ACP l'agriculture ACP l'agriculture ACP l'agriculture ACP les neufs projets récompensés les neufs projets récompensés les neufs projets récompensés les neufs projets récompensés les neufs projets récompensés Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour Observatoire des NTIC pour l'agriculture ACP l'agriculture ACP l'agriculture ACP l'agriculture ACP l'agriculture ACPles neufs projets récompensés les neufs projets récompensés les neufs projets récompensés les neufs projets récompensés les neufs projets récompensés L'Observatoire des NTIC créé par le CTA  L'Observatoire des NTIC créé par le CTA identifie les questions et les stratégies NTIC  identifie les questions et les stratégies NTIC présentant un intérêt pour l'agriculture ACP  présentant un intérêt pour l'agriculture ACP et suit le développement des NTIC destinées  et suit le développement des NTIC destinées à la gestion de l'information et de la communication. Chaque année, le CTA rassemble, sous les auspices de l'Observatoire des NTIC, les meilleurs • T T T T Tchad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au service du dév vice du dév vice du dév vice du dév vice du développement de la eloppement de la eloppement de la eloppement de la eloppement de la f f f f femme rurale au T emme rurale au T emme rurale au T emme rurale au T emme rurale au Tchad chad chad chad chad, Grâce Agouna, Audy Magazine • Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP), Joana Francis Adda, PACODEV à la gestion de l'information et de la communication. Chaque année, le CTA rassemble, sous les auspices de l'Observatoire des NTIC, les meilleurs• T T T T Tchad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au ser chad : La radio communautaire au service du dév vice du dév vice du dév vice du dév vice du développement de la eloppement de la eloppement de la eloppement de la eloppement de la f f f f femme rurale au T emme rurale au T emme rurale au T emme rurale au T emme rurale au Tchad chad chad chad chad, Grâce Agouna, Audy Magazine • Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP) Ghana : Participatory community planning (PCP), Joana Francis Adda, PACODEV experts des pays ACP et de l'UE dans le domaine des NTIC pour le développement. La première réunion de ces experts a conseillé au CTA d'adopter une stratégie NTIC à long terme permettant d'améliorer l'audience et la qualité de ses services d'information et de communication agricoles. En 2001, l'assemblée annuelle de l'Observatoire a étudié les technologies offrant un accès sans fil à Internet par satellite. Les participants à cette réunion ont mis en évidence le potentiel énorme • Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs, Dorienne Rowan-Campbell, Networked Intelligence for Development • Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture, James Onyango, Kenya AIDS Intervention Prevention Project Group • Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise, Bessie Nyirenda, Computer Land Ltd • Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal, Joseph Kiplang'at, University of Zululand • T T T T Tanzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la question du genre à l'inf uestion du genre à l'inf uestion du genre à l'inf uestion du genre à l'inf uestion du genre à l'information, la communication ormation, la communication ormation, la communication ormation, la communication ormation, la communication experts des pays ACP et de l'UE dans le domaine des NTIC pour le développement. La première réunion de ces experts a conseillé au CTA d'adopter une stratégie NTIC à long terme permettant d'améliorer l'audience et la qualité de ses services d'information et de communication agricoles. En 2001, l'assemblée annuelle de l'Observatoire a étudié les technologies offrant un accès sans fil à Internet par satellite. Les participants à cette réunion ont mis en évidence le potentiel énorme• Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture Jamaïque : Outils et services NTIC pour le développement de l'agriculture biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné biologique dans les Caraïbes : un séminaire régional de formation destiné aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs aux femmes entrepreneurs, Dorienne Rowan-Campbell, Networked Intelligence for Development • Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture Kenya : Radio communautaire sur les questions de santé et d'agriculture, James Onyango, Kenya AIDS Intervention Prevention Project Group • Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise Malawi : FarmWise, Bessie Nyirenda, Computer Land Ltd • Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des Afrique du Sud : Accroître le rôle des NTIC dans la diffusion des informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au informations agricoles pour le développement rural parmi les femmes au Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal Kwa-Zulu Natal, Joseph Kiplang'at, University of Zululand • T T T T Tanzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la q anzanie : Intégrer la question du genre à l'inf uestion du genre à l'inf uestion du genre à l'inf uestion du genre à l'inf uestion du genre à l'information, la communication ormation, la communication ormation, la communication ormation, la communication ormation, la communication des petites applications VSAT, de faible coût, qui permettent une communication à double sens et qui pourraient ainsi rendre et la technologie en la T la T la T la T anzanie anzanie, Pantaleon Shoki, Community Development and Relief Agency (CODRA) la Tanzanie anzanie anzanie des petites applications VSAT, de faible coût, qui permettent une communication à double sens et qui pourraient ainsi rendreet la technologie en la T la T la T la T anzanie anzanie, Pantaleon Shoki, Community Development and Relief Agency (CODRA) la Tanzanie anzanie anzanie Internet accessible pour les zones rurales  Internet accessible pour les zones rurales des pays ACP.  des pays ACP. En 2002, l'Observatoire a examiné un  En 2002, l'Observatoire a examiné un ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 2004 7 7 7 7 7 ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate: numér e: numér e: numér e: numér e: numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A, juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 20047 7 7 7 7  "},{"text":"Selon vous, quelles sont les applications NTIC les plus prometteuses pour fournir un accès Internet abordable, aux zones rurales des pays ACP ? //ictupdate.cta.int http://ictupdate.cta.int http://ictupdate.cta.int http://ictupdate.cta.int http://ictupdate.cta.int), en version papier et sous forme d'une newsletter diffusée par e-mail. ICT Update paraît tous les deux mois. ), en version papier et sous forme d'une newsletter diffusée par e-mail. ICT Update paraît tous les deux mois. ), en version papier et sous forme d'une newsletter diffusée par e-mail. ICT Update paraît tous les deux mois. ), en version papier et sous forme d'une newsletter diffusée par e-mail. ICT Update paraît tous les deux mois.), en version papier et sous forme d'une newsletter diffusée par e-mail. ICT Update paraît tous les deux mois. sans relâche la promotion des NTIC pour le développement et il connaît sans doute ce domaine à fond. Au début des années 90, il a sillonné l'Afrique pour aider les ONG à installer leurs premiers systèmes de courrier électronique à envoi différé, avec le soutien d'APC/GreenNet. De nos jours, il est l'un des conseillers les plus demandés par les gouvernements africains et les organisations internationales en matière de politiques de NTIC pour le développement. Questions-Réponses : P Questions-Réponses : P Questions-Réponses : P Questions-Réponses : P Questions-Réponses : Par ar ar ar articiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiques de télécommunications ues de télécommunications ues de télécommunications ues de télécommunications ues de télécommunications Questions-Réponses : P Questions-Réponses : P Questions-Réponses : P Questions-Réponses : P Questions-Réponses : Par ar ar ar articiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiq ticiper au dialogue sur les politiques de télécommunications ues de télécommunications ues de télécommunications ues de télécommunications ues de télécommunications Depuis plus de 15 ans, Mike Jensen Mike Jensen Mike Jensen Mike Jensen Mike Jensen fait MJ : Les infrastructures de  Depuis plus de 15 ans, Mike Jensen Mike Jensen Mike Jensen Mike Jensen Mike Jensen fait MJ : Les infrastructures de télécommunications terrestres (par fibre  télécommunications terrestres (par fibre optique) sont le moyen le moins cher de  optique) sont le moyen le moins cher de se connecter à Internet. Il faudra cependant  se connecter à Internet. Il faudra cependant encore 10 ans avant que des infrastructures  encore 10 ans avant que des infrastructures de ce type n'existent dans les zones rurales  de ce type n'existent dans les zones rurales en Afrique. Dans l'intervalle, je pense  en Afrique. Dans l'intervalle, je pense qu'une application sans fil fournissant un  qu'une application sans fil fournissant un accès à Internet à double sens et à large  accès à Internet à double sens et à large bande passante par satellite est l'option la  bande passante par satellite est l'option la plus intéressante pour répondre aux  plus intéressante pour répondre aux besoins les plus urgents. Cette  besoins les plus urgents. Cette technologie existe déjà, elle s'appelle « Ku-  technologie existe déjà, elle s'appelle « Ku- band VSAT » et m'a été présentée pour la  band VSAT » et m'a été présentée pour la première fois il y a trois ans, lors de l'une  première fois il y a trois ans, lors de l'une des réunions annuelles de l'Observatoire  des réunions annuelles de l'Observatoire des NTIC du CTA.  des NTIC du CTA.  . . ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate e e e e, numér , numér , numér , numér , numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin 2004. , juin 2004. , juin 2004. , juin 2004. , juin 2004. ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate e e e e est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la fois sur Int ois sur Int ois sur Int ois sur Int ois sur Interne erne erne erne ernet t t t t ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate e e e e, numér , numér , numér , numér , numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin 2004. , juin 2004. , juin 2004. , juin 2004. , juin 2004. ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate e e e e est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la f est un magazine multimédia disponible à la fois sur Int ois sur Int ois sur Int ois sur Int ois sur Interne erne erne erne ernet t t t t ( ( ( ( (http:Chaq Chaq Chaq Chaq Chaque numér ue numér ue numér ue numér ue numéro se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème particulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le développement agricole e eloppement agricole e eloppement agricole e eloppement agricole e eloppement agricole et rural dans les pa t rural dans les pa t rural dans les pa t rural dans les pa t rural dans les pays A ys A ys A ys A ys ACP CP CP CP CP. . . . . ( ( ( ( (http:Chaq Chaq Chaq Chaq Chaque numér ue numér ue numér ue numér ue numéro se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème par o se concentre sur un thème particulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le dév ticulier lié aux NTIC pour le développement agricole e eloppement agricole e eloppement agricole e eloppement agricole e eloppement agricole et rural dans les pa t rural dans les pa t rural dans les pa t rural dans les pa t rural dans les pays A ys A ys A ys A ys ACP CP CP CP CP. . . . . CT CT CT CT CTA Centre t A Centre t A Centre t A Centre t A Centre techniq echniq echniq echniq echnique de coopération agricole e ue de coopération agricole e ue de coopération agricole e ue de coopération agricole e ue de coopération agricole et rurale A t rurale A t rurale A t rurale A t rurale ACP-UE, A CP-UE, A CP-UE, A CP-UE, A CP-UE, Agr gr gr gr gro Business P o Business P o Business P o Business P o Business Par ar ar ar ark 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW Wageningen, P ageningen, P ageningen, P ageningen, P ageningen, Pa a a a ays-Bas ys-Bas ys-Bas ys-Bas ys-Bas CT CT CT CT CTA Centre t A Centre t A Centre t A Centre t A Centre techniq echniq echniq echniq echnique de coopération agricole e ue de coopération agricole e ue de coopération agricole e ue de coopération agricole e ue de coopération agricole et rurale A t rurale A t rurale A t rurale A t rurale ACP-UE, A CP-UE, A CP-UE, A CP-UE, A CP-UE, Agr gr gr gr gro Business P o Business P o Business P o Business P o Business Par ar ar ar ark 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW W k 2, 6708 PW Wageningen, P ageningen, P ageningen, P ageningen, P ageningen, Pa a a a ays-Bas ys-Bas ys-Bas ys-Bas ys-Bas Production et content management : Production et content management : Production et content management : Production et content management : Production et content management : Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Production et content management : Production et content management : Production et content management : Production et content management : Production et content management : Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Contactivity bv, Nieuwe Mare 23, 2312 NL Leiden, Pays-Bas Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Valerie Jones / Valerie Jones / Valerie Jones / Valerie Jones / Valerie Jones / Site Internet : Site Internet : Site Internet : Site Internet : Site Internet : Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Coordination rédactionelle : Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Rutger Engelhard / Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Recherche et rédaction : Valerie Jones / Valerie Jones / Valerie Jones / Valerie Jones / Valerie Jones / Site Internet : Site Internet : Site Internet : Site Internet : Site Internet : Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / Sebastiaan van der Vliet / T T T T Traduction : raduction : raduction : raduction : raduction : Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue et P t P t P t P t Patrice Pingue atrice Pingue atrice Pingue atrice Pingue atrice Pinguet / t / t / t / t / Conseiller Conseiller Conseiller Conseiller Conseiller s scientif s scientif s scientif s scientif s scientifiq iq iq iq iques : ues : ues : ues : ues : K K K K Ke e e e evin P vin P vin P vin P vin Painting, P ainting, P ainting, P ainting, P ainting, Pe e e e et t t t ter Ballantyne. er Ballantyne. er Ballantyne. er Ballantyne. er Ballantyne. T T T T Traduction : raduction : raduction : raduction : raduction : Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue e Bruno Lagarrigue et P t P t P t P t Patrice Pingue atrice Pingue atrice Pingue atrice Pingue atrice Pinguet / t / t / t / t / Conseiller Conseiller Conseiller Conseiller Conseiller s scientif s scientif s scientif s scientif s scientifiq iq iq iq iques : ues : ues : ues : ues : K K K K Ke e e e evin P vin P vin P vin P vin Painting, P ainting, P ainting, P ainting, P ainting, Pe e e e et t t t ter Ballantyne. er Ballantyne. er Ballantyne. er Ballantyne. er Ballantyne. Cop Cop Cop Cop Copyright © 2004 CT yright © 2004 CT yright © 2004 CT yright © 2004 CT yright © 2004 CTA A A A A , W , W , W , W , Wageningen, P ageningen, P ageningen, P ageningen, P ageningen, Pa a a a ays-Bas. Sit ys-Bas. Sit ys-Bas. Sit ys-Bas. Sit ys-Bas. Site Int e Int e Int e Int e Interne erne erne erne ernet : t : t : t :  Cop Cop Cop Cop Copyright © 2004 CT yright © 2004 CT yright © 2004 CT yright © 2004 CT yright © 2004 CTA A A A A , W , W , W , W , Wageningen, P ageningen, P ageningen, P ageningen, P ageningen, Pa a a a ays-Bas. Sit ys-Bas. Sit ys-Bas. Sit ys-Bas. Sit ys-Bas. Site Int e Int e Int e Int e Interne erne erne erne ernet : t : t : t : 8 8 8 8 ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate : numér e : numér e : numér e : numér e : numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 2004 8 8 8 8ICT U ICT U ICT U ICT U ICT Updat pdat pdat pdat pdate : numér e : numér e : numér e : numér e : numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A A A , juin 2004 , juin 2004 , juin 2004 , juin 2004 , juin 2004  "}],"sieverID":"2ecc0437-ca2c-45d2-947f-494a000f6557","abstract":"numéro spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniv o spécial 20e anniver er er er ersaire du CT saire du CT saire du CT saire du CT saire du CTA A A"}

data/part_1/067898ec11fcfef5db6685a2a16a404a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"067898ec11fcfef5db6685a2a16a404a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/754c7146-fcb5-4f34-8e8f-53ea15f0a424/retrieve"},"pageCount":29,"title":"Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia Contents","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":170,"text":"Tables Table 1. Descriptions of the study sites in Ethiopia Table 2. Number of participants by their gender and resource endowments for the application of LC tool at Digga and Sinana woredas Table 3. List of legume species grown and their functions at Arjo Qonnan Bula kebele, Digga woreda Table 4. Legume species which scored high following application of the LC tool at Arjo Qonnan Bula kebele, Digga woreda Table 5. List of legume species grown and their functions at Jirata kebele, Digga woreda Table 6. Legume species which scored high following application of the LC tool at Jirata kebele, Digga woreda Table 7. List of legume species grown and their functions at Aman Laman kebele, Sinana woreda Table 8. Legume species which scored high following application of the LC tool at Aman Laman kebele, Sinana woreda Table 9. List of legume species grown and their functions at Shallo kebele, Sinana woreda Table 10. Legume species which scored high following application of the LC tool at Shallo kebele, Sinana woreda "}]},{"head":"Summary","index":2,"paragraphs":[{"index":1,"size":144,"text":"Focus group discussions (FGDs) were conducted with smallholder farmers in Digga woreda and Sinana woredas of Ethiopia to identify the existing legume species grown by smallholder farmers, assess legume production constraints, and the benefits of legumes and seek niches for new usage of legumes. The Legume CHOICE (LC) tool was used to support decision making on suitable legume species that can be grown in participatory consultation with farmers in the targeted kebeles. The Legume CHOICE tool focuses on six key functions of legumes, which are provision of food, income, livestock feed, fuel, soil erosion control and soil fertility improvement, and contextualizes the key production constraints based on the dialogue with farmers. Farmers were selected ensuring representation across gender and resource endowments. Three farmer resource types (high, medium and low) were determined based on farmers' land size, livestock holdings and other factors, i.e. fertilizer use."},{"index":2,"size":226,"text":"In general, we observed that the participating farmers have limited formal understanding of the types of legumes across the four sites. Their knowledge mainly related to the annual grain legumes used for rotation with their common cereals. However, herbaceous and tree legumes could not be immediately identified as legumes by most farmers and their benefits were not recognized beyond livestock feed, live fencing and fuel. The FGDs and application of LC tool exercises demonstrated that preferences for legume functions vary among the farmer resource types, gender and sites. However, we observed that the preferences for food and income functions were consistently scored highest, the other functions (feed, fuel, erosion control and soil fertility improvement) were demanded with variable degrees or ranks across sites, gender and farmer resource types. The common constraints faced by farmers in legume production include lack of improved legume varieties, lack of legume production knowledge and skills, high weed burden, disease and pest incidence, high costs of inputs (i.e. pesticides, fertilizer), lack of inputs and services, and soil erosion. These findings were also supported by the output of the LC tool application. The top three constraints across the four sites were the shortage of improved seeds, lack of inputs and services, and knowledge and skills on the improved production techniques of legumes. These constraints also varied across sites, gender, and farmer resource types."},{"index":3,"size":219,"text":"The results from the LC tool \"hit list\" offered a range of suitable annual, herbaceous and tree legume species with the consideration of agroecology, context and community needs. Some legume species were not found in the LC top-ranked legume species lists even though they are well known for their adaptation and functions in the sites. These results were presented for farmers and in consultation with them, 2-3 annual grain legumes were selected per site for demonstration trials. The establishment of on-farm demonstration trials were aimed to increase the awareness of farmers for legume production management, access for planting materials of the improved varieties in particular to address the prioritized legume functions, i.e. food and income; and to collect supplemental information for the further development of the LC tool. The exercises gave us multi-dimensional observations and understanding on expressed needs for the various legume functions, production constraints and lists of top ranked legumes variations for specific sites; gender and farmer resource types. The work also stimulated extension officers to deepen their knowledge and skills on different types of legumes in the farming system. Accordingly, the outputs presented in this report provide preliminary information for further refinement of the LC tool for better decision support in legume selection for specific sites by addressing the functional needs and widely varying farming contexts."}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":151,"text":"Growth in agricultural productivity lags behind population growth in sub-Saharan Africa making the region increasingly food and nutrition insecure. More than 80% of the Ethiopian population is dependent on agriculture, which accounts for about 50% of gross domestic product (GDP), 90% of the exports, and 85% of the employment (Tamene et al. 2017). Smallholder farmers in Ethiopia practice mixed crop-livestock farming under rainfed conditions. They contribute significantly to the country's economy although their productivity is low. This is due to several challenges faced by farmers which include erratic rainfall patterns, limited access to inputs and low soil fertility. Legumes have strong potential to deal with many of the constraints to improved smallholder livelihoods and natural resource status, either in the form of grains for home consumption or sale, fodder for livestock feed, protein for health and nutrition, available soil nutrients, or fuel wood (Vanlauwe et al. 2019 andYirga et al. 2010)."},{"index":2,"size":100,"text":"Most farmers in Ethiopia grow maize, wheat, barley or teff often with limited resources hence the yield gaps are wide. Legumes including faba bean, common bean, chickpea, etc. are usually grown in smallholder farms as intercrops and rotations with cereal crops. Legumes have a range of functions which include provision of food, feed, income, soil fertility improvement, soil erosion control and provision of fuel. Grain legumes are more common in smallholder farms than herbaceous and tree legumes because most farmers are interested in food and income provision from among the various benefits legumes offer (Muoni 2019 andVanlauwe et al. 2019)."},{"index":3,"size":133,"text":"Finding niches for multipurpose legumes could help alleviate poverty, increase food security, improve nutrition and enhance natural resource status. However, despite several decades of agricultural research for development, so far there has been only limited uptake of legumes by the poorest farming households (Vanlauwe et al. 2019). This could relate to high variation in resource endowment, climatic conditions and soil types in smallholder farms which influences decision making and spread of information (Muoni 2019 andTittonell et al. 2015). Challenges faced by farmers in use of legumes could be addressed by improved extension services supported with decision support tools (Duncan et al. 2019;Muoni 2019;Wambugu et al. 2011). Decision support tools aim at providing clear decision stages and helping visualize the likelihood of various outcomes which helps in making evidence-based decisions (Rose et al. 2016)."},{"index":4,"size":132,"text":"To improve use of legumes in smallholder farms, efforts to improve decision making on suitable species has been made through decision support tools such as the Legume CHOICE (LC) tool which was developed in the LegumeCHOICE project (2014)(2015)(2016)(2017). The tool is currently being tested in the Legume SELECT project in smallholder farms. The Legume SELECT project aims at improving use of legumes in smallholder farming systems in sub-Saharan Africa (SSA) through improved decision making on suitable legumes for different locations depending on biophysical and social conditions. The project includes research trials which will facilitate better understanding of the relationship between legume traits (water use efficiency, nutrient use efficiency and N-fixation), and farmer needs in a range of biophysical and socioeconomic contexts. This will help to refine a more robust Legume CHOICE tool. "}]},{"head":"Logical flow of Legume CHOICE tool","index":4,"paragraphs":[{"index":1,"size":46,"text":"Legume CHOICE is designed to be a rapid approach to identifying promising legume options and interventions based on community dialogue and expert knowledge (Duncan et al. 2019). It consists of a series of components (Figure 1). The logic of the Legume CHOICE tool is as follows."},{"index":2,"size":30,"text":"• Qualitative diagnosis: is a simple checklist of questions designed to construct a broad overview of the farming context focusing in particular on those elements of relevance to legume use."},{"index":3,"size":32,"text":"• Context assessment: goes deeper by specifically considering a series of key constraints to legume use and assigning a score to each key constraint for the particular context or community being studied."},{"index":4,"size":50,"text":"• Community needs: assessment involves a series of participatory exercises with a community to gather an understanding of their needs in relation to what legumes might offer. Each of a series of \"legume functions\" is given a score representing the extent to which a particular community demands a given function."},{"index":5,"size":24,"text":"• Agroecological filter: that scores legume options according to their suitability to the agroecological conditions (altitude, rainfall, soil quality etc.) of the target site."},{"index":6,"size":52,"text":"• Legume option attributes: the final component is a long list of legume options each pre-scored by experts on (1) their sensitivity to the various legume use constraints (from the Context Assessment) (2) how well they supply various predefined legume functions (from the Community Needs Assessment) and ( 3) their agroecological requirements."},{"index":7,"size":41,"text":"The scores in legume option list are compared against (1), ( 2) and (3) to give an overall score for each legume option on their suitability for the given context in relation to use constraints, legume function supply and agroecological match. "}]},{"head":"Methods","index":5,"paragraphs":[{"index":1,"size":4,"text":"Description of study sites"},{"index":2,"size":61,"text":"The study was conducted between July and September 2019 in Digga woreda, western Ethiopia and Sinana woreda, southeastern Ethiopia. Arjo Qonnan Bula and Jirata kebeles (=sites) were selected from Digga woreda; and Aman Laman and Shallo kebeles were chosen from Sinana woreda based on their access to market, mainly their distance from the main road to the central marketplace (Table 1)."},{"index":3,"size":133,"text":"Digga woreda is located around 350 km west of Addis Ababa. Digga has an altitude ranging from 1200-2300 m; mean total annual rainfall of 2080 mm (Daba 2018)and mean temperatures 21 0 C (Sparks 2018). The second target woreda, Sinana woreda is located around 450 km southeast of Addis Ababa. Sinana has an altitude ranging from 1700-3100 m; mean total rainfall of 930 mm (SDAO 2006) and mean temperature 18 0 C (Sparks 2018). The farming system in Digga is dominated by maize, teff, finger millet-based crop-livestock production but at Sinana is dominated by wheat, barley, field pea, faba beanbased crop-livestock production. The soil pH of Digga and Sinana can be categorized as from moderately to strongly acidic; and from slightly acidic to neutral, respectively (Hengl et al. 2015 andLeenaars et al. 2014). "}]},{"head":"Identification of participants","index":6,"paragraphs":[{"index":1,"size":131,"text":"Refresher training was given for the Legume SELECT country team, then consecutive practical trainings were provided for the extension staff and researchers to acquaint them on the nature and application of the Legume CHOICE tool. Extension officers from the two woredas facilitated the identification of farmers to participate in the FGDs and application of the LC tool. One FGD was conducted per kebele and multiple farmers participated in each FGD. A total of 122 farmers (29 women and 93 men) participated in the FGDs in the four sites. Of these, 72 farmers were picked for further application of LC tool, i.e. participatory matrix scoring based on their resource endowment and gender (Table 2). Although more women farmers were invited for the FGDs, they could not attend due to multiple socioeconomic factors."},{"index":2,"size":52,"text":"The resource endowment classes were determined based on farmers' land size, livestock holdings and other factors including fertilizer use and proportions of farm produce sold to the market (Duncan et al. 2019). Based on these the information gathered from the key informants and farmers, the following three resource endowment classes were used."},{"index":3,"size":118,"text":"i. High resource (wealthy class): comprised of farmers owning more than 3 ha of land which could be certified or noncertified; with 4 or more oxen and who apply recommended amount of mineral fertilizer on the farms ii. Medium resource (middle class): comprised of farmers owning between 1 and 3 ha of land which could be certified or non-certified; with 2-4 oxen and who apply below recommended rate of mineral fertilizer on the farms iii. Low resource (poor class): comprised of farmers owning less than 1 ha of land; with 1 or no oxen and who do not use mineral fertilizer or apply low amount relative to the recommended rate on their farms Application of the LC tool"}]},{"head":"Qualitative diagnosis","index":7,"paragraphs":[{"index":1,"size":46,"text":"This exercise provided a qualitative assessment of the farming system in relation to possible legume niches. It also helped to assess farmers' knowledge about legumes and the challenges they face to produce them. Also, this exercise identified the legume species grown by farmers in different villages."}]},{"head":"Context assessment","index":8,"paragraphs":[{"index":1,"size":57,"text":"The context assessment exercise took account of resource endowment classes where farmers scored different factors which limit production of legumes. The scored constraints were land availability, labour, seed availability, market access, input availability, knowledge and skills, and water availability. The scores were from zero to four where zero indicates that the factor is not a limiting factor."}]},{"head":"Pairwise ranking","index":9,"paragraphs":[{"index":1,"size":44,"text":"The exercise involved presenting the six key legume functions incorporated in the LC tool (food, feed, soil erosion control, soil fertility improvement, fuel and income) and asked the farmers to prioritize among pairs of functions. The exercise was conducted separately for men and women."}]},{"head":"Participatory matrix scoring","index":10,"paragraphs":[{"index":1,"size":56,"text":"This exercise was conducted to assess what individual farmers of different gender and resource endowments would look for in any new intervention involving legumes. Farmers were given 20 beans and asked to allocate them according to the importance of the various functions for their future aspirations. This helps to triangulate the results of the previous exercise."}]},{"head":"Data collation and analysis","index":11,"paragraphs":[{"index":1,"size":58,"text":"Qualitative and quantitative data were collected, summarized and combined. The results of the context assessment, pairwise ranking and participatory matrix scoring with the agroecological parameters were used to come up with a list of legume options for each site. Local names of legumes listed in the FGDs were referred and translated into English or scientific names (Bekele-Tesemma 2007)."},{"index":2,"size":51,"text":"A summary of the scores for each category (agroecological, socioeconomic and farmer aspiration fits) was also generated against each legume species. The output of the LC tool was a list of potential legumes that would fulfil the priority needs of the farming communities, were compatible with the biophysical and socioeconomic conditions."},{"index":3,"size":81,"text":"Subsequent discussions were undertaken on which legumes would be selected for on-farm demonstrations in the targeted kebeles. Mainly grain legumes were targeted for on-farm demonstration trials because of the urgency of the growing season and availability of planting materials. These demonstration trials were also set up to increase the awareness of farmers on the management of legumes and increase the access to improved seeds of legume varieties which can adapt the area and fulfil the functional needs of farmers. southeastern Ethiopia"}]},{"head":"Results","index":12,"paragraphs":[]},{"head":"Understanding of legumes","index":13,"paragraphs":[{"index":1,"size":141,"text":"We referred the following legume definition and concepts to communicate with farmers participating in the FGDs. Plants belonging to the family Fabaceae (or Leguminosae) are characterized by their ability to form a symbiotic relationship with soil bacteria called rhizobia contained within root nodules which fix atmospheric nitrogen which can be used by the host plant (although not all legumes fix nitrogen). This nitrogen-fixing ability presents considerable benefits to plants growing in nitrogen-constrained environments and lends them various functions of potential benefit to humans who utilize them for various livelihood purposes. Legumes as a plant family are diverse in structure ranging from herbaceous plants through to woody shrubs and trees. This diversity of form and function presents multiple opportunities for beneficial human use but also complexity in terms of how different legume species fit within different farming systems (Duncan et al. 2019)."},{"index":2,"size":100,"text":"In general, we observed that the participating farmers had limited formal understanding of the technical definitions of legumes across the four sites. Their understanding was mostly limited to the annual grain legumes used for rotation with their common cereals. The farmers indicated the grain legumes as root nodule producers and to some extent as pod producers. These grain legumes are known by their source of food, income, and soil fertility improvement. However, herbaceous and tree legumes could not be immediately identified as legumes by most farmers and were not recognized for their benefits beyond livestock feed, live fencing and fuel."},{"index":3,"size":46,"text":"After warm up discussions and briefing about the definition and types of legumes, the farmers were able to identify multiple legume species and several livelihood functions of legumes including provision of food, feed, income, soil improvement, medicine, fuel, fencing, construction materials, coffee shade, and erosion control."},{"index":4,"size":6,"text":"Site 1: Arjo Qonnan Bula kebele"},{"index":5,"size":77,"text":"Major legumes produced and objectives of production A total of 20 farmers participated (9 women and 11 men) in the FGD at Arjo Qonnan Bula kebele. The farmers in the kebele produce legume crops including groundnut, common bean (bush type), climbing bean (annual type), soybean, cowpea, and fodder/ tree legumes, i.e. Lablab, Sesbania, Leucaena, and Acacia species (Table 3). According to the respondents, farmers grow legumes for income, food, soil fertility improvement and livestock feed (Table 3)."},{"index":6,"size":220,"text":"Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia The results of pairwise ranking exercise show that there were some differences between men and women farmers in their preferences for legume functions (Figure 2). Food, income source and soil fertility improvement were the demanded legume functions by both men and women. But women farmers had higher preference for the fuel function and a higher preference for soil fertility than men farmers. The results of participatory matrix scoring exercise show that there were differences in preferences for legume functions between gender and among farm types (Figure 3). Accordingly, men farmers demand the legumes mainly for food and income generation while women farmers prefer the legumes for fuel and food in addition income generation. Legumes for soil fertility function was the last function for women but fourth for men. The preferences for legume functions among the farm types are almost the same for high and medium resource farmers. Food and income generation came foremost but high resource farmers' demand for feed function was lower than the other two types. Low resource farmers on the other hand wanted feed as a priority function from legumes followed by food and income generation. Constraints to legume production in Arjo Qonnan Bula kebele"},{"index":7,"size":45,"text":"Participants of the FGD identified several challenges limiting legume production which included lack of improved legume varieties, soil fertility degradation over time, lack of legume production knowledge (to implement improved practices), high disease and insect pest incidences, high costs of inputs (fertilizer) and soil erosion."},{"index":8,"size":183,"text":"The results of the context scoring exercise show that lack of improved legume seeds, lack of knowledge and skills, high input and service costs (i.e. herbicides fertilizers) are the key constraints limiting legume production in Arjo Qonnan Bula kebele (Figure 4). These constraints varied across the resource endowments of farmers. Medium and low resource farmers were highly constrained by access and shortage of improved seeds, but high resource farmers were limited by shortage of inputs and services delivery (i.e. herbicides and fertilizer). Lack of proper knowledge and skills on the management of legumes came as the second most constraint for all farmer types. Based on the result of legume options score section of Legume CHOICE tool, a total of 11 legume species from different types came out as potential candidates taking into account the various functional attributes, context suitability, and agroecological suitability for growing in Arjo Qonnan Bula kebele (Table 4). These were 5 grain legumes (Pigeon pea, Climbing beans, Dolichos lablab, French beans, Groundnuts); 1 herbaceous legume (lablab) and 5 tree legumes (Calliandra calothyrus, Gliricidia sepium, Leucaena diversifolia, Leucaena trichandra, Sesbania sesban)."},{"index":9,"size":124,"text":"Common bean (bush type), groundnut and soybean were selected for on-farm demonstrations in the 2019 cropping season at Arjo Qonnan Bula in consultation with lead farmers. Soybean, however, was excluded by agroecological filter due to the large amount of rainfall in the area but farmers wanted to test it on their farms. The participatory scoring above showed that the farmers in Arjo Qonnan Bula kebele demand legumes mainly for food and income generation. In addition, their key constraints were lack of improved seeds and lack of knowledge/awareness of production. So, these issues would be demonstrated through the establishment of on-farm demonstration trials using bush bean, groundnut and soybean as entry point in the 2019 cropping season with better management practices and wider adaptable varieties.  "},{"index":10,"size":36,"text":"Note: P=perennial; S=seasonal/annual; Herb=herbaceous; C=coppicing; NC=non-coppicing. The colors indicate that suitability of a range of different legume options score well on each criteria (green is good, red is bad). Blue color indicates the top ranked legumes."},{"index":11,"size":22,"text":"Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia"},{"index":12,"size":4,"text":"Site 2: Jirata kebele"},{"index":13,"size":334,"text":"Major legumes produced and objectives of production At Jirata 29 farmers participated (11 women and 18 men) in the FGD and they mentioned that Faba bean, Field pea, Common bean (bush type), Climbing bean (annual type), Chickpea, Lentil, Sweet Lupine, Cowpea, Lablab, Sesbania, Leucaena, and Acacia species are among the legume species grown in the community (Table 5). Farmers identified several benefits of growing legumes and these include provision of food, soil fertility improvement, income and provision of livestock feed (Table 5). Although the functions of the legume species were common among participants, the results of pairwise ranking exercise show that there were some differences on preferences for legume functions between men and women farmers. Food, income and soil fertility improvement were demanded by both men and women (Figure 5). But women farmers had higher demand for fuel than men farmers who scored zero for this function. The results of participatory matrix scoring exercise showed that there were differences in preferences for legume functions between gender and among farm types at Jirata kebele (Figure 6). Accordingly, men farmers demand the legumes mainly for food and income generation while the women prefer legumes for fuel and erosion control next to food. The preferences for legume functions among the farm types are almost the same but the low resource farmers' demand for erosion control function is slightly higher than the other two types.   4 0 4 1 0 1 2 3 4 4 3 4 4 35  1  1 2 Field Pea (Pisum sativum L) Grain S 4 3 4 2 0 2 3 2 2 1 2 3 1 12 30  1 3 Faba bean (Vicia faba L.) Grain S 4 2 4 1 0 3 2 3 4 3 2 2 2  9 Sesbania sesban Tree NC 0 4 2 4 3 3 1 2 1 2 2 2 3 3 23 1 10 Acacia angustissima Tree NC 0 2 3 3 4 3 2 2 1 2 2 1 3 12 30 1"},{"index":14,"size":35,"text":"Note: P=perennial; S=seasonal/annual; Herb=herbaceous; C=coppicing; NC=non-coppicing;.The colors indicate that suitability of a range of different legume options score well on each criteria (green is good, red is bad). Blue color indicates the top ranked legumes."},{"index":15,"size":5,"text":"Site 3: Aman Laman kebele"},{"index":16,"size":260,"text":"Major legumes produced and objectives of production A total for forty (40) farmers (5 women and 35 men) participated in the FGDs at Aman Laman kebele. Results show that faba bean, field pea, chickpea, lentil, grass pea, fenugreek, and climbing bean (annual type) were the major food and cash legume crops grown (Table 7). Farmers grow legumes for food, income, soil fertility improvement and livestock feed among other benefits. The pairwise ranking exercise showed that most of the legume function preferences were commonly shared between men and women farmers. However, the women farmers expressed higher demand for legumes that provide feed for their livestock than men (Figure 8). The participatory matrix scoring exercise indicated there were differences in demand for legume functions among the three farm types and between men and women farmers. Both men and women demand the legumes mainly for food and income generation, however, women farmers had higher demand for legumes that provide soil fertility improvement, feed for livestock, and fuel than men farmers. All the three farm types had preferences for legumes that provide food and income, but the demand for legume functions as food and income generation were higher for low and medium resource farmers, respectively (Figure 9). Constraints to legume production in Aman Laman kebele Participants of the FGD identified the following challenges that they are facing for production of legumes; lack of improved legume varieties, lack of knowledge (to implement improved practices), soil fertility degradation over time, disease and insect pests attack, high costs of inputs (fertilizer), unavailability of pesticides and soil erosion."},{"index":17,"size":194,"text":"Context scoring results show that lack of improved seeds, water, inputs and services, and knowledge are the key constraints to legume production in Aman Laman kebele (Figure 10). Land, labour and markets were the least scored factors limiting productivity of legumes in this area. These constraints vary across farmer resource types. High resource farmers were highly constrained by shortage of improved seeds and access to irrigation water. Medium resource farmers were also relatively constrained by access to improved seeds and knowledge and skills on the management of legumes. Low resource farmers were highly constrained by shortage of land, followed by access to improved seeds and knowledge and skills on the management of legumes. Based on the result of legume options score section of the Legume CHOICE tool, a total of 13 legume species from different types came out as potential candidates for various functional plus context fulfilments, and agroecological suitability for growing in Aman Laman kebele (Table 8). These were 6 grain legumes (French beans, Faba bean, Lentils, Field Pea, Sweet lupin, Grass pea); 5 herbaceous legumes (Alfalfa/lucerne, silverleaf Desmodium, White clover, Hairy Vetch, Crotolaria juncea) and 2 tree legumes (Tree lucerne, Faidherbia albida)."},{"index":18,"size":24,"text":"Faba bean and field pea were selected in consultation with lead farmers for on-farm demonstrations for the 2019 cropping season at Aman Laman kebele."},{"index":19,"size":300,"text":"The participatory scoring exercise above showed that farmers in Aman Laman kebele demand legumes mainly for income generation and food. In addition, their key constraints were lack of improved seeds and lack of knowledge/awareness of production. So, these issues would be demonstrated through the establishment of on-farm demonstration trials using faba bean and field pea as entry points in the 2019 cropping season with better management practices and disease resistant varieties.  13 Faidherbia albida Tree NC 0 3 2 3 3 4 2 2 1 2 2 1 3 12 30 1 Major legumes produced and objectives of production A total of 33 participants (4 women and 29 men) participated in the FGDs at Shallo kebele. The results show that the community produces various legume species including faba bean, field pea, common bean, chickpea, lentil, fenugreek, alfalfa, vetch, Sesbania, and Acacia species (Table 9). These legumes are grown for food, income, livestock feed and soil fertility improvement depending on the legume type. The results of the pairwise ranking exercise show that there were differences between men and women farmers' perceptions on legume functions (Figure 11). Income and soil fertility were scored higher by men than women while food and soil erosion control were scored higher by women than men. Both genders had a similar score for provision of the fuel function. The participatory matrix scoring exercise showed that there were small differences between genders and among farm types on farmers' preferences for legume functions (Figure 12). Men farmers demanded food and income generation functions while women preferred fuel and erosion control in addition to food and income generation. The preferences for legume functions among the farm types are almost the same but, the medium resource farmers' demand for food function was slightly higher than the other two types (Figure 12). "}]},{"head":"Constraints to legume production in Shallo kebele","index":14,"paragraphs":[{"index":1,"size":63,"text":"Participants of the FGD identified several challenges/constraints that limit legume production in their area and these challenges include; lack of improved legume varieties, soil fertility degradation over time, weed problem or lack of herbicide for weed management in legume crops, lack of legume production knowledge (to implement improved practices), high diseases and insect pests incidences, and high costs of inputs (fertilizer and herbicides)."},{"index":2,"size":178,"text":"The context scoring exercise showed that lack of improved legume seeds, land availability, inputs and services and knowledge are the key constraints limiting legume production in Shallo kebele (Figure 13). Among other factors limiting legume production markets, labour and water are the other least constraining factors for the production of legumes in Shallo kebele. These constraints differ across the resource endowments of farmers. High and low resource farmers were highly constrained by shortage of improved seeds and land availability. Medium resources were highly constrained by shortage of inputs and services delivery and followed by knowledge and skills on the management of legumes. Based on the result of legume options score section of Legume CHOICE tool, a total of 11 legume species from different types came out as potential candidates for various functional plus context fulfilments, and agroecological suitability for growing in Aman Laman kebele (Table 10). These were 5 grain legumes (Faba bean, French beans, Lentils, Field Pea, Grass pea); 4 herbaceous legume (Alfalfa/lucerne, White clover, Hairy Vetch, Crotolaria juncea) and 2 tree legumes (Tree lucerne, Faidherbia albida)."},{"index":3,"size":93,"text":"Faba bean and field pea were selected in consultation with lead farmers for on-farm demonstrations for the 2019 cropping season at Shallo kebele. The participatory scoring above showed that the farmers in Shallo kebele demand legumes mainly for income generation and food. In addition, their key constraints were lack of improved seeds and lack of knowledge/awareness of production. So, these issues would be demonstrated through the establishment of on-farm demonstration trials using faba bean and field pea as entry point in the 2019 cropping season with better management practices and disease resistant varieties.  "},{"index":4,"size":37,"text":"Note: P=perennial; S=seasonal/ annual; Herb=herbaceous; C=coppicing; NC=non-coppicing. The colors indicate that suitability of a range of different legume options score well on each criteria (green is good, red is bad). Blue color indicates the top ranked legumes."},{"index":5,"size":22,"text":"Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia"}]},{"head":"Conclusions and recommendations","index":15,"paragraphs":[{"index":1,"size":160,"text":"The FGDs and application of LC tool exercises demonstrated that preferences for legume functions vary among the farmer resource types, gender and sites. However, we observed that the preferences for food and income functions were consistently scored highest, while the other functions (feed, fuel, erosion control and soil fertility improvement) were demanded to variable degrees across sites, gender and farmer resource types. The common constraints faced by farmers in legume production include lack of improved legume varieties, lack of legume production knowledge and skills, high weed burdens, disease and pest incidences, high costs of inputs (i.e. pesticides, fertilizer), lack of inputs and services, and soil erosion. These findings were also supported by the output of the LC tool applications. The top three constraints across the four sites were the shortage of improved seeds, lack of inputs and services, and knowledge and skills on the improved production techniques of legumes. These constraints also vary across sites, gender, and farmer resource types."},{"index":2,"size":52,"text":"These exercises gave us multidimensional observations, and also triggered extension officers to increase the depth of knowledge and skills required to bring different types of legumes into the farming system, and also most farmers had limited understanding of the multiple benefits of legumes. These issues would be improved through the following interventions:"},{"index":3,"size":53,"text":"• Establishment of on-farm demonstration trials: 2-3 annual grain legumes were selected per site and established for demonstration trials which mainly aimed to increase the awareness of farmers for legumes production managements, access for planting materials of the improve varieties; and to collect supplemental information for the further development of the LC tool."},{"index":4,"size":27,"text":"• Introduction of multipurpose legume trees: the top selected multipurpose leguminous trees will be provided for farmers to test them around their homestead for their multiple functions."},{"index":5,"size":27,"text":"• Organization of capacity development sessions, i.e. in-house trainings, discussions among farmers, field visits for better understandings on legume types, benefits and their wider functions and managements."},{"index":6,"size":125,"text":"The applications of the LC tool were implemented within a compressed period and we were in hurry not to miss the 2019 cropping season. The exercises were practiced in LC V2.0 earlier and then adapted into the latest version, V2.2. We observed some output differences due to additional agroecology filter information updates from the EcoCrop database which was previously blank. In addition, we observed that slight variation of agroecology filter inputs (i.e. soil pH, altitude) affect the output of the LC tool. So reliable data sources have to be sought for consistent use of the LC tool. When primary sources of data are not available, we like to recommend use of AfSIS database for the soil pH and NASA Power point data for climate data."},{"index":7,"size":100,"text":"It is wise to include more multipurpose legumes in the LC database. For instance, fenugreek (Trigonella foenum-graecum L.) is well known for its food and medicinal values besides the soil improvement in the south eastern Ethiopia. In addition, LC tool could be improved by not ignoring legumes which are widely adapted within the sites and grown by many farmers. Consequently, the outputs presented in this report shall be taken as early practices for further refinement of the LC tool for better decision support tool in legume selection for specific sites by addressing the functional needs and widely varying farming contexts. "}]}],"figures":[{"text":" CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia "},{"text":"FiguresFigure 1 . Figures "},{"text":"Figure 1 . Figure 1. Logical flow of Legume CHOICE tool components (Source: Duncan et al. 2019) "},{"text":"Figure 2 . Figure 2. Pairwise ranking scores for the preference of legume functions in a) women and b) men groups at Arjo Qonnan Bula kebele, Digga woreda "},{"text":"Figure 3 Figure 3. a) Demand for legume functions based on b) gender and c) resource endowment at Arjo Qonnan Bula kebele, Digga woreda "},{"text":"Figure 4 . Figure 4. Scores for the major constraints to legume production at Arjo Qonnan Bula kebele, Digga woreda "},{"text":"Figure 5 . Figure 5. Pairwise ranking scores for the preference of legume functions in a) women and b) men groups at Jirata kebele, Digga woreda "},{"text":"Figure 6 Figure 6. a) Demand for legume functions based on b) gender and c) resource endowment at Jirata kebele, Digga woreda "},{"text":"Figure 8 . Figure 8. Pairwise ranking scores for the preference of legume functions in a) women and b) men groups at Aman Laman kebele, Sinana woreda "},{"text":"Figure 9 Figure 9. a) Demand for legume functions based on b) gender and c) resource endowment at Aman Laman kebele, Sinana woreda "},{"text":"Figure 10 . Figure10. Scores for the major constraints to legume production at Aman Laman kebele, Sinana woreda "},{"text":"Figure 11 . Figure 11. Pairwise ranking scores for the preference of legume functions in a) women and b) men groups at Shallo kebele, Sinana woreda "},{"text":"Figure 12 Figure 12. a) Demand for legume functions based on b) gender and c) resource endowment at Shallo kebele, Sinana woreda "},{"text":"Figure 13 . Figure 13. Scores for the major constraints to legume production at Shallo kebele, Sinana woreda "},{"text":"  "},{"text":"  "},{"text":" This report covers the results of the FGDs and the outputs of the application of LegumeCHOICE tool in Ethiopia. It includes a description of the overall farming context, presents scored constraints and legume functions, and a short list of promising legume options for future interventions for smallholder farmers in the targeted areas of Ethiopia. In general, we adhere with the detailed methodologies set out in the LC tool user guide version 2.2(Duncan et al. 2019)  The Legume SELECT project in Ethiopia is led by The Legume SELECT project in Ethiopia is led by the International Livestock Research Institute (ILRI) and the national implementing partner, Oromia Agricultural Research the International Livestock Research Institute (ILRI) and the national implementing partner, Oromia Agricultural Research Institute (IQQO). Institute (IQQO).  "},{"text":"Table 1 . Descriptions of the study sites in Ethiopia  Digga  Sinana DiggaSinana  Arjo Qonnan Bula Jirata Aman Laman Shallo Arjo Qonnan BulaJirataAman LamanShallo Latitude 9.0120 9.0294 7.1305 7.0975 Latitude9.01209.02947.13057.0975 Longitude 36.4335 36.4838 40.2969 40.0971 Longitude36.433536.483840.296940.0971 Altitude (average masl) 1379 2238 2373 2373 Altitude (average masl)1379223823732373 Rainfall (annual in mm) 2080 2080 931 929 Rainfall (annual in mm)20802080931929 Temp (mean monthly in degrees 21.18 21.18 17.57 17.57 Temp (mean monthly in degrees21.1821.1817.5717.57 C)     C) Soil pH (average) 5.32 5.33 6.42 7.37 Soil pH (average)5.325.336.427.37 Market access Low High Low High Market accessLowHighLowHigh Rainfall pattern Unimodal  Bimodal  Rainfall patternUnimodalBimodal Main farming system Maize, teff, finger millet-based crop-livestock Wheat, barley, field pea, faba bean, based Main farming systemMaize, teff, finger millet-based crop-livestockWheat, barley, field pea, faba bean, based    crop-livestock mixed  crop-livestock mixed  "},{"text":"Table 2 . Number of participants by their gender and resource endowments for the application of LC tool at Digga and Sinana woredas Woreda Sites High resource Female Male Medium resource Female Male Low resource Female Male Total WoredaSitesHigh resource FemaleMaleMedium resource Female MaleLow resource Female MaleTotal Digga Arjo Qonnan Bula Jirata 2 2 4 4 3 2 3 4 3 3 3 3 18 18 DiggaArjo Qonnan Bula Jirata2 24 43 23 43 33 318 18 Sinana Aman Laman Shallo 1 6 5 1 6 5 4 2 2 4 18 18 SinanaAman Laman Shallo16 516 54 22 418 18  Total 5 19 6 18 12 12 72 Total519618121272  "},{"text":"Table 3 . List of legume species grown and their functions at Arjo Qonnan Bula kebele, Digga woreda Legume types produced Purpose of production Remark Legume types producedPurpose of productionRemark Annual grain legumes   Annual grain legumes Groundnut Income, livestock feed, soil fertility Widely grown as a rotational crop for GroundnutIncome, livestock feed, soil fertilityWidely grown as a rotational crop for  improvement maize improvementmaize Common bean (bush type) Food, soil fertility improvement, livestock Grown sole and intercropped with maize Common bean (bush type)Food, soil fertility improvement, livestockGrown sole and intercropped with maize  feed  feed Climbing bean (annual type) Food, income Grown in hedge rows around home stead Climbing bean (annual type)Food, incomeGrown in hedge rows around home stead   (fences as staking), intercropped with maize (fences as staking), intercropped with maize Soybean Food, income, soil fertility improvement, Rarely grown but previously widely grown SoybeanFood, income, soil fertility improvement,Rarely grown but previously widely grown  livestock feed  livestock feed Cowpea Livestock feed, soil fertility improvement Rarely produced, and recently introduced CowpeaLivestock feed, soil fertility improvementRarely produced, and recently introduced   by agricultural extensions and researchers by agricultural extensions and researchers Fodder/tree legumes   Fodder/tree legumes Sesbania Fencing, fuel, feed, soil fertility improvement Mostly grown by coffee farmers SesbaniaFencing, fuel, feed, soil fertility improvementMostly grown by coffee farmers  and coffee shade  and coffee shade Leucaena Fencing, livestock feed, firewood, soil fertility Recently introduced and getting attention LeucaenaFencing, livestock feed, firewood, soil fertilityRecently introduced and getting attention  improvement,  improvement, Acacia species Livestock feed, firewood and soil fertility Naturally grown in and around farmlands Acacia speciesLivestock feed, firewood and soil fertilityNaturally grown in and around farmlands  improvement  improvement Annual fodder legumes   Annual fodder legumes Lablab Livestock feed, soil fertility improvement Recently introduced by agricultural LablabLivestock feed, soil fertility improvementRecently introduced by agricultural   extensions and researchers extensions and researchers Desmodium Livestock feed, soil fertility improvement Rarely produced, and recently introduced DesmodiumLivestock feed, soil fertility improvementRarely produced, and recently introduced   by agricultural extensions and researchers by agricultural extensions and researchers  "},{"text":"Table 4 . Legume species which scored high following application of the LC tool at Arjo Qonnan Bula kebele,  "},{"text":"Digga woreda Food Feed Income Erosion control Fuel Soil fertility Land Labour Seed supply Inputs and services Knowledge and skills Water Markets   "},{"text":"Table 5 . List of legume species grown and their functions at Jirata kebele, Digga woreda Legume types produced Benefits Remarks Legume types producedBenefitsRemarks Annual grain legumes   Annual grain legumes Faba bean Food, soil fertility improvement and Widely grown in rotation with maize and Faba beanFood, soil fertility improvement andWidely grown in rotation with maize and  income Finger millet incomeFinger millet Field pea Food, soil fertility improvement, livestock Widely grown as a rotational crop Field peaFood, soil fertility improvement, livestockWidely grown as a rotational crop  feed and income  feed and income Lentil Food, soil fertility improvement, livestock Grown on small homestead farm pieces LentilFood, soil fertility improvement, livestockGrown on small homestead farm pieces  feed, and income  feed, and income Chickpea Food, soil fertility improvement, livestock Grown as double cropping after early ChickpeaFood, soil fertility improvement, livestockGrown as double cropping after early  feed and income maturing Barley feed and incomematuring Barley Common bean (bush type) Food, soil fertility improvement, livestock Grown sole and intercropped with maize Common bean (bush type)Food, soil fertility improvement, livestockGrown sole and intercropped with maize  feed.  feed. Climbing bean (annual type) Food, income Grown in hedge rows around home stead Climbing bean (annual type)Food, incomeGrown in hedge rows around home stead   (fences as staking), intercropped with maize (fences as staking), intercropped with maize Cowpea Food, livestock feed, soil fertility Rarely produced CowpeaFood, livestock feed, soil fertilityRarely produced  improvement, livestock feed  improvement, livestock feed Sweet lupine Food, livestock feed, soil fertility improvement Rarely produced and getting high demand Sweet lupineFood, livestock feed, soil fertility improvement Rarely produced and getting high demand Fodder/tree legumes   Fodder/tree legumes Sesbania Fencing, fuel, feed, soil fertility Mostly grown by coffee farmers SesbaniaFencing, fuel, feed, soil fertilityMostly grown by coffee farmers  improvement and coffee shade  improvement and coffee shade Leucaena Fencing, livestock feed, firewood, soil Recently introduced and getting attention LeucaenaFencing, livestock feed, firewood, soilRecently introduced and getting attention  fertility improvement  fertility improvement Acacia species Livestock feed, firewood and soil fertility Naturally grown in and around farmlands Acacia speciesLivestock feed, firewood and soil fertilityNaturally grown in and around farmlands  improvement  improvement Annual fodder legumes   Annual fodder legumes Lablab Livestock feed, soil fertility improvement Recently introduced by agricultural LablabLivestock feed, soil fertility improvementRecently introduced by agricultural   extensions and researchers extensions and researchers  "},{"text":"Table 6 . Legume species which scored high following application of the LC tool at Jirata kebele, Digga woreda Food Feed Income Erosion control Fuel Soil fertility Land Labour Seed supply Inputs and services Knowledge and skills Water Markets Functional rank Context rank Agro-ecological rank FoodFeedIncomeErosion controlFuelSoil fertilityLandLabourSeed supplyInputs and servicesKnowledge and skillsWaterMarketsFunctional rankContext rankAgro-ecological rank  "},{"text":"Table 7 . List of legume species grown and their functions at Aman Laman kebele, Sinana woreda Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia Legume types produced Benefits Remark Legume types produced BenefitsRemark Annual grain legumes   Annual grain legumes Faba bean Food, rotational crop for cereals, livestock feed, soil Widely grown in rotation with wheat and barley Faba beanFood, rotational crop for cereals, livestock feed, soilWidely grown in rotation with wheat and barley  fertility improvement and Income  fertility improvement and Income Field pea Food, rotational crop for cereals, livestock feed, soil Widely grown rotation with wheat and barley Field peaFood, rotational crop for cereals, livestock feed, soilWidely grown rotation with wheat and barley  fertility improvement and Income  fertility improvement and Income Chickpea Income, food, soil fertility improvement, livestock feed Grown on small farm pieces ChickpeaIncome, food, soil fertility improvement, livestock feed Grown on small farm pieces Lentil Income, food, soil fertility improvement, livestock feed Widely grown in rotation with wheat and barley LentilIncome, food, soil fertility improvement, livestock feed Widely grown in rotation with wheat and barley Grass pea Food, income, soil fertility improvement, livestock feed Grown on small farm pieces Grass peaFood, income, soil fertility improvement, livestock feed Grown on small farm pieces Common bean (bush Food, soil fertility improvement, livestock feed, income Grown sole and intercropped with maize in Common bean (bushFood, soil fertility improvement, livestock feed, incomeGrown sole and intercropped with maize in type) generation lowlands of the area type)generationlowlands of the area Fenugreek Income, food, soil fertility improvement, livestock feed Widely grown on homestead farms FenugreekIncome, food, soil fertility improvement, livestock feed Widely grown on homestead farms Fodder/tree legumes   Fodder/tree legumes Abyssinian rose (Rosa Grown for fencing Widely planted around homestead for fencing Abyssinian rose (RosaGrown for fencingWidely planted around homestead for fencing abyssinica)   abyssinica) Calpurnia (Calpurnia House construction, fencing, to make local farm Grown around homestead and farm borders Calpurnia (CalpurniaHouse construction, fencing, to make local farmGrown around homestead and farm borders aurea) implements, livestock shading, erosion control,  aurea)implements, livestock shading, erosion control,  firewood  firewood Wolensu (Erythrina Fencing, shade, house construction, local beehive Grown around farm boundaries Wolensu (ErythrinaFencing, shade, house construction, local beehiveGrown around farm boundaries brucei) construction, to make some home implements,  brucei)construction, to make some home implements,  medicinal value to locally treat livestock  medicinal value to locally treat livestock Flat-top acacia (Acacia Fuel, Timber, local beehive making, to make home and Naturally grown in and around farmlands Flat-top acacia (AcaciaFuel, Timber, local beehive making, to make home andNaturally grown in and around farmlands abyssinica) farm implements, soil fertility improvement and animal  abyssinica)farm implements, soil fertility improvement and animal  feed  feed  "},{"text":"Table 8 . Legume species which scored high following application of the LC tool at Aman Laman kebele, Sinana woreda  "},{"text":" •• Note: P=perennial; S=seasonal/ annual; Herb=herbaceous; C=coppicing; NC=non-coppicing. The colors indicate that suitability of a range of different legume options score well on each criteria (green is good, red is bad). Blue color indicates the top ranked legumes.Using the Legume CHOICE tool to support legume use on smallholder farms at Digga and Sinana woredas in western and southeastern Ethiopia Site 4: Shallo kebele Site 4: Shallo kebele  "},{"text":"Table 9 . List of legume species grown and their functions at Shallo kebele, Sinana woreda Legume types produced Benefits Remarks Legume types produced BenefitsRemarks Annual grain legumes   Annual grain legumes Faba bean Food, soil fertility improvement and income Grown in rotation with maize and Faba beanFood, soil fertility improvement and incomeGrown in rotation with maize and   Finger millet Finger millet Field pea Food, income, livestock feed and soil fertility improvement Grown as relay crop Field peaFood, income, livestock feed and soil fertility improvementGrown as relay crop Lentil Food, soil fertility improvement, livestock feed, and Income Grown on small homestead farm pieces LentilFood, soil fertility improvement, livestock feed, and Income Grown on small homestead farm pieces Chickpea Food, soil fertility improvement, livestock feed, income Grown on small homestead farm pieces ChickpeaFood, soil fertility improvement, livestock feed, incomeGrown on small homestead farm pieces Common bean Food, soil fertility improvement, livestock feed. Grown sole Common beanFood, soil fertility improvement, livestock feed.Grown sole Fenugreek Food, income, medicinal value, soil fertility improvement  FenugreekFood, income, medicinal value, soil fertility improvement Fodder/tree legumes   Fodder/tree legumes Sesbania Fencing, fuel, feed, soil fertility improvement  SesbaniaFencing, fuel, feed, soil fertility improvement Albizia gummifera Fencing, firewood, medicinal purposes, Livestock feed Used as bees forage and shade Albizia gummiferaFencing, firewood, medicinal purposes, Livestock feedUsed as bees forage and shade Acacia species Livestock feed, firewood, and soil fertility improvement Naturally grown in and around Acacia speciesLivestock feed, firewood, and soil fertility improvementNaturally grown in and around   farmlands farmlands Annual fodder legumes   Annual fodder legumes Alfalfa Livestock feed Recently introduced by agricultural AlfalfaLivestock feedRecently introduced by agricultural   extension and researchers extension and researchers Vetch Livestock feed, soil fertility improvement Rarely Produced VetchLivestock feed, soil fertility improvementRarely Produced  "},{"text":"Table 10 . Legume species which scored high following application of the LC tool at Shallo kebele, Sinana woreda Food Feed Income Erosion control Fuel Soil fertility Land Labour Seed supply Inputs and services Knowledge and skills Water Markets FoodFeedIncomeErosion controlFuelSoil fertilityLandLabourSeed supplyInputs and servicesKnowledge and skillsWaterMarkets  "},{"text":" The International Livestock Research Institute (ILRI) works to improve food security and reduce poverty in dev eloping countries through research for better and more sustainable use of livestock. ILRI is a member of the CGIAR Consor tium, a global research partnership of 15 centres working with many partners for a food-secure future. ILRI has t wo main campuses in East Africa and other hubs in East, West and Southern Africa and South, Southeast and East Asia. ilri.org CGIAR is a global agricultural research partnership for a food-secure future. Its science is carried out by 15 research centres that are members of the CGIAR Consortium in collaboration with hundreds of partner organizations. cgiar.org  "}],"sieverID":"7880ca87-8ade-442b-aba0-9107f9e2dc41","abstract":""}

data/part_1/06dd1bfb6657934f5dd72146e8d02adb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06dd1bfb6657934f5dd72146e8d02adb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0cb11771-b954-45e4-b2f0-bb7c6c586878/retrieve"},"pageCount":11,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":327,"text":"antigen. The antibodies bind themselves to the antigens and either neutralize the effects of the diseaseproducing microorganisms or help to destroy them. Trypanosomes, however, avoid total destruction by the host's immune response by repeatedly changing the protein antigens displayed on their surface membrane. These antigens, called 'variable surface glycoproteins', or VSGs, form a thick coat that covers the cell membrane. ____________________ ILRAD staff members whose work and reports formed the basis of this issue are Dennis Grab, John LonsdaleEccles and Paul Webster. When an animal becomes infected with trypanosomes, it produces antibodies against the VSGs displayed by the first wave of invading trypanosomes and these antibodies kill most of the parasites. However, before all the parasites can be eliminated, a few trypanosomes display a new coat of VSGs to which the available antibody cannot bind. These individuals give rise to a new population displaying the new VSG. The host produces new antibodies against the second wave of trypanosomes, but then a few individuals again change their VSG coat, and so the process continues, with the parasite confounding the host immune system by always keeping a step ahead of the immune responses. This remarkable ability of the parasite to change the antigenic composition of its surface coat-called antigenic variation-is the primary mechanism that prevents most domestic animals from developing effective immunity against trypanosomiasis. Researchers at ILRAD and elsewhere believe that the number of kinds of variable antigens displayed by trypanosomes may be too great to use the coat proteins as the basic material for a conventional vaccine, which works by priming an animal's responses against one or a small number of antigens. ILRAD scientists are thus studying other cell parts, as well as certain physical and chemical processes essential to the cell, in their search for an element or activity of the parasite that can be attacked with drugs without adversely affecting the host or that can be made vulnerable to attack by the host's own immune system."},{"index":2,"size":134,"text":"Because trypanosomes are entirely dependent on their hosts for the nutrients they must ingest, the process by which the parasites take up nutrients, called endocytosis, is one promising area of study. By devising a way to interfere with the endocytotic process, scientists may be able to starve the parasite to death. The metabolic pathways of the VSG make up another promising area. VSGs and parts of VSGs have been found along with nutrients in the endocytotic pathway. This discovery has led scientists to speculate that the endocytosed VSG molecules may be partially broken down in the pathway for eventual reassembling. If the parasite does recycle VSG molecules rather than, or in addition to, continually creating and destroying them, the metabolic pathways of this recycling process may offer further targets for chemotherapeutic or immunological intervention."}]},{"head":"Endocytosis","index":2,"paragraphs":[{"index":1,"size":268,"text":"The Endocytotic process Trypanosomes, like all organisms, need nutrients to live and grow. Nutrients are a source of energy and materials for the synthesis of essential cellular substances such as proteins, lipids, carbohydrates and nucleic acids. Cells that belong to multicelled organisms as well as single cells that are themselves organisms, such as the trypanosome, obtain nutrients by engulfing molecules and particles in a process known as endocytosis. In the trypanosome, nutrient molecules are drawn into the parasite by way of the flagellar pocket, a flaskshaped reservoir at the posterior end of the trypanosome, from which the flagellum emerges (Figure 1).* The flagellar pocket acts as the 'mouth' of the parasite. Where a nutrient molecule touches or is close to the membrane of the pocket, that part of the membrane invaginatesthat is, it turns or caves in on itself-forming a pit in the membrane that envelops the nutrient. As the pit deepens into the cell, the membrane closes over it, forming a spherical vesicle. This newly formed intracellular vesicle then breaks loose from the pocket membrane and travels further into the cell, where it fuses with a specialized structure called an endosome, into which the ingested material is deposited. Finally, the ingested material passes through the endosome into another cell structure, called the lysosome, where intracellular digestion is completed. Endosomes and lysosomes contain hydrolytic enzymes that break down the endocytosed molecules. (Protein sorting and recycling also occur in these organelles.) The breakdown products, such as amino acids, then pass through the lysosomal membranes into the cell's cytoplasm, where they can be used in the manufacture of new proteins."}]},{"head":"____________________________ FIGURE 2. A section of a trypanosome that has been incubated in medium containing colloidal gold particles. The flagellum can be seen entering the flagellar pocket, which contains many small particles of gold (arrows). Many intracellular vesicles close to the pocket also contain gold particles.","index":3,"paragraphs":[{"index":1,"size":116,"text":"Most animal cells have further enhanced the efficiency of this way of ingesting biologically important molecules. In addition to obtaining nutrients by enclosing molecules in this non selective manner, these animal cells can take up specific molecules from the extracellular fluid. In this selective uptake, proteins called receptors, which are located on the surface of the cell, bind themselves to specific nutrient proteins outside the cell. The receptors and nutrient molecules then move, in a way not yet understood, into vesicles that, during endocytosis, appear to form continuously by the invagination process described above. This selective uptake, called receptormediated endocytosis, enables the cell to ingest molecules at a greater rate than is possible in nonselective endocytosis."},{"index":2,"size":66,"text":"Recent studies suggest that trypanosomes may, like animal cells, possess surface receptors. But if they do, the receptors on the trypanosome, which is an organism that thrives in many animal species, would appear to be much less selective in what they take up than the receptors on animal cells. If trypanosomes do possess receptors, their relatively indiscriminate binding may offer scientists another target to attack immunologically."}]},{"head":"Importance of the flagellar pocket","index":4,"paragraphs":[{"index":1,"size":101,"text":"To study the endocytotic processes in trypanosomes, ILRAD scientists have incubated Trypanosoma brucei and T. congolense parasite species in culture medium containing colloidal gold particles coupled to nutrient molecules. The parasites are then chemically fixed and examined by electron microscopy. By passing electrons rather than light through a specimen, the electron microscope enables researchers to visualize cell parts that are too small to be seen with the light microscope. The gold particles show up in the image produced by an electron microscope, thus enabling scientists to see where the nutrient molecules and their linked particles, called markers, go inside the parasite."},{"index":2,"size":91,"text":"Using this procedure and stopping the endocytotic process, by fixing the parasites, at various times to note the location of the markers, scientists have observed that the markers first appear in the flagellar pocket and in vesicles that bud off from the membrane of the pocket into the cell and, furthermore, that the markers never appear in the anterior end of the parasite (Figures 2 and 9). Thus it seems that the various particulate and soluble substances taken up by trypanosomes enter the parasite only by way of the flagellar pocket."},{"index":3,"size":30,"text":"A more detailed study of the flagellar pocket membrane may reveal unique proteins that cause the membrane to invaginate and these would be good candidates for the bases of vaccines. "}]},{"head":"Enzymes in the endocytotic pathway","index":5,"paragraphs":[{"index":1,"size":193,"text":"Enzymes are protein molecules that act as catalysts in biological chemical reactions. Some break down compounds and are thus the means by which the parasite mobilizes molecules for its own rise. Evidence suggests that different types of degrading enzymes are located in different parts of the endocytotic pathway. If this is so, it is likely that each step in the process of protein degradation occurs predominately in a different part of the pathway. The surface of the cell, for example, contains enzymes able to degrade aDglucose and 3' nucleotide, the flagellar pocket contains enzymes able to degrade organicphosphate and orthophosphate, and lysosomes within the parasite contain enzymes able to digest a range of complex molecules, such as sugars, lipids and proteins. Some trypanocidal drugs such as arsenicals, which apparently kill the parasite by inhibiting enzymes in vitro, kill the host along with the parasite when administered in vivo. When researchers learn more about the endocytotic pathway, they may learn how these drugs inhibit enzyme activity. Once this is known, it may be possible to devise methods to inhibit the parasite enzymes in vivo, and thus block the parasite's metabolism, without harming the host."},{"index":2,"size":148,"text":"Proteases are enzymes that break down proteins. Those in African trypanosomes resemble in some respects similar enzymes in mammalian cells, which suggests that they perform similar functions. However, properties unique to the trypanosome proteases are now being discovered, and when these are better understood it may be possible to use these unique properties to attack the parasite without attacking the host animal. For example, although the lysosomal proteases of mammalian cells appear always to be in a fully active form within the lysosome, the trypanosomal proteases may not be. ILRAD scientists have identified a compound in blood that in some circumstances appears to increase the activity of the trypanosomal proteases. Should the parasites need this compound to regulate their lysosomal protsolytic activity, it may be possible to interfere with the uptake of the compound by the parasite, and in this way harm the trypanosome without harming the host."}]},{"head":"Metabolic pathways of the VSG","index":6,"paragraphs":[{"index":1,"size":113,"text":"The trypanosome cannot survive in its mammalian host without its coat of VSG. The vital role of the VSG has provoked intensive investigation into the synthesis and maintenance of the VSG, as well as into a sidechain structure that attaches the VSG molecule to the surface membrane of the cell and an enzyme that cleaves the side chain from the molecule, thus severing the molecule from the cell membrane. Interference with VSG synthesis or the attachment or removal of VSG from the cell membrane could disrupt the stability of the surface coat or impair the cell's ability to change the VSG of the coat, and thus render the parasite susceptible to immunological attack."}]},{"head":"Synthesis and Maintenance of VSG","index":7,"paragraphs":[{"index":1,"size":176,"text":"When trypanosomes are fixed and cut into thin slices and the slices incubated with antibodies that recognize VSG, the antibodies will bind specifically to VSG molecules wherever these are located in the cell. The antibodies can be visualized by labelling them with colloidal gold and then examining the parasites with an electron microscope. Using this procedure, scientists have discovered VSG within the trypanosome. The colloidal gold particles, representing the VSG, were found associated with the same organelles that have been shown in other experiments to take up endocytosed colloidal gold coupled to nutrient proteins (Figures 3 and 4). Experiments at ILRAD have subsequently shown that VSG molecules from the surface of the parasite are taken through the same pathway as nutrient molecules coupled to colloidal gold particles (Figure 5). These findings have led scientists to suspect that the VSG molecules are being endocytosed for the purpose of eventual breakdown or recycling. If VSG is indeed reprocessed and perhaps recycled in the cell, the recycling process is another area that can be explored for possible immunological attack."}]},{"head":"The VSG Anchor","index":8,"paragraphs":[{"index":1,"size":102,"text":"Although VSGs vary biochemically, and thus antigenically, one part of the VSG molecule stays relatively constant. This part, called a 'crossreacting determinant' (CRD), is a complex glycolipid sidechain structure of the VSG molecule of different species of African trypanosomes. This lipid chain, identified as glycosylphosphatidylinositol, or GPI, is believed to anchor the VSG to the plasma membrane of the trypanosome. The CRD, although similar in all VSGs, does not induce natural immunity and cannot serve as the basis for a vaccine because the VSGs are attached to the membrane in such a way that does not expose the CRD to host antibodies."},{"index":2,"size":158,"text":"ILRAD scientists have used antibodies that specifically recognize the CRD in conjunction with antibodies that recognize the remainder of the VSG in doublelabelling experiments. The VSG and CRD antibodies were found together on the surface of the trypanosome, in the flagellar pocket and in many endocytotic organelles (Figures 5 and 6). VSG antibodies labelled the whole of the Golgi apparatus, an organelle in the cytoplasm that exports proteins to different parts of the cell. However, CRD antibodies labelled only half of the Golgi, suggesting that the part of the molecule recognized by the antibody is attached to the protein in the Golgi apparatus. Many tubularlike structures in the cells that did not appear to be involved with endocytosis were also labelled with both kinds of antibodies; other such structures were labelled only with CRD antibody or had VSG antibody labelling to one side of them. This segregation is further indication that VSG may be reprocessed in the cell.  "}]},{"head":"Removal of VSG","index":9,"paragraphs":[{"index":1,"size":43,"text":"In 1983 it was discovered that the trypanosome possesses an enzyme, subsequently called GPIspecificphospholipaseC, that chops through the GPI anchor, thereby releasing the VSG molecule from the cell membrane. It was presumed that this enzyme released the VSG molecule prior to antigenic variation."},{"index":2,"size":156,"text":"It is now known that, contrary to what was formerly believed, the VSGspecific GPIspecific phospholipaseC is located within the cell, where it is associated with intracellular vesicles, rather than on the surface of the cell. Having observed VSG molecules being endocytosed, scientists speculate that the intracellular GPIspecificphospholipaseC enzyme plays a role in processing endocytosed VSG and is thus another potential target for chemotherapeutic and immunological attack against the parasite. FIGURE 6. In this micrograph a section of a trypanosome has been labelled with antibodies to two different parts of the VSG molecule. Each antibody has been coupled with a particular size of colloidal gold particles. Antibodies to the VSG, represented by the large gold particles, are located mostly on the cell surface and in the flagellar pocket Antibodies to the crossreacting determinant, or CRD, represented by smaller gold particles, are present on the cell surface, but are also in tubular structures not labelled with VSG antibodies."},{"index":3,"size":84,"text":"In experiments using subcellular fractionation methods, the highest concentration of the GPIspecificphospholipaseC enzyme was found in a fraction that scientists suspected contained flagellar pocket membranes as well as other organelles. When the researchers further purified this fraction by spinning it through sucrose gradients in a centrifuge, they discovered that enzyme activity was located in at least two membrane fractions. Experiments are now being conducted to clarify whether one of the fractions containing GPIspecificphospholipaseC originates from the cytoplasm and the other from the endocytotic pathway."}]},{"head":"Techniques for Separating and Identifying Organelles in the Trypanosome","index":10,"paragraphs":[{"index":1,"size":61,"text":"Magnifying a cell in an electron microscope many thousands of times enables scientists to see different parts of the cell. But to identify sites of important endocytotic and metabolic functions, researchers must find out not only what parts of the cell look like but also what they do. This is accomplished by taking the cell apart and analysing the parts chemically."}]},{"head":"Breaking the parasites open","index":11,"paragraphs":[{"index":1,"size":103,"text":"The French pressure cell The first step in analysing cell components is to open the cell and separate the different components, called organelles, from each other. The trick is to break the parasite open in a way that keeps the intracellular organelles intact or, if the organelles are broken up, that keeps the organelle particles big enough to identify. This is best accomplished by using a method called 'subcellular fractionation'. The parasites are put in a sucrose (sugar) solution and the solution is passed under pressure through a small orifice in a device called a French Pressure Cell, which breaks the cells apart."}]},{"head":"Purifying the fractions","index":12,"paragraphs":[]},{"head":"Differential centrifugation","index":13,"paragraphs":[{"index":1,"size":186,"text":"The solution containing the broken cells is then poured into thickwalled tubes and the tubes placed in an instrument called a centrifuge, which spins the sample around at great speeds to separate by centrifugal force the lighter portions of the solution from the heavier. This process is called differential centrifugation (Figure 7). The heavier an organelle is, the faster it settles out at a given speed of rotation. Centrifuging the sample at relatively low speeds pulls heavy organelles, such as the nuclei, which are normally kept suspended in the sugar solution by the random motion of the molecules around them, down to the bottom of the tube, where they form a pellet, while lighter organelles remain suspended in the supernatant. The supernatant can then be poured off into another centrifuge tube, leaving the pellet of nuclei behind, and then centrifuged again at a higher speed to pull down a lighter organelle, such as the lysosome, to the bottom of the tube. The supernatant can be centrifuged again and again in this way, at progressively higher speeds, to pull down other organelles and complete the cell fractionation."}]},{"head":"Density Gradient Centrifugation","index":14,"paragraphs":[{"index":1,"size":65,"text":"The cell fractions produced by this method of 'differential centrifugation' are not pure, that is, they contain cell components whose size and mass are roughly similar rather than identical. To purify these fractions so that each fraction contains for the most part only one kind of organelle, particles of different size and mass in each fraction must be separated from each other using other methods."},{"index":2,"size":205,"text":"One such purification method, called 'density gradient centrifugation', works on the Archimedes' principle: the buoyancy of an object in liquid depends exactly on the mass of liquid it displaces. To purify a pellet of lysosomes, for example, the pellet is resuspended in liquid and the suspension put on top of a sucrose solution in a centrifuge tube. The sucrose solution is set up in a special way so that the density of the solution increases from the top of the tube to the bottom, the solution thus forming a 'density gradient'. When the sample is spun, the centrifugal force pulls the lysosomes and other organelles at the top of the tube down towards the bottom. When the lysosomes reach a part of the tube where the density of the solution is the same as their own density, they stop. Different kinds of organelles have different densities and so each will migrate within the gradient to a point where the density of the solution surrounding the organelle is exactly equivalent to the density of the organelle. Each kind of organelle will thus be pulled to a different place in the gradient, forming a number of separate layers or bands, which can be collected separately for analysis."}]},{"head":"Characterizing the fractions","index":15,"paragraphs":[{"index":1,"size":398,"text":"In theory, most organelles can be separated from each other in this way, but in practice the separation is usually messier than this. Often, for example, organelles are broken up along with the cells in the French Pressure Cell and particles of an organelle have a different density from that of the whole organelle. It must then be ascertained from which organelle the particles isolated in a particular band are derived. To find out, scientists combine the powers of the electron microscope with techniques of biochemistry. Some particles can be identified with an electron microscope by their structure alone. Organelles whose particles are readily identifiable by their structure include the flagellum, the Golgi apparatus, the lysosome, the glycosome (which produces energy in the trypanosome) and the rough endoplasmic reticulum (which synthesizes proteins) (Figure 8).  Such identifications are strengthened by biochemical analyses of the organelle particles. It is known, for example, that in trypanosomes the enzyme glycerol3phosphate dehydrogenase is found only in glycosomes. Throughout the fractionation process, this enzyme thus serves as an identification mark for glycosome particles. Golgi fractions can be recognized as such not only by the distinctive shape of Golgi membranes (they look like piles of flattened sacs), but also because the Golgi fraction is more active than the others for an enzyme known to be associated with it: galactosyltransferase. Scientists can make further discriminations by testing whether a particle can carry out a normal function of a given organelle. The ability of a membrane fraction to synthesize proteins in a test tube, for example, suggests that the particle belongs to the rough endoplasmic reticulum. Scientists cannot rely totally on fractionation techniques to identify cell parts. Some organelles, such as the mitochondrion of the trypanosome, are broken up so severely after being passed through the small orifice of the French Pressure Cell that no structurally identifiable parts remain. In addition, after passing through this instrument, some mitochondrial enzymes are separated from the mitochondrion particles and released in the soluble supernatant, thus giving no clue as to the identity of the particles. But although scientists must be cautious when interpreting fractionation data, when used in conjunction with other techniques, such as structural analyses, the fractionation process is an important tool in the study of the biology of the African trypanosome, enabling researchers to discover which organelles are responsible for which chemical reactions and processes in the parasite. "}]},{"head":"_______________________________________________________________________________________","index":16,"paragraphs":[]}],"figures":[{"text":"FIGURE 1 . FIGURE 1. Schematic diagram of a trypanosome of the Trypanosoma brucei group in its intermediate bloodstream form. The arrow shows the direction of travel of the parasite. "},{"text":"FIGURE 3 . FIGURE 3. Intracellular organelles into which the colloidal gold particles enter are seen in this micrograph. The large organelle, lower left, is the flagellar pocket; the two organelles in the middle of the micrograph are endosomes. "},{"text":"FIGURE 4 . FIGURE 4. If sections of fixed trypanosomes are incubated with antibodies that bind to the coat of variable surface glycoprotein (VSG), the antibodies will bind specifically to VSG molecules wherever these are located in the cell. The antibodies can be visualized by electron microscopy by labelling them with particles of colloidal gold. The above micrograph shows that the colloidal gold particles (representing the VSG molecules) are on the cell surface as expected. VSG molecules are also in the flagellar pocket and inside the cell (arrows). "},{"text":"FIGURE 5 . FIGURE 5. Three sizes of colloidal gold appear on this micrograph of a trypanosome. The small particles are coupled to transferrin, a serum protein that brings iron into cells, and have been endocytosed by the cell. The mediumsized particles indicate the location of VSG antibodies and the large particles the location of the crossreacting determinant (CRD) antibodies. The VSG antibodies, and to a lesser extent the CRD antibodies, label the cell surface. Both antibodies are present in the flagellar pocket and in a vesicle containing endocytosed gold particles: "},{"text":"Figure 7 . Figure 7. Diagram of the differential centrifugation process. To separate the different parts of the cell, trypanosomes are put in a sucrose solution and the solution is passed through a small orifice in a French Pressure Cell, which breaks the cells apart. The solution is then centrifuged at progressively higher speeds to obtain fractions enriched in different cell parts, such as the nuclei, large granule, small granule and microsomes. "},{"text":"Figure 8 . Figure 8. After being centrifuged, cell fractions are examined with an electron microscope to identify from what organelle the particles of a given fraction are derived. Particles of some organelles, such as those from the flagellar pocket (left) and the Golgi apparatus (right), are relatively easy to identify in this way. "},{"text":"FIGURE 9 . FIGURE 9. Endocytosed colloidal gold particles can be visualized by light microscopy by reacting with a solution of a silver salt. Metallic silver, deposited around the gold particles, can be seen as a black deposit in the light microscope. In this micrograph, the silver deposits can be seen only in the posterior end of the cell. "},{"text":"  "},{"text":"  "}],"sieverID":"7f46eb87-549a-4e7a-8776-8573d7ebf154","abstract":""}

data/part_1/072ca3777218ef5091628a9370985812.json

@@ -0,0 +1 @@
+{"metadata":{"id":"072ca3777218ef5091628a9370985812","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d152b4fb-c0f0-4f8e-873c-5c3cfd0a3f05/retrieve"},"pageCount":1,"title":"Opportunities in adopting best-bet management practices ▪ Engaging pastoralists as community groups reduces resistance to change and enables faster acceptance of best-bet practices for livestock improvement ▪ Deliberate involvement of women within communities enables greater insights into dynamics on decision making in managing categorized livestock assets ▪ The ability to make informed decisions on animal sales and use of income generated is critical in determining the choice of breeds and the traits maintained in the population","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"✓ Gender dynamics in pastoral communities determine ▪ Livestock ownership and herd dynamics ▪ Management practices adopted ▪ Traits selected in individual animals ▪ Marketing of animals and their products Diverse socio-economic and cultural contexts in different pastoral communities disproportionally affect women and result in skewed development interventions Gender roles and labour investments greatly impact the adoption of livestock breeds and the requisite practices in their management Among livestock species in pastoral communities, sheep and goats are easier for women to acquire, own and manage Next steps Training of National partners and extension service providers on best-bet practices through community innovation groups for long term sustainability of interventions ✓ Strengthening marketing networks for livestock products ✓ Facilitating learning across pastoral communities through \"farmer to farmer\" learning expositions Partners Impact of interventions ▪ Men appreciated the role of women in the management of sheep and goats ▪ Men allowed women to participate and contribute actively in training on best practices for sheep and goat management ▪ Men allowed women to make decisions on selective mating and culling in their sheep and goat populations The International Livestock Research Institute thanks all donors and organizations which globally support its work through their contributions to the CGIAR Trust Fund. cgiar.org/funders This document is licensed for use under the Creative Commons Attribution 41 , J.M.K. Ojango 1 , E. Oyieng 1 , J. Gachora 2 and A.W.T. Muigai 3 1 International Livestock Research Institute, 2 Ministry of Agriculture, Livestock, Fisheries and Irrigation, 3 Jomo Kenyatta University of Agriculture and Technology Enquire: Explore production environment, Identify community needs, understand cultural practices, Engage: Identify, engage and involve local government, development partners, men and women in communities Engage: Jointly determine context specific interventions, identify innovative implementers, adapt and use local resources Develop capacity: Train local extension and service providers for long term sustainability, Train targeted community groups Empower: Support implementation of transformational practices, Support networks for services and product marketingFeedback and communication of information ▪ Developing and sharing new knowledge and feedback from observations of on-going practices with both men and women in communities helps to catalyse change ▪ Developing mobile phone-based tools in addition to paper-based training manuals enabled access to content on best-bet practices for other communities through partners and service providers in the target areas. "}],"sieverID":"55ec6dd6-490b-44d8-817b-786ee8b39dc1","abstract":""}

data/part_1/0791c7ca003654761ac01fc92d3d473e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0791c7ca003654761ac01fc92d3d473e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3b24f7ac-0c90-4328-be39-661ffe3eb650/retrieve"},"pageCount":21,"title":"","keywords":[],"chapters":[{"head":"Executive summary","index":1,"paragraphs":[{"index":1,"size":143,"text":"To implement its 2030 research and innovation strategy, CGIAR has developed 32 research initiatives designed to achieve a world with sustainable and resilient food, land and water systems. The CGIAR research initiative Protecting human health through a One Health approach has been approved for implementation from 2022 to 2024. The aim of the initiative is to protect human health by improving the prevention, detection and control of zoonoses, foodborne diseases and antimicrobial resistance in low-and middle-income countries. The initiative Resilient cities through sustainable urban and peri-urban agrifood systems harnesses the potential of urban capacities for innovation to generate evidence-based solutions to address the food safety constraints of food systems and improve the safety of foods sold in urban markets while strengthening the income opportunities that urban value chains offer, especially to the most vulnerable populations. Ethiopia is a focus country for both initiatives."},{"index":2,"size":61,"text":"On 17 May 2022, the initiative teams held a stakeholder workshop for Ethiopian partners to introduce the initiatives, reflect on food safety priorities and ongoing food safety projects in the country and identify priority value chains and food safety interventions. The workshop was held at the Addis Ababa campus of the International Livestock Research Institute (ILRI) with some participants joining online."},{"index":3,"size":98,"text":"Participants included representatives from the ministries of agriculture, health and environment, food safety authorities and non-governmental organizations involved in animal-source food value chains. The goal of the workshop was to understand the challenges of food safety in animal-source food value chains in Ethiopia and identify the most suitable interventions to tackle these challenges. The workshop was opened by Namukolo Covic, ILRI Director General's representative in Ethiopia, who addressed important issues related to food security and safety, and Sisay Getachew, Director of Veterinary Public Health, Ethiopia, who addressed important issues related to One Health and activities of the directorate."},{"index":4,"size":74,"text":"Presentations on the two CGIAR initiatives and related ongoing projects set the context of food safety research in Ethiopia. The water work package of the One Health Initiative examined the link between water and food safety and the economics, governance and behaviour work package focused on behavioural food business as it relates to food safety. The experience of food safety interventions in Cambodia, Vietnam and Kenya were presented and discussed in the local context."},{"index":5,"size":30,"text":"Following the presentations, two working groups were formed, representing dairy and meat value chains, to prioritize food safety interventions considering a multi-criteria approach and using the following pre-designed elicitation questions:"},{"index":6,"size":12,"text":"• What are the critical risks in dairy and meat value chains?"},{"index":7,"size":14,"text":"• What interventions can be implemented at which value chain nodes (farm, market, household)?"},{"index":8,"size":15,"text":"• What is the role of water in food safety challenges and subsequent potential interventions?"},{"index":9,"size":46,"text":"The market-oriented dairy value chain, where raw milk is the priority commodity, was identified as the primary focus. The intervention should also focus on the informal milk market as it supplies most of the milk in urban and peri-urban systems. The following priority interventions were identified:"},{"index":10,"size":58,"text":"• Training producers on hygienic milk production and handling at milk collection centres • Capacity of milk collection centres: cold chain system; quality testing and surveillance systems • Incentives to producers and vendors to produce and sell high quality milk • Improving regulatory capacity through guidelines, training and advisory support to establish a food safety technical working group"},{"index":11,"size":5,"text":"• Waste management (e.g. biogas)"},{"index":12,"size":5,"text":"• Improving water quality vi"},{"index":13,"size":59,"text":"In the meat value chain, participants identified the meat vendor and abattoir nodes as the focus of the interventions. Antimicrobial residues and zoonoses were acknowledged as challenges, hence the need to target the knowledge, attitude and practices of meat handlers and processors in relation to hygiene and sanitation, with emphasis on foodborne pathogens. The following priority interventions were identified:"},{"index":14,"size":26,"text":"• Implement good hygienic practices, for example, using harmonized standard operating procedures (SOPs) to formalize the practices, with the ultimate goal of end-to-end ISO 14000 certification."},{"index":15,"size":9,"text":"• Mandatory ISO 9000 certification • Meat inspection (incentives)"},{"index":16,"size":8,"text":"• Waste management (outside of the facility downstream)"},{"index":17,"size":8,"text":"• Upgrading of facilities (meat vendors and abattoirs)"}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":144,"text":"To implement its 2030 research and innovation strategy, CGIAR has developed 32 research initiatives designed to achieve a world with sustainable and resilient food, land and water systems. The CGIAR research initiative Protecting human health through a One Health approach has been approved for implementation from 2022 to 2024. The aim of the initiative is to protect human health by improving the prevention, detection and control of zoonoses, foodborne diseases and antimicrobial resistance (AMR) in low-and middle-income countries. The initiative Resilient cities through sustainable urban and peri-urban agrifood systems harnesses the potential of urban capacities for innovation to generate evidence-based solutions to address the food safety constraints of food systems and improve the safety of foods sold in urban markets while strengthening the income opportunities that urban value chains offer, especially to the most vulnerable populations. Ethiopia is a focus country for both initiatives."},{"index":2,"size":1,"text":"On "}]},{"head":"Objectives","index":3,"paragraphs":[{"index":1,"size":7,"text":"The objectives of the meeting were to:"},{"index":2,"size":13,"text":"• introduce the CGIAR One Health and Resilient Cities initiatives to research partners;"},{"index":3,"size":13,"text":"• understand the food safety priorities and ongoing projects and programs in Ethiopia;"},{"index":4,"size":14,"text":"• agree on the focus commodities and interventions through the One Health initiative; and"},{"index":5,"size":17,"text":"• identify opportunities to collaborate with other food safety projects, programs and partners to implement the interventions."}]},{"head":"Opening remarks","index":4,"paragraphs":[{"index":1,"size":37,"text":"The opening remarks were given by Namukolo Covic, ILRI Director General's Representative in Ethiopia, and Sisay Getachew, Director of Veterinary Public Health, Ministry of Agriculture (MoA), Ethiopia (see Annex 1 for the full text of the remarks)."}]},{"head":"Food safety research in Ethiopia","index":5,"paragraphs":[{"index":1,"size":22,"text":"Presentations on food safety in Ethiopia covered the status of food safety management and research projects. The main points are summarized below."},{"index":2,"size":62,"text":"Overview of food safety research and implementation in Ethiopia (government, partners, priority and strategy): Kebede Amenu The presentation covered food safety challenges, relative causes of foodborne diseases (reality vs. perception), food supply diversity, examples of food safety research projects, evidence generated from research and a summary of technologies at hand. The need to translate the evidence generated into intervention actions was noted."},{"index":3,"size":18,"text":"Food safety research projects in Ethiopia (implemented by CGIAR): Silvia Alonso Safe food, fair food project (phase 1)"},{"index":4,"size":41,"text":"The project focused on understanding of the food safety priorities in the respective countries (risk assessment) and development of a participatory data collection tool (rapid integrated assessment) in food safety and nutrition. Evidence was generated from the informal milk value chain."},{"index":5,"size":67,"text":"Safe food, fair food project (phase 2) Based on the results of the first phase, the second phase of the project followed a risk-based approach to develop and test locally relevant food safety interventions. The project also used a policy framework to address sustainability. The interventions had three pillars: (1) improve knowledge and access to technology, (2) develop incentive mechanisms and (3) create an enabling policy environment."},{"index":6,"size":96,"text":"Urban food markets in Africa: Incentivizing food safety through a pull-push approach The project aims to reduce the burden of foodborne disease in Ethiopia and Burkina Faso in poultry and vegetable value chains. This project follows a risk-based approach and investigates if consumer demand can provide the incentive or 'pull' for food safety. The 'push' approach empowers value chain actors to implement best practices that affect food safety through targeted messages and simple tools. The project also builds the capacity of value chain actors to respond to demand, and of regulators to provide an enabling environment."},{"index":7,"size":116,"text":"Assessment and management of risk from non-typhoidal Salmonella, diarrhoeagenic Escherichia coli and Campylobacter in raw beef and dairy products in Ethiopia The project seeks to understand the burden of foodborne diseases in Ethiopia and develop costeffective and socio-culturally appropriate approaches to mitigate the impact of foodborne diseases, with the goal of improving food safety governance. The project tests interventions in milk and meat value chains. The main research questions are: (1) What are the costs and public health burden associated with non-typhoidal Salmonella, diarrhoeagenic Escherichia coli and Campylobacter in Ethiopia? (2) What are cost-effective and socio-culturally acceptable approaches to mitigate the public health risks associated with these pathogens in raw beef and dairy products in Ethiopia?"},{"index":8,"size":4,"text":"Reflections/questions on the presentations"},{"index":9,"size":27,"text":"• It is important to involve stakeholders such as the Ethiopian Standards Agency, which works for inclusion of compulsory standards for dairy products, and animal health laboratories."},{"index":10,"size":19,"text":"• Many organizations are working on food safety and One Health projects but there is little coordination among them."},{"index":11,"size":48,"text":"• Food safety is complex in Ethiopia due to lack of enforcement of food laws and regulations; neither the market nor the institutions are well coordinated and structured, and there are overlaps of institutional food safety mandates with conflicts of interest. How will you engage with these institutions?"},{"index":12,"size":13,"text":"• Government institutions working on food safety are not well empowered and facilitated."},{"index":13,"size":10,"text":"Assigning expert focal persons will be crucial for building partnerships."},{"index":14,"size":28,"text":"• AMR is a very important One Heath issue in Ethiopia. Studies conducted in abattoirs in Addis Ababa, Dire Dawa and Shashemene found high levels of tetracycline resistance."}]},{"head":"Responses","index":6,"paragraphs":[{"index":1,"size":14,"text":"• Involvement of stakeholders in the area is key and expected from this workshop."},{"index":2,"size":80,"text":"• There is not enough data to locate exactly where the problem is and where should we target to make difference in our area of interest. The interest is to be more strategic and we need to know what the important points are to make impact. Regulations can be short-term solutions but what would be the focus of food safety in Ethiopia (big abattoirs; vendors; which food commodities)? These to be addressed with experts and potential stakeholders in the area."}]},{"head":"Presentations on CGIAR initiatives on One Health and Resilient Cities to be implemented in Ethiopia","index":7,"paragraphs":[{"index":1,"size":127,"text":"One Health initiative General overview and food safety work package: Hung Nguyen The presentation emphasized the three things to be achieved from the discussion: understanding the current food safety research projects; agreement on commodity and research questions; and opportunities for collaboration. The structure of the One Health initiative and the theory of change were discussed. The contexts targeted were intensifying food systems, informal food systems and wildlifelivestock interaction. Selected intervention scenarios and impact forecast were also examined. The initiative will be implemented in seven countries (Kenya, Ethiopia, Uganda, Côte d'Ivoire, India, Bangladesh and Vietnam) under five work packages: zoonoses; food safety; AMR; water (environment); and economics, governance and behaviour. Only three work packages will be active in Ethiopia, namely, food safety; water; and economics, governance and behaviour."},{"index":2,"size":50,"text":"Water (environment) work package: Alemseged Tamiru The presentation covered the anthropogenic root causes of water quality deterioration, the importance of water in the food chain, the link between water quality and food safety, analysis of the relative contribution of polluted water to food safety, and business models for resource recovery."},{"index":3,"size":56,"text":"Economics, governance and behaviour work package: Gashaw Abate This work packages focus on behavioural food business as it relates to food safety and includes key actors and food businesses that are engaged in food product distribution from farm to retail. The overall theory of change for food safety was discussed in relation to economics and governance."},{"index":4,"size":68,"text":"Research objectives usually focus on testing the effect of food safety interventions like capacity building, incentives through consumer demand, and surveillance/monitoring of the food business practices and evaluating their impact. The food safety team will look at the impact in terms of food safety related outcomes like reduction in levels of pathogen contamination and the food policy team will look at business-related outcomes such as sales and price."},{"index":5,"size":74,"text":"Resilient Cities initiative : Silvia Alonso The focus is on food systems in urban and peri-urban environments. As urban populations increase, there is a need to make cities resilient, sustainable, green and able to feed their inhabitants. CGIAR research and innovation were discussed under five main areas of work: urban and peri-urban production systems, commercialization (emphasis on informal urban food market), circular bioeconomy, environment and health risk (food and consumer behaviour perspectives), and policy."},{"index":6,"size":4,"text":"Reflections/questions on the presentations"},{"index":7,"size":20,"text":"• What is the current status of the two initiatives? Have you secured funding and is there room for improvement?"},{"index":8,"size":13,"text":"• What were the criteria for selecting the three work packages in Ethiopia?"},{"index":9,"size":16,"text":"• How will you engage with local partners and at what point will you involve them?"},{"index":10,"size":38,"text":"• What was the priority in choosing partners and what is the role and level of engagement of the partners in the project? We need clarity. Among the partners, who will you engage more, the adopters or enablers?"},{"index":11,"size":26,"text":"• Are you focusing on animals? Which specific commodities are the priorities and what are the criteria? Which level of value chain are you focusing on?"},{"index":12,"size":16,"text":"• Please tell us about the connection between the two initiatives: One Health and Resilient Cities."},{"index":13,"size":9,"text":"• What is the environment component expected to address?"}]},{"head":"Responses","index":8,"paragraphs":[{"index":1,"size":23,"text":"• The proposals for the initiatives were approved and the plan is to undertake immediate activities under each work package and expand further."},{"index":2,"size":47,"text":"• CGIAR is undergoing a reform to One CGIAR and only 60% of the planned budget has been secured for 2022. This limitation led us to prioritize work on the selected three work packages in Ethiopia. But we have other initiatives that work on zoonoses, for example."},{"index":3,"size":71,"text":"• The best way of engaging partners is to be defined and this workshop will discuss who is to be involved. The food safety stakeholder engagement process is actually along the value chain from farm to fork. We might focus on vendors at the market level or farmers at the production level or slaughterhouse workers. These are the people who are directly involved in the research more than the assessment phase."},{"index":4,"size":12,"text":"• The red meat and dairy value chains in Ethiopia are chosen."},{"index":5,"size":15,"text":"• In Ethiopia, both initiatives work on food safety issues in animal-source food value chains."},{"index":6,"size":12,"text":"• The environment work package can address waste management and water interventions."},{"index":7,"size":10,"text":"Rationale for choosing the red meat and milk value chains"},{"index":8,"size":12,"text":"• We have good evidence generated on meat and milk value chains."},{"index":9,"size":14,"text":"• There is a visible value chain growth opportunity for the dairy value chain."},{"index":10,"size":15,"text":"• Milk is an excellent food, but a lot of hazards are associated with milk."},{"index":11,"size":14,"text":"• Meat/beef is common in the country, again with a lot of risky practices."},{"index":12,"size":6,"text":"Reflections/questions on the chosen value chains"},{"index":13,"size":32,"text":"• The chosen value chains are among the top priority commodities in the country's 10-year plan but when you refer to 'dairy', do you mean milk or other dairy products as well?"},{"index":14,"size":34,"text":"• Evidence is available on food habits of the population. Milk and meat are consumed more than poultry, fish and other animal-source foods. Between dairy and meat, which to focus on is the question."},{"index":15,"size":59,"text":"• There is a tendency that both commodities (meat and milk) are being commercialized. The new agro-industries by the government initiative in four regions could be an entry point to address food safety. These agro-industries are going to involve several farmers, so if we support this system, we can address food safety at the level of farmers and consumers."},{"index":16,"size":12,"text":"• Why is AMR not included as a component of the environment?"}]},{"head":"Responses","index":9,"paragraphs":[{"index":1,"size":26,"text":"• For the dairy value chain, the market-oriented value chain is the focus and for the meat value chain, butchers, meat vendors and consumers are targeted."},{"index":2,"size":24,"text":"• There are currently no plans for AMR research and intervention in Ethiopia but there may be future opportunities through the CGIAR AMR Hub. "}]},{"head":"Recommendations","index":10,"paragraphs":[]},{"head":"Milk","index":11,"paragraphs":[{"index":1,"size":11,"text":"• In general, market-oriented dairy value chain is the primary focus."},{"index":2,"size":7,"text":"• Raw milk is the priority commodity."},{"index":3,"size":23,"text":"• The intervention should also focus on the informal milk market as it includes most of milk supply in urban and peri-urban systems."},{"index":4,"size":105,"text":"• I welcome you to the ILRI campus for this important meeting on an initiative that focuses on protecting human health through a One Health approach and food safety interventions. Food safety and a One Health approach is critical to attaining not only objectives of food security that can provide optimal nutrition and health outcomes for people. It is also critical for sustaining livelihoods and economic growth right across the globe. The COVID-19 pandemic, perhaps the most significant One Health challenge of our time, has clearly demonstrated why a One Health approach is critical and, I would add, essential to addressing the Sustainable Development Goals."},{"index":5,"size":67,"text":"Coming home to Ethiopia, a One Health approach and the added attention to food safety interventions considered for this meeting come at a very opportune time. This past year, Ethiopia was quite a front runner in the United Nations Food Systems Summit process and developed a food systems transformation pathway and is now working further on a roadmap to realize benefits from the pathway that was developed."},{"index":6,"size":45,"text":"Ethiopia's food systems transformation pathway has set out the following stated vision: 'A holistic transformation of Ethiopia's food systems from production to consumption that promotes enhanced food safety, nutrition and diets, improved livelihoods, greater land preservation and restoration and greater resilience to shocks and stress.'"},{"index":7,"size":49,"text":"It is further indicated in the vision that Ethiopia seeks 'to transform our food systems using a sustainable and healthy diet-centred lens that minimizes trade-offs through calling for strong collaboration across all food systems actors, uniting around a common goal of heathy and sustainable diets for all' (MoA 2021)."},{"index":8,"size":67,"text":"To promote and attain the desired outcomes of increasing consumption of healthy nutritious and sustainable diets, a One Health approach needs consideration as part of the package of efforts towards the vision that has been set, not just in the food systems transformation pathway, but also for other policy instruments Ethiopia has in place such as the food and nutrition strategy, the nutrition-sensitive agriculture strategy and others."},{"index":9,"size":128,"text":"Against this background I have painted, Ethiopia is also one of the most important livestock countries on the continent. Indeed, taking a One Health approach is very opportune at this time. And the One Health experts in this room today I am sure will remind us of the importance of One Health to address the health issues at the interface of humans, animals and the environment such as zoonoses, food safety and AMR. They will no doubt remind us that a One Health Approach should now be an area of priority for all countries without exception as demonstrated by our current global context of the coronavirus disease (COVID-19) pandemic. COVID-19 is a zoonotic disease. The initiative you will be discussing is part of implementing the One CGIAR transition."},{"index":10,"size":66,"text":"CGIAR has moved to a One CGIAR approach in which CGIAR research centres have come together to operate as one, taking a broad food systems approach to deliver on a research and innovation strategy that contributes to five different impact areas: nutrition, health and food security; poverty reduction, livelihoods and jobs; gender equality, youth and social inclusion; climate adaptation and mitigation; and environmental health and biodiversity."},{"index":11,"size":73,"text":"Ethiopia has attracted at least 14 of 32 initiatives under the One CGIAR research and innovation strategy. And during this meeting, you will also deliberate on two: one on One Health and the other on resilient cities. The One Health initiative will focus on food safety, environment and economic and governance aspects of One Health to improve food safety, focusing on the key value chains of animalsource food such as milk and meat."},{"index":12,"size":60,"text":"This stakeholder consultation meeting is a follow up of last year's meeting in July 2021 (consultation to develop the One Health initiative proposal) to make sure to embrace national priorities on food safety. As you engage in your deliberations, I want to end my remarks by challenging you to also think of how you contribute to answering the following questions:"},{"index":13,"size":80,"text":"1. How will the initiatives you will discuss contribute to the vision the country has set in its food systems transformation pathway? What questions will you provide evidence towards? 2. How might those who will need to take up the evidence you generate be empowered to make the most of this evidence once available? 3. How can you leverage the two initiatives you will be discussing to create synergy and the desire for a One Health approach with policy implications."},{"index":14,"size":10,"text":"Distinguished guests, ladies and gentlemen, I wish you fruitful deliberations."},{"index":15,"size":15,"text":"Message from Sisay Getachew, Director of Veterinary Public Health, MoA, Ethiopia All participants, Good morning."},{"index":16,"size":45,"text":"It gives me pleasure to be here today to participate and deliver a speech from MoA on the One Health meeting organized by ILRI to promote the need for a One Health approach to address health threats shared among people, animals, plants and our environment."},{"index":17,"size":86,"text":"As we all recognize, general health risks are increasing with trade globalization, global warming and changes in human behaviour, all of which provide multiple opportunities for pathogens to colonize new territories and evolve into new forms, endangering human, animal and environmental health. There are also emerging and re-emerging potential pathogens that can affect all lives on Earth, circulating among animals, human and the environment. These emerging and re-emerging diseases often need a multisectoral approach and use of multidisciplinary efforts to prevent and or control their occurrence."},{"index":18,"size":78,"text":"According to the World Organisation for Animal Health, 60% of pathogens that cause human diseases originate from domestic animals or wildlife, 75% of emerging human pathogens are of animal origin and 80% of pathogens that are of bioterrorism concern originate from animals. These scenarios indicate that the risk is not only for humans. While most risk assessments focus on the transmission of pathogens from animals to humans, animal health is also greatly affected by diseases transmitted from humans."},{"index":19,"size":57,"text":"We all understand that our society faces an enormous challenges to feed, house and provide a healthy life for the growing human population while preserving the environment and natural resources for the benefit of future generations. In order to meet these challenges, sustainable food production and environmental stewardship are paramount and will require a One Health approach."},{"index":20,"size":100,"text":"Evidence from the Food and Agriculture Organization of the United Nations shows that the global human population is expected to reach 9.7 billion people by the year 2050. As the human population continues to grow, we face increasing challenges to ensure that people will have access to safe, nutritious and healthy food. By the year 2050, food production will need to increase by more than 50% of 2012 production levels to meet demand. As incomes in developing countries continue to rise and living conditions improve, demand for meat, dairy and specialty crops such as fruits, nuts and vegetables has increased."},{"index":21,"size":76,"text":"Therefore, we believe that today's meeting will contribute to possible interventions in the government plan for food security and food safety development in the country. CGIAR's new two-year (2022-24) research initiative titled Protecting human health through a One Health approach is one of the main focus areas contributing to solving the challenges of ensuring sustainable food systems, food safety and food security. Taking this opportunity, the MoA is committed to supporting the implementation of the initiative."},{"index":22,"size":57,"text":"Dear participants, the MoA has been closely working with the main health stakeholders to combat public health threats such as zoonotic diseases, through a One Health approach. Regarding animal health, the MoA has a mandate for activities under zoonotic diseases prevention and control, food safety (raw food sources from animal and plants) and AMR containment and prevention."},{"index":23,"size":74,"text":"I would like to mention some of the current activities that MoA has been undertaking. The ongoing rabies control campaign all over the country that is being coordinated and run by the MoA is a good example that needs a One Health approach. Still, there are many disease scenarios that need multisectoral cooperation and coordination to develop and implement national strategies to tackle such priority zoonotic diseases and broader health threats such as AMR."},{"index":24,"size":83,"text":"The health of animals and the environment determine human health, and the health of animals and of the environment strongly depend on human activities. It's everyone's health. Therefore, I would like to express our continued commitment to promote a sustainable One Health approach towards ensuring sustainable food systems, food security and food safety, recognizing the interdependence of animal, human and environmental health. Together, we can find tangible results for a healthier and more sustainable food system through a One Health approach coordination platform."},{"index":25,"size":15,"text":"Finally, on behalf of the MoA, I wish you the best deliberations in this workshop."},{"index":26,"size":2,"text":"Thank you!"}]}],"figures":[{"text":" The priority interventions are: o Training of producers (hygienic milk production and handling) and actors in the value chain (milk collection centres) o Capacity building of milk collection centres: cold chain system, testing system for quality (surveillance) o Incentives for producers and vendors to produce and sell high quality milk o Improving regulatory capacity through guidelines, training and advisory support for the establishment of a food safety technical working group o Waste management, e.g. biogas o Water quality and supply Meat • For a given intervention, the closer the chain node is to the consumer, the better the result. • Value chain focus: Processing (abattoir or slaughter site) • Problems: o Antimicrobial residues and zoonoses o Hygiene and sanitation; knowledge, attitudes and practices (related to pathogens); contamination (tackled at the level of processing) • The priority interventions are: o Good hygienic practices, formalized through harmonized SOPs; end-to-end ISO 14000 certification o Mandatory ISO 9000 certification o Meat inspection (incentives) o Waste management (outside of the facility downstream o Upgrading of facilities (meat vendors and abattoirs) Annex 1: Opening remarks Message from Namukolo Covic, ILRI Director General's representative in Ethiopia Distinguished guests, ladies and gentlemen, All protocols observed, "},{"text":" 17 May 2022, the initiative teams held a stakeholder workshop for Ethiopian partners to introduce the initiatives, reflect on food safety priorities and ongoing projects in the country and identify priority value chains and food safety interventions. The workshop was held at the Addis Ababa campus of the International Livestock Research Institute (ILRI) with some participants joining online. Participants included representatives from the ministries of agriculture, health and environment, food safety authorities and non-governmental organizations involved in animal-source food value chains. The goal of the workshop was to understand the challenges of food safety in animal-source food value chains in Ethiopia and identify the most suitable interventions to tackle these challenges.  "},{"text":" The One Health initiative will closely work with the One Health National Steering Committee to support and promote One Health activities together with other One Health projects led by ILRI in Ethiopia (Capacitating One Health in Eastern and Southern Africa and the One Health Research, Education and Outreach Centre in Africa).  "}],"sieverID":"02eebfc4-aa35-49f8-946f-505e0dd3b76d","abstract":""}

data/part_1/07aac9c5e57eb9e07a263127825d25c6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07aac9c5e57eb9e07a263127825d25c6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0559a76d-dd83-4d1f-bf9f-eae31a34dfd3/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"ce63b550-612b-42df-b7bf-e2b4d22acf0e","abstract":""}

data/part_1/07f010237397d9f3d96a14d8d8f739ae.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07f010237397d9f3d96a14d8d8f739ae","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/365d1c7c-4223-4292-8dec-7e1143a5bc83/retrieve"},"pageCount":1,"title":"§ This study offers valuable insight into how ASF virus can be transmitted via direct and indirect contact and controlled § Strict movement control and high standards of biosecurity can contribute to the reduction of disease spread","keywords":[],"chapters":[{"head":"A simulation model for African swine fever (ASF) in domestic pigs and evaluation of movement control strategies in Vietnam","index":1,"paragraphs":[]},{"head":"POVERTY REDUCTION, LIVELIHOODS & JOBS","index":2,"paragraphs":[]},{"head":"Partners Outcomes","index":3,"paragraphs":[{"index":1,"size":19,"text":"• The enforcement of movement restrictions is an effective control measure if implemented as soon as outbreaks are confirmed."},{"index":2,"size":28,"text":"• To be effective, movement restrictions need to reach at least between 50% and 75% of the population, and they need to be applied in a timely manner."},{"index":3,"size":1,"text":"The "}]},{"head":"Context","index":4,"paragraphs":[{"index":1,"size":30,"text":"• In Vietnam, the first African swine fever (ASF) outbreak was in backyard pig farms reported in February 2019 . Since then, the disease has spread countrywide and caused ongoing."},{"index":2,"size":17,"text":"• The main reason for the rapid spread was low biosecurity at farm level and poor management."},{"index":3,"size":25,"text":"• Simulation models are a useful tool for decisionmakers to evaluate the impact of outbreaks as well as to identify and evaluate cost-effective control strategies."}]},{"head":"Our innovative approach","index":5,"paragraphs":[{"index":1,"size":21,"text":"• We modelled ASF transmission in domestic pigs in the Mekong Delta Region, Vietnam using different scenarios by adjusting model parameters."},{"index":2,"size":11,"text":"• What-if scenarios estimated the impact of movement control strategy scenarios."}]},{"head":"Future steps","index":6,"paragraphs":[{"index":1,"size":18,"text":"• The findings of this study provide the basis for a cost-benefit analysis of control strategies in Vietnam "}]}],"figures":[{"text":" CGIAR Research Program on Livestock thanks all donors & organizations which globally support its work through their contributions to the CGIAR Trust Fund. cgiar.org/funders This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. June 2020 "}],"sieverID":"9712d1dd-c199-4e11-9f06-ecf267c17146","abstract":""}

data/part_1/07f7fb823cbb35319ffa72eab2419530.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07f7fb823cbb35319ffa72eab2419530","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ebf90b7f-a806-43af-a90a-db6b6ec34420/retrieve"},"pageCount":3,"title":"Quality estimation of intact and ground maize (Zea mays) grain and stover by near-infrared spectroscopy","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":217,"text":"Globally, maize is the most preferred cereal grain component in poultry diets (60-70%) due to its high energy content, good palatability, presence of desirable pigments and essential fatty acids besides being a staple food for human populations in eastern and southern Africa. However, maize, like other cereals, is deficient in certain essential amino acids, particularly lysine and tryptophan. Man and mono-gastric animals such as pig and poultry are not able to synthesize essential amino acids found in proteins, including lysine and tryptophan, which must therefore be acquired through the diet. Cereal proteins contain on average about 2 per cent lysine, which is less than one-half of the concentration recommended for human nutrition by the WHO (1985). Increasing demand for maize grain for swine and poultry production is, at least regionally (Asia and Africa), matched by increasing demand for maize stover as a ruminant feedstuff (Erenstein et al., 2011;Berhanu et al., 2013). Hence, both grain and stover quantity and quality are important particularly in smallholder, mixed crop-livestock farming systems existing in Asia and Africa. In fact, in earlier studies, nutritionally significant variation in stover/haulms traits in existing cultivars of cereals/legumes was identified without affecting the grain/pod yields which positively and significantly influenced the performance of milk-and meat-producing animals (Anandan et al., 2010;Rao and Blümmel, 2010;Nigam and Blümmel, 2010)."},{"index":2,"size":160,"text":"In view of this, plant breeders are attempting to improve both grain (amino acids, metabolisable energy content) and stover quality (IVOMD, ME) traits so as to optimise whole maize plant utilisation. However, in large breeding programmes, it is tedious to analyse the grain/stover samples for quality traits by laboratory analysis but near infrared (NIR) spectroscopy appears to be attractive for quick assessment of grain and stover quality traits in large numbers of samples because NIRS analysis is timesaving, requires less labour, saves consumables cost and does not use hazardous chemicals. In the case of grain, the other factor which makes NIR laborious, costly and slow is grinding of grain samples before scanning. Studies on small cereals (Choudhary et al., 2010) have demonstrated that NIR models have been developed with reasonable accuracy to predict the quality of intact grain samples. Hence, we focused this study on nondestructive assessment of maize grain quality traits as well as stover quality traits by NIR."}]},{"head":"Materials and methods","index":2,"paragraphs":[{"index":1,"size":273,"text":"Grain and stover quality assessment was based on near infrared (NIR) spectroscopy calibrated for this experiment against conventional wet laboratory analyses. The NIR instrument used was a FOSS Forage Analyzer 5000 with software package WinISI II. Thirty samples of maize grain in whole and in ground form (1 mm mesh size) and 690 samples of maize stover were scanned using small circular cups (36 mm diameter). NIR calibration equations for maize grain were based on conventional analysis of 60 samples with protein (N x 6.25) analysed by Kjeldahl and fat content by Soxhlet methods (AOAC 1997; procedure no.s 4.2.02 and 4.5.01). Lysine content in maize grain was determined by the colorimetric method described by Tsai et al. (1972) and Galicia et al. (2009) while tryptophan was analysed by the colorimetric method of Nurit et al. (2009) using a Hitachi U-2001 spectrophotometer. Grain metabolisable energy (ME) content was analysed according to Menke and Steingass (1988) using an equation developed for concentrates in ruminant feeding. Similarly, NIR equations for stover analysis were based on laboratory traits of 690 samples. Traits analysed were nitrogen (N) by the method described above , neutral (NDF) and acid detergent fibre (ADF) and acid detergent lignin (ADL) according to Van Soest et al. (1991). In vitro organic matter digestibility (IVOMD) and ME content of stover samples were determined by the method described above for grain ME but an equation developed for roughages was used for ME calculation. Validation procedures were blind-predictions of laboratory measurements by the NIR equations developed in the calibration procedures. Relationships between blind-predicted and measured variables were described by R 2 and standard error of prediction (SEP)"},{"index":2,"size":1,"text":"values."}]},{"head":"Results and discussion","index":3,"paragraphs":[{"index":1,"size":51,"text":"The accuracy of NIR blind predictions of protein, fat, lysine, tryptophan and ME content of intact and ground maize grain are presented in Table 1 and 2. Except for tryptophan content, nutrients in maize grain scanned whole, i.e. un-ground, were poorly correlated to NIR predictions (R 2 = 0.0 to 0.34)."},{"index":2,"size":72,"text":"In ground maize samples, protein, fat and ME were wellcorrelated (R 2 = 0.81 to 0.94). Predictions of lysine and tryptophan were less highly-correlated (R 2 = 0.60 to 0.79) but still adequate to categorise cultivars into three or four quality classes. Both standard error of calibration (SEC) and standard error of validation (SEP) values were lower for quality traits in ground maize grain than intact grain with the exception of tryptophan."},{"index":3,"size":131,"text":"The possibility of scanning intact whole grain would substantially reduce sample processing needs particularly in terms of time and labour. Several workers have shown that in smaller grains such as pearl millet (Choudhary et al., 2010), rice (Zhang et al., 2011) and rape seed (Velasco et al., 1999) scanning of intact grain samples resulted in similar accuracy of prediction of key nutritional quality traits as scanning of ground samples. However, this was not the case for maize grains (Table 1). Except for tryptophan content, nutritive grain quality traits were very poorly predicted when based on scanning of intact maize grains due to the sheath covering the grain, diversity of surface area and size of the material in the intact grain samples and/or due to vacant space(s) in the NIR scanning cups."},{"index":4,"size":30,"text":"In contrast, quality traits based on scanning of ground maize grains were well-predicted for protein, fat and ME content, while predictions of lysine and tryptophan succeed reasonably well (Table 2)."},{"index":5,"size":84,"text":"The R 2 for comparisons of blind predicted and actually measured lysine and tryptophan content was about 0.70 with a SEP of 0.05 and 0.005 for lysine and tryptophan, respectively; these are similar to validation statistics obtained by Rosales et al. (2011). Delwiche (2004) reported that traditional NIR (diffuse reflectance spectroscopy) region (1000-2500 nm) better predicted the quality of ground cereals whereas shorter wave length light (800-1000 nm) is better suited for predicting the quality of intact seeds because of its higher inherent penetration."},{"index":6,"size":91,"text":"Stover quality traits analysed by single step chemical digestive processes such as N (Kjeldahl), NDF and ADF (Van Soest, 1994) were very well correlated to NIR predicted results with R 2 values ranging from 0.94 to 0.96 (Table 3); multi-step chemical digestive process such as ADL or biological tests (IVOMD and ME) were well correlated (R 2 = 0.81 to 0.82). This is not unexpected since NIR was successfully used to predict these traits in maize stover (Melchinger et al., 1986) and a wide range of forages (Deaville et al., 2000). "}]},{"head":"Conclusion","index":4,"paragraphs":[{"index":1,"size":89,"text":"Both grain and stover quality traits of maize cultivars were well predicted by NIR. However, maize grain quality traits such as content of protein, fat, energy and amino acids (lysine and tryptophan) were better predicted by NIR when the samples were in the ground form. Based on protein, energy and amino acid content, maize grain can be classified and superior samples can be traded for a premium price in the market; use of the same material in livestock and poultry rations reduces the need for other costlier protein sources. "}]}],"figures":[{"text":"Table 3 : Coefficient of determination (R 2 ) and standard errors of 2 ) and standard errors of  "},{"text":"Table 1 . Coefficient of determination (R    2 ) and standard errors of 2 ) and standard errors of prediction (SEP) and calibration (SEC) of near infrared prediction prediction (SEP) and calibration (SEC) of near infrared prediction from scans of whole maize grain.    from scans of whole maize grain. Trait NIR validation  NIR calibration TraitNIR validationNIR calibration n R 2 SEP n R 2 SEC nR 2SEPnR 2SEC Protein (%) 30 0.23 1.2  60 0.65 0.73 Protein (%)30 0.231.260 0.650.73 Fat (%) 30 0.06 1.2  60 0.40 0.94 Fat (%)30 0.061.260 0.400.94 Lysine (%) 30 0.06 0.08  60 0.67 0.04 Lysine (%)30 0.060.0860 0.670.04 Lysine (% 30 0.34 0.72  60 0.67 0.45 Lysine (%30 0.340.7260 0.670.45 protein)      protein) Tryptophan 30 0.90 0.004  60 0.96 0.002 Tryptophan30 0.900.00460 0.960.002 (%)      (%) Tryptophan 30 0.49 0.082  60 0.88 0.03 Tryptophan30 0.490.08260 0.880.03 (% protein)      (% protein) ME (MJ/kg) 30 0.0 0.33  60 0.41 0.17 ME (MJ/kg)30 0.00.3360 0.410.17 ME, metabolisable energy     ME, metabolisable energy      Trait NIR validation NIR calibration TraitNIR validationNIR calibration      n R 2 SEP n R 2 SEC nR 2SEPnR 2SEC      Nitrogen 345 0.94 0.06 345 0.97 0.04 Nitrogen345 0.94 0.06345 0.970.04      (%) (%)      NDF (%) 345 0.94 1.6 345 0.97 1.1 NDF (%)345 0.94 1.6345 0.971.1      ADF (%) 345 0.96 1.2 345 0.97 0.9 ADF (%)345 0.96 1.2345 0.970.9      ADL (%) 345 0.82 0.4 345 0.84 0.4 ADL (%)345 0.82 0.4345 0.840.4      IVOMD (%) 345 0.81 0.4 345 0.92 0.3 IVOMD (%) 345 0.81 0.4345 0.920.3      ME (MJ/kg) 345 0.81 2.5 345 0.92 1.6 ME (MJ/kg) 345 0.81 2.5345 0.921.6  "},{"text":"Table 2 . Coefficient of determination (R 2) and standard errors of prediction (SEP) and calibration (SEC) of near infrared prediction from scans of ground maize grain. Trait NIR validation  NIR calibration TraitNIR validationNIR calibration n R 2 SEP n R 2 SEC nR 2SEPnR 2SEC Protein (%) 30 0.81 0.59  60 0.91 0.34 Protein (%)30 0.81 0.5960 0.910.34 Fat (%) 30 0.83 0.50  60 0.88 0.41 Fat (%)30 0.83 0.5060 0.880.41 Lysine (%) 30 0.69 0.05  60 0.91 0.02 Lysine (%)30 0.69 0.0560 0.910.02 Lysine (% 30 0.79 0.42  60 0.88 0.28 Lysine (%30 0.79 0.4260 0.880.28 protein)      protein) Tryptophan 30 0.70 0.005  60 0.70 0.005 Tryptophan30 0.70 0.00560 0.700.005 (%)      (%) Tryptophan 30 0.60 0.08  60 0.77 0.05 Tryptophan30 0.60 0.0860 0.770.05 (% protein)      (% protein) ME (MJ/kg) 30 0.94 0.13  60 0.94 0.03 ME (MJ/kg)30 0.94 0.1360 0.940.03 ME, metabolisable energy     ME, metabolisable energy  "}],"sieverID":"fc34d3b8-68c8-4388-886c-ea7449185496","abstract":""}

data/part_1/0828ebd541e7cb64f7b3ccbbc5cc46fc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0828ebd541e7cb64f7b3ccbbc5cc46fc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b1b21291-b22a-440e-89d1-e8d8d3ef91f8/retrieve"},"pageCount":7,"title":"Methods of planning livestock feed requirements for smallholder farmers","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":132,"text":"Planning feed requirements of a given livestock farm is the main and essential activity for successful and profitable husbandry. The scope of the planning could stretch from a traditional system to well organized commercial farms. Planning feed requirements for commercial livestock farms are simpler and follows established principles and guidelines. On the other hand, in traditional livestock systems, such as pastoral, agropastoral and mixed crop-livestock systems, planning feed requirements is usually a challenging task. It is generally considered as routine practice and done in a traditional way, which lacks precision and effectiveness. For example, pastoralists plan to have feed and water through moving from place to place in an annual basis. Under such circumstances, the best way of planning is through experiences, which is an established good practice through trial and error."},{"index":2,"size":73,"text":"Planning feed requirements of animals is important because, it ensures animals are fed properly, so we can reach the set production targets. It ensures minimizing feed wastage. It helps to predict feed surpluses and deficits to act accordingly in time. It helps to design strategies of acquiring required feeds including roughages in time and supplement feed requirements can be foreseen a long way in advance and therefore purchased at the lowest possible price."},{"index":3,"size":164,"text":"Animals require feed for different functions. They require feed for body maintenance (a condition in which the body is maintained without an increase or decrease in body weight, and with no production or work being done). Animals also require feed to produce (for growth, fattening, milk and egg production) and others such as wool production and traction. They require feed for reproduction (gamete production, foetus development). Feed requirements could be expressed in many ways depending on the prevailing production system including in terms of total dry matter, or in terms of roughages, concentrate supplements, total mixed rations (TMR), all details of nutrients (protein, energy, vitamins, minerals and water). Or in terms of digestible nutrients, gross and net energies. The objective of this short brief is to give highlights on the benefits of feed planning in each farm, village or district level. It will also give the principles and the information required and the procedures to follow in planning feed requirements for a given period."}]},{"head":"Information required for planning livestock feed requirements","index":2,"paragraphs":[{"index":1,"size":164,"text":"The animals and their management-In planning feed requirement, the first thing to know is the details of animals in the farm. Which type and number of animals are in the farm (cattle, goats, sheep or others)? What is the main purpose of the animals (milk, meat, power)? What is the level of productivity? How many are there in the different categories (milking cows, growing animals, heifers, steers, bulls, calves )? Good if one has individual live weights periodically. The management of the animals has the main determinant factor for proper planning of feed requirements of the animals. These include: One can broadly categorize the management of animals as pastoral, agropastoral and sedentary (mixed croplivestock systems in Ethiopia) production systems. Extensive, semi-intensive and intensive systems, traditional and commercial production systems. In dairy it could also be categorized as rural, peri-urban and urban systems. These classifications are normally based on the level of feed availability and feeding systems. It also implies the level of information/data availability."},{"index":2,"size":330,"text":"Quantifying and qualifying available feed resources-In planning feed requirements for animals, one must identify the feeds which will be available in the area or to be potentially purchased. Some feed sources are normally difficult to estimate, such as feed from communal grazing land and aftermath grazing. On the other hand, feeds from natural or cultivated pasture hay and crop residues could be roughly estimated in terms of total dry matter produced. Crop residues yields are usually estimated from the grain yield using an established multiplying factor for the different crops as indicated in Table 1. Cultivated forage crops used as a cut and carry or conserved in any other form could be estimated through normal sample procedures. Availability of concentrate feeds in the form of compound feeds or agroindustrial products should be described. Any other feed sources which are quantifiable need also to be quantified. The other important parameters to be known in formulating or planning feeds for livestock are the price of every type of feed used and the major quality parameters in terms of nutrient content including protein, energy and digestibility. The price of seeds may also be seen across the different months or seasons of the year. Describing the details of animals-Feed requirements are based on the type, condition, and production level of the animals. Hence, information on the status of the animals is required. The basic information includes the weight of the animals, the production level (growth rate, milk yield/day ) and physiological levels such as pregnancy need to be known. However, under smallholder farmers conditions, information like live weight of animals is usually difficult to obtain, even in most cases production levels are not well known and described. In such cases use of different methods of estimating live weight such as extrapolating weight from heart girth or converting animal types to tropical livestock units (TLUs) which is the equivalent to 250 kg using conversion factors indicated in Table 2. rations for different types of animals."},{"index":3,"size":10,"text":"b) Estimating feed requirements of animals for traditional feeding practices"},{"index":4,"size":236,"text":"Under the traditional livestock production systems, the basic information required such as live weight and production levels are not readily available or inadequate. This is because data recording systems are not in place and basic facilities such as weighing balances are not easily accessible or do not exist. When information such as live weight is required, it is usually estimated or extrapolated from established figures like for example using TLUs and heart girth measurements. When information on production levels such as milk yield and weight gain are not available planning feed requirements will be made usually through estimating the maintenance requirements. However, it is also possible to make crude estimates of feed requirements for the different production levels. Regardless of the quality of feed, feed intake of animals per day on dry matter basis normally ranges between 2.5-3% of the animal's live body weight. It is usually observed that animals consume higher proportions when the quality of feed or roughage is very good and lower when the quality is poor. For estimating feed requirements based on the level of production (milk yield, growth) it is possible to use standard feed requirement tables or practical recommendations. For example, there are recommendations to feed 0.5 kg of concentrate for 1 litre of milk low producing crossbred cows. It is advisable to be inquisitive about standard feed requirement tables, which are mostly established for highly productive temperate animal breeds."},{"index":5,"size":332,"text":"Example to plan feed requirement of a farmer owning mixed species of livestock Table 3 shows an example of a farmer's livestock holdings expressed as to TLUs in which the total live weights are estimated. The 10.43 TLU animals is equivalent to 2,606 kg live weight (10.43 TLU × 250 kg = 2,606 kg). Accordingly, the daily feed requirements of these animals will be 2,606 kg live weight × 3% = 78.2 kg (assume the animals consume 3% of the animal's live weight in DM basis). This annual feed requirement is multiplying the daily feed requirement by 365 days (78.2 × 365 = 28,543 kg = 28.5 t of total dry matter (TDM)). It is normally advisable to add about 20% allowance for feeds that may be wasted as refusal and others. These brings the annual feed requirement to be 34,200 kg (34.2 t) (28.5 t + (28.5 × 20%) = 34.2 t TDM). This feed is basically a maintenance requirement. However, the quality of the feed we provide determines the productivity. Therefore, knowing the quality of the feed and the production level helps to refine the planning to be more practical. When estimating the total available feed you need to critically look into the availability of the feed in the area, its nutritional value in relation to the nutrient requirement and target product, the price of the feed (if purchased) and ease of production and its productivity and quality (if it is to be produced). Once the quantity of feed required for the animals on the farm is estimated, the next step is to quantify the available feeds including grazing, crop residues, hay, cultivated forage crops, agro-industrial by products, formulated concentrate feeds and others. Then the sum of these feeds available in dry matter basis will be compared to see the balance with the requirements. If the available feed is in a negative balance, then we have to design how to fulfil the deficit either through purchase, production or other means."},{"index":6,"size":18,"text":"If the balance shows extra feed, it could be conserved for later use or sold at the market."},{"index":7,"size":44,"text":"In planning the feed requirements of the traditional production systems in the mixed crop-livestock production systems in Ethiopia, it is very essential to properly understand the farming system and livestock feeding practice. In the mixed crop-livestock systems there are 3 broadly categorized feeding practices:"},{"index":8,"size":1,"text":"1."},{"index":9,"size":15,"text":"Livestock fully under grazing systems, which is very extensive, traditional, and not market oriented, 2."},{"index":10,"size":14,"text":"Semi-intensive in which animals are partly grazing but provided with supplement feeds and 3."},{"index":11,"size":2,"text":"Indoor feeding/tethering."},{"index":12,"size":12,"text":"For these systems, planning feed requirements for animals are described as follows:"},{"index":13,"size":1,"text":"i."},{"index":14,"size":90,"text":"Livestock feeding entirely based on grazing in mixed crop-livestock system area-this is based on grazing on pasture and crop aftermaths, browsing bushes and trees, and feed on crop residues on threshing grounds. In these feeding practices the major issues for planning feed requirements are challenges to estimating available feeds from grazing and browsing, whether the animals consume adequately or not and variabilities on feed availability over seasons. Therefore, such system requires experience to the production system. To improve productivity and efficient use of feed resources appropriate interventions are required. ii."},{"index":15,"size":54,"text":"Livestock grazing and supplemented with additional feeds-Most farmers in the mixed crop-livestock systems keep their livestock to graze and browse during the daytime and supplement crop residues and other feed sources in the mornings and evenings. The grazing lands are usually poor and during the dry season it is highly degraded and extremely poor."},{"index":16,"size":302,"text":"Estimating feed intake from grazing lands especially from communal grazing lands is difficult. However, the annual production of hay from grazing lands could be estimated based on the condition of the grazing lands. Poor grazing lands produce about 1 t/ha DM, relatively good grazing lands produces 1-2 t/ ha DM, and protected grazing lands produce 3-4 t/ha DM. If applicable yield estimation by field sampling is more accurate. The estimated yield from grazing lands (pasture lands) could be used as grazing, cut and carry or conserved hay. In planning the feed requirements in such system there is a need to critically determine how much proportion of the feed requirement is fulfilled from the grazing and browsing. A good estimation is made from experience. Based on the estimation the remaining feed which is used as supplement will come from crop residues, hay, cultivated forages, concentrate feeds and others. Quantify these feeds and sum up. The next question is the sum of these feeds fulfilled the estimated feed requirement of the animals in addition to the grazing and browsing. Make a balance if the available feed is low then quantify the deficit and plan how the feed shortage is managed or fulfilled from different feed sources through purchase, production of cultivated forages or other management options like culling of animals. iii. Estimating feeds requirements to intensive (confined) feeding systems-There are significant number of livestock farms in which animals feed intensively and productivity is also remarkably high. However, the data recording systems even for the financial systems is not in place. The livestock population should be converted to TLU so that their annual feed requirement for maintenance in terms of total DM is estimated. If production and productivity levels at kebele or district level is roughly estimated this could be considered in the feed requirement."}]},{"head":"2.","index":3,"paragraphs":[{"index":1,"size":69,"text":"Taking stock of all the feed sources and estimating the total feed available per year at kebele, district or zonal level. All the grazing lands, crop areas cultivated and estimated grain and crop residues yields (by species level, maize, wheat, chickpea, lentil, enset etc.), hay made from natural pasture, cultivated forage crops, concentrate supplements and other feeds available. Sum up the total feed estimated in terms of dry matter."}]},{"head":"3.","index":4,"paragraphs":[{"index":1,"size":43,"text":"By balancing the feed requirements of the livestock in the kebele, district or zone with the total available feed we can roughly estimate whether the feed is enough or deficit. Based on this prediction one can do the required action ahead of time."}]}],"figures":[{"text":"Table 1 . Multipliers used to estimate crop residue yields from grain yields of different crops No. Crop type Multiplier No. Crop type Multiplier 1 Teff 1.5 1Teff1.5 2 Wheat 1.5 2Wheat1.5 3 Barley 1.5 3Barley1.5  "},{"text":"Table 2  . Conversion factors of different . Conversion factors of different livestock groups into tropical livestock units livestock groups into tropical livestock units (TLUs) (TLUs)  "},{"text":"Table 3   . Example on how to convert the  . Example on how to convert the different type and number of animals a  different type and number of animals a farmer has to TLU    farmer has to TLU No. Animal Number Conversion Total No. AnimalNumberConversionTotal  description of factor to TLU descriptionoffactor toTLU   animals TLU  animalsTLU 1 Crossbred 2 1.8 3.6 1Crossbred21.83.6  cows    cows 2 Local oxen 3 1 3 2Local oxen313 3 Crossbred 2 0.4 0.8 3Crossbred20.40.8  calves    calves 4 Crossbred 1 0.7 0.7 4Crossbred10.70.7  heifer    heifer 5 Mature 1 0.5-0.7 0.6 5Mature10.5-0.70.6  donkey    donkey 6 Sheep 15 0.1-0.13 1.73 6Sheep150.1-0.131.73  Total   10.43 Total10.43  "},{"text":" Planning feed requirements for animals at the village, district or at zonal level follows the same principle as that of planning for an individual livestock farm. The major deviation comes from the precision of data collected for such a large area and huge livestock population and the dynamic nature of the different factors considered. For planning three steps are required:1.Enumerate the existing livestock population in the given kebele, district or zone. The data need to be detailed and should have the different categories (calves, heifers, oxen, cows etc.) in the different species (sheep, goats, cattle etc.). c) Planning feed requirements at c) Planning feed requirements at village, district or zonal levels village, district or zonal levels  "}],"sieverID":"30afd9ef-03cc-4231-a5bb-194258f95f28","abstract":""}

data/part_1/089752b51d43634a13930a66142fee36.json

@@ -0,0 +1 @@
+{"metadata":{"id":"089752b51d43634a13930a66142fee36","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6dabfe9b-2ec7-46a3-afc0-ffc08ed0c38e/retrieve"},"pageCount":20,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":214,"text":"Results Framework FGD Workshop Report: A focus group discussion on the Results Framework process  in ... .............................................................................................................................. Did you have any outputs that were related to engagement with partners and other stakeholders ? ................... Would it be useful to create an explicit category for engagement ? ....................................................................... What other categories of outputs could be created to reduce the number of \"other outputs\"? ............................  What went well? ..................................................................................................................................................... What did not work well? And why? ......................................................................................................................... How might we improve? ..................................................................................................................................... Any other things that worked well (for you) and why? i.e. we should maintain doing this in the next reporting cycle. ........................................................................................................................................................................ The one thing that comes to your mind about what is essential that we need to improve is … (all were scored with a 5 = absolutely essential to improve) .. ........................................................................................................... Any other things that did not work (for you) and why? And most important, how can we improve this? ............. Anything else that needs to be taken note of ? .....................................................................................................  in ... ............................................................................................................................ Did you have any outputs that were related to engagement with partners and other stakeholders ? ................... Would it be useful to create an explicit category for engagement ? ....................................................................... What other categories of outputs could be created to reduce the number of \"other outputs\"? ............................ "}]},{"head":"Did you have any difficulties","index":2,"paragraphs":[]},{"head":"Did you have any difficulties","index":3,"paragraphs":[]},{"head":"Introduction","index":4,"paragraphs":[{"index":1,"size":30,"text":"The Results Framework (RF) Focused Group Discussion (FGD) was conducted on June 26, 2023. With 14 participants, the FGD consisted of a presentation, breakout rooms, and a final group discussion."},{"index":2,"size":8,"text":"We sought feedback on three broad key questions:"},{"index":3,"size":10,"text":"• What went well? • What did not work well?"},{"index":4,"size":5,"text":"• How we can improve?"},{"index":5,"size":31,"text":"Below is a summary analysis of the focus group discussions, highlighting valuable insights and recommendations. Raw comments from the Miro board and FGD are put together in Annexes 1 and 2."},{"index":6,"size":49,"text":"Additionally, these broad questions were asked with a set of more specific questions in the form of a survey that was made available before the meeting; participants were also time given during the meeting to submit responses. The survey results are presented below, with full details in Annex 3."}]},{"head":"What went well? Efficient data entry and user-friendly systems","index":5,"paragraphs":[{"index":1,"size":57,"text":"The participants praised the CGSpace links, which facilitated efficient data entry. This suggests that the system provided a streamlined and time-saving approach to inputting data. Additionally, the userfriendliness of the Performance and Results Management System (PRMS) was highlighted, indicating that the system was designed in a way that made it easy for users to navigate and operate."}]},{"head":"Positive feedback on the Results Dashboard","index":6,"paragraphs":[{"index":1,"size":20,"text":"The Results Dashboard received positive feedback, implying that it effectively presented the generated results in a clear and accessible manner."}]},{"head":"Familiarity and experience with SIDS and CRP","index":7,"paragraphs":[{"index":1,"size":33,"text":"The familiarity with Standards Indicator Description Sheets (SIDS) from previous CGIAR research program (CRP) experience was beneficial, as participants were able to leverage their existing knowledge and apply it to the current project."}]},{"head":"Ease of mapping activities and reporting key performance indicators","index":8,"paragraphs":[{"index":1,"size":32,"text":"The Scriptoria MF tool received positive feedback for its ease of use in mapping project activities. Additionally, the participants mentioned that inputting key performance indicators (KPIs) into PRMS was a straightforward process."}]},{"head":"Knowledge management contributions","index":9,"paragraphs":[{"index":1,"size":44,"text":"The involvement of knowledge management (KM) personnel in quality-checking metadata for outputs that go into CGSpace was seen as a positive contribution. This suggests that the KM team played a significant role in ensuring the accuracy and reliability of the information shared through CGSpace."}]},{"head":"What did not work well? And why?","index":10,"paragraphs":[]},{"head":"Complexity and inaccessibility of the theory of change process","index":11,"paragraphs":[{"index":1,"size":105,"text":"Participants expressed frustration with the complexity of the theory of change (TOC) process. They felt that it was overcomplicated, with too many columns and fields that were not updated in sync. This resulted in a loss of control over versions and made it challenging to access the live version. The focus on words in boxes and links detracted from the process's coordination aspect, and the TOC process became inaccessible to anyone except a small team. Additionally, participants noted that wordsmithing and target setting from different stakeholders occasionally led to inappropriate changes. These challenges led to a reluctance among scientists to be involved in the process."}]},{"head":"Reporting challenges and misalignment","index":12,"paragraphs":[{"index":1,"size":27,"text":"Reporting against the indicators and targets listed in proposals was a significant challenge. This created difficulties in demonstrating to funders whether the promised deliverables were being met."},{"index":2,"size":32,"text":"The lack of linkage between PRMS and the TOC/RF prevented effective tracking of progress against the TOC/RF. Communication gaps between Initiative management and Center-level staff resulted in rushed activities without proper expectations."},{"index":3,"size":19,"text":"Confusing communication and guidance, managed through Microsoft Teams chat instead of a structured system, further added to reporting challenges."},{"index":4,"size":17,"text":"Participants emphasized the need for clarification on reporting Expression of Interest Outcomes and Action Area (AA) Outcomes."},{"index":5,"size":14,"text":"Moreover, there was a tendency to focus on quantity rather than quality/relevance in reporting."},{"index":6,"size":15,"text":"Results Framework FGD Workshop Report: A focus group discussion on the Results Framework process 5"},{"index":7,"size":20,"text":"The limited space in PRMS and the excessive details required were perceived as burdensome compared to what was being reported."}]},{"head":"Usability and accessibility challenges","index":13,"paragraphs":[{"index":1,"size":12,"text":"Participants highlighted several areas where usability and accessibility challenges may need addressing:"},{"index":2,"size":17,"text":"• The ability to batch upload into PRMS was desired to streamline the laborious data entry process."},{"index":3,"size":120,"text":"• There was a suggestion to shift the focus from outputs (such as publications and capacity development reporting) to reporting progress against outcomes and behavioral changes. • Aligning reporting with the TOC and improving the formatting of TOC diagrams were also seen as necessary enhancements. • Participants noted that partnership graphs were incorrect and could not be used for reporting purposes. • Ongoing access to the \"CGIAR Level Agricultural Results Interoperable System Architecture\" (CLARISA) for uploading partner information was deemed important. • Dealing with evidence and knowledge products, particularly compliance-driven documents, was seen as burdensome when loading them for public viewing in CGSpace. • The use of Scaling Readiness in reporting was considered unclear and overly complex, hindering effective communication."}]},{"head":"How might we improve? Communication and clarity","index":14,"paragraphs":[{"index":1,"size":24,"text":"Stakeholders, linked with processes including CGSpace and PRMS should be informed about the timeline to ensure better coordination (in addition to notifying the researchers)."},{"index":2,"size":8,"text":"Clear differentiation between outputs and innovations is needed."},{"index":3,"size":31,"text":"Clarity on at what stage of Scaling Readiness the innovation's use becomes an outcome, i.e., guidance on reporting innovations at level 6 and above as both innovations and outcomes are required."},{"index":4,"size":19,"text":"The addition of new categories or metadata should be evaluated in terms of managing results and meeting funder requirements."},{"index":5,"size":23,"text":"The RF should consider the overall CGIAR strategy and ensure coordination and linkage among global Initiatives, Action Areas, Impact Areas, and Regional Initiatives."}]},{"head":"Results management","index":15,"paragraphs":[{"index":1,"size":8,"text":"Improvements are needed in managing results within PRMS."},{"index":2,"size":15,"text":"Results Framework FGD Workshop Report: A focus group discussion on the Results Framework process 6"},{"index":3,"size":12,"text":"Streamlining the reporting process by eliminating the \"Other Output\" category is suggested."},{"index":4,"size":11,"text":"Clarification on the distinction between \"Other Outputs\" and innovations is necessary."},{"index":5,"size":8,"text":"Initiatives should focus on reporting against their targets."},{"index":6,"size":17,"text":"Alignment with the AA Outcomes needs to be worked on and clear guidance needs to be given."},{"index":7,"size":22,"text":"A participatory tool involving scientists, managers, and monitoring, evaluation, and learning (MEL) experts should be developed for creating the TOC and RF."}]},{"head":"Reporting and indicators","index":16,"paragraphs":[{"index":1,"size":24,"text":"Differentiation between what is \"evidence\" and kept for accountability reasons and \"knowledge product\" outputs provided to show progress towards outcomes in reporting is important."},{"index":2,"size":15,"text":"Guidance is needed on prioritizing certain indicators and understanding their importance to funders and Initiatives."},{"index":3,"size":18,"text":"Guidelines defining key results and their purpose are required to avoid a focus solely on quantity over quality."},{"index":4,"size":9,"text":"The inclusion of TOC targets in PRMS is recommended."},{"index":5,"size":10,"text":"Timelines should be shared earlier to facilitate planning and reporting."},{"index":6,"size":16,"text":"The revival of the MEL Community of Practice with peer support and shared templates is suggested."}]},{"head":"Data and information management","index":17,"paragraphs":[{"index":1,"size":10,"text":"Linkages between output/outcome targets and AA outcomes should be illustrated."},{"index":2,"size":10,"text":"Effective management of timelines is necessary to reduce last-minute requests."},{"index":3,"size":14,"text":"An equivalent of CGSpace for reporting capacity building events in real-time should be developed."},{"index":4,"size":13,"text":"Mechanisms for reporting should be defined to protect Initiatives from micromanagement by donors."},{"index":5,"size":8,"text":"Offline templates would be beneficial for reporting purposes."},{"index":6,"size":13,"text":"Improvements are needed in \"findable, accessible, interoperable and reusable\" (FAIR) scoring for outputs."},{"index":7,"size":13,"text":"Reporting stakeholder engagement as part of co-creation and TOC development should be considered."},{"index":8,"size":17,"text":"A dashboard for the RF/Plan of Results (POR) and countries is required to enhance visibility and planning."},{"index":9,"size":27,"text":"The same partner appeared in the Polinode maps under different names; need to check where the source for this came from as CLARISA has a clearing process."}]},{"head":"Simplification and integration","index":18,"paragraphs":[{"index":1,"size":5,"text":"Simplify the Scaling Readiness concept."},{"index":2,"size":18,"text":"Develop tools for day-to-day Initiative management and tracking progress against Plan of Results and Budget (PORB) and TOC."},{"index":3,"size":22,"text":"Explore retiring the On-line Submission Tool (OST) and TOC board concept and consider a more streamlined and offline version of data entry."},{"index":4,"size":15,"text":"Presenting results along with the TOC, rather than just on a dashboard, should be considered."},{"index":5,"size":20,"text":"Emphasize the importance of monitoring, evaluation, learning, and impact assessment (MELIA) studies and their connection to workplans and end-of-Initiative outcomes."},{"index":6,"size":27,"text":"Rethink the Results Dashboard to provide better decision-making support for Initiatives, or this may require a different type of dashboard -more process/progress-oriented to complement the Results Dashboard."}]},{"head":"Summary of breakout room and general discussions Resource utilization and empowerment","index":19,"paragraphs":[{"index":1,"size":39,"text":"Discussions: Leveraging existing expertise/resources within CGIAR for SIDS improvements, e.g. Empowering capacity development units and knowledge management colleagues in each Center to contribute to relevant areas. Reducing reliance on external units for reporting and accessing expertise within each Center."}]},{"head":"Reporting alignment and clarity","index":20,"paragraphs":[{"index":1,"size":26,"text":"Discussions: Addressing the alignment of end-of-Initiative outcomes with reporting. Understanding the inclusion of Action Area outcomes and their alignment with the initial proposal and results framework."},{"index":2,"size":14,"text":"Clarifying when to report knowledge products and addressing confusion regarding their classification as outputs."}]},{"head":"Streamlining reporting and prioritization","index":21,"paragraphs":[{"index":1,"size":60,"text":"Discussions: Identifying the need to streamline reporting by establishing clear rules. Emphasizing the importance of reporting fewer but more meaningful and higher-quality outputs aligned with initial commitments. The aim is to prioritize reporting outputs that are meaningful, higher quality, and aligned with the initial commitments. This approach ensures that the reported outputs effectively communicate the story of the achieved results."}]},{"head":"Usability and communication","index":22,"paragraphs":[{"index":1,"size":27,"text":"Discussions: Addressing the limited usability of the RF. Considering the broader story of impact beyond mapping outputs. Enhancing communication of timelines and information to all staff members."},{"index":2,"size":67,"text":"Participants expressed concerns about the limited usability of the RF, making it challenging for stakeholders to navigate and filter information based on their interests. They also emphasized the need to focus on the broader story of impact rather than solely mapping outputs. Additionally, the discussion emphasized the importance of clear communication of timelines and information to all staff members, ensuring everyone is aware of deliverables and deadlines."}]},{"head":"Process improvement suggestions","index":23,"paragraphs":[{"index":1,"size":30,"text":"Discussions: Opening the reporting process earlier for real-time tracking. Prioritizing gender perspectives in online meetings. Simplifying TOC diagrams and network maps. Providing a consistent template to streamline the reporting process."},{"index":2,"size":62,"text":"Participants proposed opening the reporting process earlier to enable real-time tracking of progress. They highlighted the importance of prioritizing gender perspectives in online meetings. Additionally, there were suggestions to simplify TOC diagrams and network maps to enhance their communicability, including highlighting partner networks. Participants also recommended providing a consistent template to streamline the reporting process and reduce reliance on designers or software."}]},{"head":"Enhanced accessibility and organization of information","index":24,"paragraphs":[{"index":1,"size":25,"text":"Discussions: Identifying and tagging evidence for easier retrieval. Establishing a structured approach to track and report innovations. Standardizing the uploading of knowledge products to CGSpace."},{"index":2,"size":44,"text":"Participants suggested identifying and tagging evidence, such as MELIA studies, to make it easier for evaluators and others to locate relevant information. They also highlighted the need for a structured approach to track and report innovations, ensuring that their progress is monitored over time."},{"index":3,"size":27,"text":"Additionally, the participants discussed the importance of standardizing the uploading of knowledge products to CGSpace, aligning with the PRMS, and avoiding the need for separate document types."}]},{"head":"Internal needs and activity management","index":25,"paragraphs":[{"index":1,"size":12,"text":"Discussions: Considering internal needs in the future of the Performance Management Framework."},{"index":2,"size":22,"text":"Addressing the risk of Initiatives developing their own activity mapping tools. Incorporating internal targets for better activity management within a unified framework."},{"index":3,"size":27,"text":"Participants recommended considering the internal needs of Initiatives in the future of the Performance Management Framework, highlighting the risk of each Initiative developing its own activity mapping"},{"index":4,"size":32,"text":"Results Framework FGD Workshop Report: A focus group discussion on the Results Framework process 9 tools. They proposed incorporating internal targets within a unified framework to facilitate better activity management and coordination."}]},{"head":"Summary results from the survey on detailed questions","index":26,"paragraphs":[{"index":1,"size":96,"text":"Five total submitted responses. • Time consuming and no clear process for this from the scientist to the Center to the Initiative. What would be dealt with through Center-level processes by a team/unit for anything non-Initiativerelated falls in the lap of Initiative management (1 person). • No formal process for this; it is up to the Initiative Design Teams to develop their own quality review. However, Initiatives do not want this to be prescribed … perhaps a checklist that we could use, and then QA could also refer to. • The lead or WP leads decided."}]},{"head":"Did","index":27,"paragraphs":[]},{"head":"Did you have any outputs that were related to engagement with partners and other stakeholders?","index":28,"paragraphs":[{"index":1,"size":4,"text":"4 Yes, 0 No"}]},{"head":"Would it be useful to create an explicit category for engagement?","index":29,"paragraphs":[{"index":1,"size":15,"text":"What other categories of outputs could be created to reduce the number of \"other outputs\"?"},{"index":2,"size":53,"text":"• Break knowledge product outputs into \"published\" and \"gray\" materials with different criteria and stringencies for both, especially around whether needing to be put into CGSpace. • Evidence that will not go on CGSpace -but that could come under an engagement tracking tool. • Blog articles or other documents documenting progress toward outcomes."},{"index":3,"size":912,"text":"• If you create other outputs you need to make sure this has a value for the user (learning, com Annex 1: Actual discussions 1. In the spirit of our matrix structure, how can we leverage existing resources within CGIAR to improve SIDS and enhance innovation? Specifically, why not empower capacity development units or knowledge management colleagues in each Center to review and contribute to relevant areas, such as capacity development and innovation? This would reduce the distance and reliance on external units for reporting and enable faster access to expertise and tailored support within each Center. 2. Are the end-of-initiative outcomes included in the reporting? I assume they are combined with Work Package outcomes. Additionally, since this year Initiatives are also required to report against Action Area outcomes, I'm unclear about the alignment with the initial proposal and the set RF. It would be helpful to understand the rationale behind the inclusion of Action Area outcomes and ensure clarity for future cycles to avoid confusion and overlapping of reporting. 3. During the discussion, we raised a question about the issue of reporting results within other results. I shared an example of my experience where I initially reported a workshop under capacity development but later was advised by the quality assessor to report it as a knowledge product on CGSpace. I clarified that there seems to be confusion regarding when a knowledge product should be reported as an output, specifically if it is developed for a specific purpose to advance the TOC or solely for accountability. I emphasized that reporting it purely for the sake of having it listed as a knowledge product may not be meaningful and could be seen as a waste of time. Instead, I suggested reporting it as a link within the relevant context. 4. The key takeaway from this section is that we may have spent excessive time reporting outputs that were unnecessary or not aligned with our initial commitments. It is crucial to establish clear and shared rules for reporting, prioritizing fewer but more meaningful and higher quality outputs that effectively tell the story of our results. 5. The RF has the potential to be a useful tool for various stakeholders, including integrating Initiatives and Impact Area directors. However, its current usability is limited, making it difficult for people to navigate and filter information based on their interests. This was a common concern expressed by participants. 6. Sometimes, when we use results for reporting purposes, such as in the Portfolio Narrative or Dashboard, we may focus on mapping outputs without considering the broader story of how our Initiatives contribute to impact. While this type of reporting may be interesting to funders, it doesn't effectively capture the impact we aim to achieve. Impact takes time to materialize, and it can be challenging to demonstrate it solely based on past-year reporting. However, if we can link our results to the precursor of impact, we can indicate the potential outcomes we expect to achieve. This approach allows us to convey the intended impact without making definitive claims. 7. There is a need for better communication of timelines and information to all staff, not just the Initiative teams, to ensure that everyone is aware of deliverables and deadlines. 8. There was a suggestion to open the reporting process earlier, particularly in relation to CGSpace capturing and real-time tracking of capacity development numbers. 9. Additionally, it was mentioned that capturing gender perspectives in online meetings should be prioritized. In a separate discussion, the suggestion was made to simplify the TOC diagrams and network maps to enhance their communicability, including highlighting partner networks. 10. It was suggested to establish a consistent template for Initiatives to use, providing guidance to streamline the process and reduce reliance on designers or software. The idea is to encourage disciplined communication and to explore simpler tools like ready-made PowerPoint templates. This aligns with previous discussions on improving communication within the group. 11. There was a suggestion to clearly identify and tag evidence, such as MELIA studies, to make it easier for evaluators and others to locate relevant information. This would streamline the process of searching for specific studies or evidence during evaluations and eliminate the need for extensive manual searching. 12. The need for clarification and a more structured approach to the innovation inventory was highlighted. The suggestion is to create a fixed structure for the inventory, similar to the fixed TOC, where each innovation is recorded over time, and the scoring may change based on its progress. The current practice of reporting the inventory annually without updating or tracking the innovations' progress is seen as problematic. There is a call for a more structured and consistent approach to managing the innovation inventory, while annual reporting focuses on the scale of outcomes or development/use. 13. The need for a standardized approach to uploading knowledge products to CGSpace, ensuring that they meet certain criteria, was discussed. The focus is on managing results along the TOC, where reporting a knowledge product should be necessary only if it is meaningful and justifiable within the context of the PRMS. Creating a new document type specifically for the PRMS is not recommended as it would lack interoperability with other libraries. The suggestion is to ensure that the reporting of knowledge products in the PRMS carries significance and aligns with the standardized approach discussed within the KM working group. 14. The discussion raised the question whether the future of the Performance and Results"},{"index":4,"size":76,"text":"Management Framework should better cater to the internal needs of Initiatives. Currently, there is a risk of each Initiative developing its own tools to map activities, as seen from the posted comments regarding the ease of mapping activities. It suggests that if there is a significant demand from Initiatives to work on activities, the PRMS should consider incorporating internal targets to facilitate better management. This would help Initiatives effectively manage their activities within a unified framework."},{"index":5,"size":15,"text":"Results Framework FGD Workshop Report: A focus group discussion on the Results Framework process 13"},{"index":6,"size":7,"text":"Annex 2: Summary of comments from the"}]},{"head":"Miro board","index":30,"paragraphs":[{"index":1,"size":3,"text":"What went well?"},{"index":2,"size":9,"text":"• The CGSpace links made the data entry efficient."},{"index":3,"size":6,"text":"• The PRMS is very user-friendly."},{"index":4,"size":21,"text":"• The Results Dashboard is good! • SIDS were similar to those used in the CRPs and we already had experience."},{"index":5,"size":12,"text":"• The Scriptoria MF tool is very easy to map activities onto."},{"index":6,"size":9,"text":"• Very easy to report a KP in PRMS."},{"index":7,"size":18,"text":"• KM people do a lot of the quality checking on metadata for outputs that go into CGSpace."}]},{"head":"What did not work well? And why?","index":31,"paragraphs":[{"index":1,"size":91,"text":"• The TOC process should be simplified. It was overcomplicated -too many columns and fields that were not updated in sync. Also, the scientists lost control of versions, and we could not easily access the live version. It became very quickly abstract -too much focus on the words in the boxes and links between than using the process to coordinate with partners and colleagues, it was inaccessible to anyone except a small team. There seemed to be wordsmiths and target setting happening from different stakeholders that resulted in occasional inappropriate changes."},{"index":2,"size":68,"text":"Focus could be at outcome level -let Initiatives manage outputs and indicators? Very few scientists wanted to be involved in the end. • We were not able to report against the indicators/targets listed in our proposal and funders cannot understand if we are delivering what we promised. • PRMS and TOC/RF in OST, not really linked up in a way that allows you to track progress against TOC/RF."}]},{"head":"• So much expectation on Initiative management and equally very little communication with","index":32,"paragraphs":[{"index":1,"size":35,"text":"Center-level staff and processes, which results in things like a huge rush on Center-level library teams, e.g., without them necessarily expecting that. • The TOC link to PRMS was hard to envision before PRMS launched."},{"index":2,"size":39,"text":"• The Genetic Innovations Initiative has developed a simpler process-based model that maps the Initiatives to processes. This is better for communicating to external audiences. • More details on SIDS sheet (e.g., as it was for CRPs (e.g., Policies)."},{"index":3,"size":34,"text":"• Communication and guidance are confusing when managed through the chat function in Microsoft Teams instead of using a clearer, more accessible and structured system. • Clarify who reports end-of-initiative Outcomes and AA Outcomes."},{"index":4,"size":8,"text":"• A focus on quantity instead of quality/relevance."},{"index":5,"size":9,"text":"• Too little space to report Work Package progress."},{"index":6,"size":14,"text":"• Too many details required in the PRMS compared to what was being reported."},{"index":7,"size":24,"text":"• Could batch uploads into PRMS be possible? Data entry result by result is laborious and simply copies the information from our offline templates."},{"index":8,"size":52,"text":"• We focused too much on outputs (publications, capacity development reporting) while we could have invested our researchers' time in reporting better progress against the outcomes (e.g., Are actors changing their behavior? What did we do to make that happen?). • Reporting should be aligned with the TOC, including progress toward outcomes."},{"index":9,"size":12,"text":"• Partnership graphs were wrong and we couldn't use them for reporting."},{"index":10,"size":7,"text":"• The TOC diagrams were poorly formatted."},{"index":11,"size":8,"text":"• Reporting is not aligned to the TOC."},{"index":12,"size":10,"text":"• Need ongoing access to CLARISA to upload partners information."},{"index":13,"size":61,"text":"• Dealing with the evidence, knowledge products -some documents are produced purely for compliance, e.g., workshop reports, and we weren't expecting to have to load these for public viewing in CGSpace. • The use of Scaling Readiness in the reporting is not clear, and it seems overcomplicated. It doesn't help to communicate innovation work with too many passages and unclear meanings."}]},{"head":"How might we improve?","index":33,"paragraphs":[{"index":1,"size":29,"text":"• The timeline needs to be communicated to all stakeholders, not just Initiative staff, but also CGSpace, PRMS, etc. • Clarify the difference(s) between an output and an innovation."},{"index":2,"size":96,"text":"• Innovations at level 6 and above are outcomes -do we report them as innovations and outcomes? • The \"Other\" category: Adding new categories or metadata should have a value. Does it help to manage results? Is it requested by funders? • The RF also needs to consider the overall CGIAR strategy and how global Initiatives, Action Areas, Impact Areas, and Regional Initiatives are supposed to coordinate and link up. • Think more about the \"M\" in \"PRMS\" -How do we better manage the results? • Eliminate the \"Other Output\" category to streamline the reporting process."},{"index":3,"size":9,"text":"• Clarify the difference between \"Other Outputs\" and innovations."},{"index":4,"size":9,"text":"• Ensure Initiatives focus on reporting against their targets."},{"index":5,"size":253,"text":"• Need a tool to create the TOC/RF -should be participatory with scientists, managers and MEL staff. • Evidence versus knowledge product. To report a knowledge product as an output it was supposed to have a meaning to help someone (actor) to change in our TOC. If a knowledge product is just evidence that will not be used, but is included for accountability or evidencing, then there is no need to report it as an output. • Determine (or get guidance on) whether the reporting of certain indicators is more important than others (e.g., we produce lots of research papers -but do funders care about these?). So provide more guidance on where we should invest our time regarding developing and reporting indicators and potentially tag who the indicator principally relays information to (Funders? Initiatives for self-improvement? etc.). • If we are to continue with key results in their present form, there needs to be more guidelines on what defines a key result -Some of us could have reported many more and aggregated less. From use of the key results in the Dashboard and the quality assurance process, it is clear that the key results will be more about quantity than quality. This could take reporting in the wrong direction since it will involve a heavy reporting burden with an inevitable degree of gaming and the atomization of workplans, activities, Initiatives. Would be good to hear how key results are used or perceived by funders and readers. • Include the TOC targets in PRMS."},{"index":6,"size":8,"text":"• Share timelines earlier would be very useful."},{"index":7,"size":14,"text":"• Revive the MEL Community of Practice -which offers peer support, shared templates, etc."},{"index":8,"size":13,"text":"• Illustrate linkages between output/outcome targets and how they feed into AA Outcomes."},{"index":9,"size":14,"text":"• The timeline needs to be managed better -there were so many last-minute requests."},{"index":10,"size":81,"text":"• Can the RF allow better communication of impact against Impact Areas (especially related to gender)? Particularly regarding external communication. • Can results be presented along the TOC in addition to/not as itemized information on a dashboard? • Curious how seriously Initiatives are taking their MELIA studies. Seems optional to have MELIA studies linked to WP and end-of-Initiative outcomes, but if these are not done, then how do we ever measure outcomes? • Rethink the dashboard to help Initiatives take decisions."}]},{"head":"Annex 3: Survey results","index":34,"paragraphs":[{"index":1,"size":4,"text":"Five total submitted responses."},{"index":2,"size":18,"text":"The one/first thing that comes to your mind that you really liked about the Results Framework is ..."},{"index":3,"size":15,"text":"• Well thought out statements and indicators to map to -need to do more of."},{"index":4,"size":16,"text":"• Having a framework and its integration into the systems used -need to do more of."},{"index":5,"size":8,"text":"• Capturing outputs and outcomes -keep as is."},{"index":6,"size":40,"text":"• I suppose this is about reporting? The CGSpace links were very useful and made data entry efficient in PRMS -need to do more of. • Similar indicators to CRPs that helped to be ready for reporting -keep as is."},{"index":7,"size":21,"text":"Any other things that worked well (for you) and why? i.e. we should maintain doing this in the next reporting cycle."},{"index":8,"size":6,"text":"• PRMS was easy to use."},{"index":9,"size":79,"text":"• While working with PRMS, there was no downtime experienced. When assistance was required, technical support promptly responded. The user experience for PRMS reporting and added modules was great, i.e., friendly interface together with a logical and streamlined flow. Center CGSpace focals were proactive in doing internal screening of invalid knowledge products, e.g., non-2022 ones, type matching, etc. It made recording knowledge products more efficient, using handles to harvest metadata, needing only a few more key fields, e.g., mapping."},{"index":10,"size":30,"text":"The one thing that comes to your mind about what is essential that we need to improve is … (all were scored with a 5 = absolutely essential to improve)"},{"index":11,"size":287,"text":"• Need the capacity development indicators, need a tool to use with the Initiative Design Teams to complete and maintain/update the RF, especially Outcomes/Action Areas/Impact Areas/Sustainable Development Goals. • Linking TOC data to reporting, e.g., targets; having space to report annual targets and enforcing that those are done. Less emphasis on KPs and more on contribution towards Outcomes (use of engagement/evidence tool to do this). • Key results diagrams for individual subsections (when put in focus mode) are not optimized, as seen and expected based on the technical report mockup: There is a readability issue for labels, layout of elements, and the overall quality is not good except for the map on national focus contribution. The key results diagrams for individual subsections are not downloadable directly in any photo format. The expectations in the mockup of the technical report are just not met by the capabilities of the PRMS downloadable items. Results by Work Package diagram in Section 4 is the hardest to follow due to the presence of 9 result types, which cannot be readily decide? no output for this type of event, of which there are many. • This is time consuming and there is no clear process for this from the scientist to the Center to the Initiative. What would be dealt with through Center-level processes by a team/unit for anything non-Initiativerelated falls in the lap of Initiative management (1 person). • No formal process for this; it is up to the Initiative Design Teams to develop their own quality reviews; however, Initiatives do not want this to be prescribed … perhaps provide a checklist that we could use, and then QA could also refer to this. • The lead or WP leads decided."},{"index":12,"size":15,"text":"Did you have any outputs that were related to engagement with partners and other stakeholders?"}]}],"figures":[{"text":" Summary results from the survey on detailed questions ....................................................................................... "},{"text":"Annex 1 : Actual discussions ............................................................................................................................. Annex 2: Summary of comments from the Miro board ........................................................................................ "},{"text":" .... Annex 3: Survey results ....................................................................................................................................... The one/first thing that comes to your mind that you really liked about the Results Framework is ... .................. "},{"text":" ... Responses to detailed questions.......................................................................................................................... "},{"text":" No example, but the types of MELIAs should be reviewed. Less choice, remove others, provide guidance on the different types. Did you have any 1 Yes Provide an example  Did you have any1 YesProvide an example difficulties in ... identifying 4 No and how you made  difficulties in ... identifying4 Noand how you made whether certain  the decision.  whether certainthe decision. knowledge products were    knowledge products were MELIA related?    MELIA related? Did you have any 1 Yes Please elaborate on Gender expert reviewed. Did you have any1 YesPlease elaborate onGender expert reviewed. difficulties in ... scoring 4 No the particular  difficulties in ... scoring4 Nothe particular any of your outputs as  challenges.  any of your outputs aschallenges. principal/significant for gender and/or climate? you have Did you have any Respo nses 3 Yes Details on What do you Responses principal/significant for gender and/or climate? you have Did you have anyRespo nses 3 YesDetails on What do youResponses any difficulties difficulties in ... 2 No recommend to  any difficulties difficulties in ...2 Norecommend to (content and editing) of in ... conducting quality reviews  address this issue?  (content and editing) of in ... conducting quality reviewsaddress this issue? outputs that did not    outputs that did not Did you have any receive any quality review 1 yes What were the Cross-Initiative outputs, unexpected outputs, Did you have any receive any quality review1 yesWhat were theCross-Initiative outputs, unexpected outputs, difficulties in ... mapping by a Center or peer- 4 no particular cases and more global-level/generic outputs. difficulties in ... mapping by a Center or peer-4 noparticular cases andmore global-level/generic outputs. some outputs to your review process?  how did you make  some outputs to your review process?how did you make Initiative?  your decision?  Initiative?your decision? Did you have any 2 Yes Which ones and • We kept these mapping clearly to the Did you have any2 YesWhich ones and• We kept these mapping clearly to the difficulties in ... deciding 3 No what did you decide outputs/outcomes. difficulties in ... deciding3 Nowhat did you decideoutputs/outcomes. whether to report certain  to do? • People's participation at events, or being whether to report certainto do?• People's participation at events, or being types of outputs?   speakers, trainers, at trainings, types of outputs?speakers, trainers, at trainings,    conferences, etc. A form of engagement conferences, etc. A form of engagement    that spread the word about Initiative that spread the word about Initiative    activities but unclear/unsure if and how to activities but unclear/unsure if and how to    report. report. Did you have any 2 Yes Which were • Events with partners like stakeholder Did you have any2 YesWhich were• Events with partners like stakeholder difficulties in ... identifying 3 No particularly consultation/workshop/policy dialogue that difficulties in ... identifying3 Noparticularlyconsultation/workshop/policy dialogue that the appropriate type of  challenging and are not capacity development but the appropriate type ofchallenging andare not capacity development but output for some outputs?  what did you stakeholder engagement -no output for output for some outputs?what did youstakeholder engagement -no output for   decide? this type of event, of which there are many. decide?this type of event, of which there are many.    • Innovations and outputs have similar • Innovations and outputs have similar    definitions in the CGIAR Glossary and they definitions in the CGIAR Glossary and they    may require an update. For example, GIZ may require an update. For example, GIZ    identifies innovation only when an output is identifies innovation only when an output is    put into use. put into use. Results Framework FGD Workshop Report: 10 Results Framework FGD Workshop Report:10 A focus group discussion on the Results Framework process  A focus group discussion on the Results Framework process  "},{"text":" • Need an equivalent of CGSpace to report capacity building events in real time. Was there a suggestion to keep PRMS open all year so as to capture key results or capacity building events in real time? • Define mechanisms for reporting to further help protect Initiatives from donors' micromanagement. Assess concrete examples around whether reporting had a gap and the donor rightly asked for some information. • Offline templates are needed. • Improve FAIR scoring for outputs. • How do we report stakeholders' engagement as part of co-creation, TOC development, etc.? • Need a Dashboard for the RF/Plan of Results and countries. There is no way to know what Initiatives are planning! Or who is working in which countries and on what. • Scaling Readiness should be simplified. • Tools for day-to-day Initiative management and tracking progress against PORB/TOC • Can OST and TOC board concepts be retired now? Data entry output by output, with boxes inside boxes and no offline version, is painful. Only the Initiatives themselves ever see the TOC board and there is no need to look. Questions required also not relevant anymore, e.g. indicator type, since in practice as we saw for 2022, many result types (KP, capacity development, etc.) are reported under a single output. Batch uploading of the RF/TOC across all areas (outputs, outcomes, AA outcomes, IA outcomes, Sustainable Development Goals) could be worked out a different way.  "},{"text":" • Innovations and outputs have similar definition in the CGIAR Glossary and it may requires updating. For example, GIZ identifies innovation only when an output is put into use.No example, but the types of MELIAs should be reviewed, offering less choice; remove \"other outputs\" and provide guidance on the different types. Did you have any 1 Yes Provide an example  Did you have any1 YesProvide an example difficulties in ... identifying 4 No and how you made  difficulties in ... identifying4 Noand how you made whether certain  the decision.  whether certainthe decision. knowledge products were    knowledge products were MELIA related?    MELIA related? Did you have any 1 Yes Please elaborate on Gender expert reviewed. Did you have any1 YesPlease elaborate onGender expert reviewed. difficulties in ... scoring 4 No the particular  difficulties in ... scoring4 Nothe particular any of your outputs as  challenges.  any of your outputs aschallenges. principal/significant for    principal/significant for gender and/or climate?    gender and/or climate? Did you have any 3 Yes What do you  Did you have any3 YesWhat do you difficulties in ... 2 No recommend to  difficulties in ...2 Norecommend to conducting quality reviews  address this issue?  conducting quality reviewsaddress this issue? (content and editing) of    (content and editing) of outputs that did not    outputs that did not receive any quality review    receive any quality review by a Center or peer-    by a Center or peer- review process?    review process?  "}],"sieverID":"3d6ae27b-bd0f-4d14-883f-ff2e2555644f","abstract":""}

data/part_1/0903b1e99dcf40ef97de2991cca8c926.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0903b1e99dcf40ef97de2991cca8c926","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/101dffaf-a659-4a1a-b301-a8f30eb639ff/retrieve"},"pageCount":8,"title":"Exploring interactions between farmgate, markets, and consumers. Initial insights from a high-frequency integrated market survey in Bangladesh","keywords":[],"chapters":[{"head":"PRELIMINARY FINDINGS","index":1,"paragraphs":[{"index":1,"size":166,"text":"1. The TAFSSA Integrated Market Survey comprehensively investigates the intricate interactions within the local food system, focusing on the relationships between agricultural plots, farm gates, markets, and consumers. 2. A significant proportion, approximately three-quarters, of the farmers surveyed reported no sales of their produce during the period from August to October 2023. Among those who did sell their produce, the sale of groundnuts and animal-based products was notably prevalent. 3. The survey identified local farm-gate traders as the predominant purchasers of agricultural produce within the study area. 4. The practice of directly selling agricultural products to consumers and vendors in local villages and markets was observed to significantly influence the dietary composition within these communities, at least at a village level. 5. A high frequency of purchases of animal products (such as eggs, poultry, meat, and fish), green leafy vegetables, and dal, coupled with a low frequency of purchasing deep-fried foods, offers preliminary evidence suggesting the prevalence of relatively healthy dietary patterns in the study areas."}]},{"head":"BACKGROUND","index":2,"paragraphs":[{"index":1,"size":123,"text":"The dominance of agribusinesses, food retailers, manufacturers, and food service firms in the food chains exerted a changing influence on retail food commodity markets, in turn contributing to a re-shaping of market dynamics (Popkin et al., 2020). This transformation is particularly relevant to subsistence farming, local consumption patterns, and the degree of profitability experienced by farmers. As the dominant players in the food chain tend to prioritize efficiency and profit, they may overlook the needs and sustainability of small-scale farmers, leading to a widening gap between commercially-oriented agriculture and subsistence farming. Additionally, the concentration of power in the hands of a few market actors can lead to unfair pricing practices and limited choices for consumers, further exacerbating the challenges faced by farming communities."},{"index":2,"size":42,"text":"Understanding the complex dynamics of market accessibility and farmers' choices regarding sales channels is essential for obtaining insights into agricultural value chains. In recent decades, researchers have emphasized integrating smallholder farmers into these value chains (German et al., 2020;Ros-Tonen et al., 2015)."},{"index":3,"size":159,"text":"The core focus of this study is the acknowledgment that farmgate pricing and market prices are crucial in forming the broader food supply chain. These factors significantly affect consumers' food purchasing and consumption habits. Comprehending the relationship between farmgate pricing and market prices is vital for assessing the economic viability of smallholder farming, as well as its influence on food security and nutrition outcomes (Molitor et al., 2017;Woodhill et al., 2022). Furthermore, analyzing consumers' food purchasing and consumption habits offers valuable perspectives on how market prices affect consumer choices and preferences. This analysis shapes the demand for agricultural products, as detailed by Ali et al. (2010). The setting of farmgate prices by producers directly influences their revenue and profitability. This impact, in turn, affects vital decisions regarding crop selection, production practices, and the sustainability of agriculture. On the other hand, consumers, influenced by market rates determined by supplyand-demand dynamics, pay prices that mirror the broader economic forces in operation."},{"index":4,"size":97,"text":"Addressing these concerns, this research focuses on the role of pricing mechanisms in agricultural and consumer markets, and their impact on altering farmers' behavior and crop production choices. The primary aim is to improve market efficiency, guarantee fair compensation for farmers, and aid in the development of sustainable food systems. This study is distinctive in its use of high-frequency data collection techniques, offering a detailed and real-time perspective. Contrasting with conventional periodic methods, this approach delivers a dynamic representation of the constantly changing agricultural and consumer landscape, thus enhancing the depth and accuracy of the study's conclusions."}]},{"head":"OBJECTIVES","index":3,"paragraphs":[{"index":1,"size":17,"text":"This study aims at uncovering insights regarding pricing mechanisms and consumption patterns in farm and consumer markets."},{"index":2,"size":48,"text":"In particular, itexamines the temporal distribution of food prices from farmgate to other existing markets to investigate whether there are any high-price zones or areas where production or cropping systems aligned with the marketing system. It also explores the patterns of food purchasing and consumption of local consumers."}]},{"head":"DATA AND METHODS","index":4,"paragraphs":[{"index":1,"size":32,"text":"Our study area includes Rajshahi, Chapai Nawabganj, Rangpur, and Dinajpur districts in Northern Bangladesh, where TAFSSA's participatory research where farmers test varied agronomic, market, and nutrition innovation bundles through structured multi-year studies."}]},{"head":"Integrated household survey","index":5,"paragraphs":[{"index":1,"size":76,"text":"Respondents to the TAFSSA integrated household (HH) survey include a total of 100 farmers from 12 villages in the four districts mentioned above. In the eight villages where on-farm texting of innovation bundles are bring carried out, five farmers and five non-trial farmers were selected. In the other four control villages, where no testing of innovation bundles is taking place, five farmers each have been selected. The respondents of both production and consumption modules are same."}]},{"head":"Market survey","index":6,"paragraphs":[{"index":1,"size":46,"text":"In the area surrounding of these villages, 26 markets have been identified (Table 1). In each marketplace 6-7 vendors were selected to cover sentinel food items, with particular focus on cereals, pulses, vegetables and fruits. In total 168 vendors are the respondents of this market survey."}]},{"head":"Sample","index":7,"paragraphs":[{"index":1,"size":33,"text":"The data for this brief is from the first six waves of high-frequency data collection for both farmers and vendors. Table summarizes the type of markets, respondents and sample size of the surveys."},{"index":2,"size":35,"text":"We used the CAPI tool to collect data 1 . High-frequency data collection started on August 6, 2023, and is repeated every two-weeks.  Note that only 26% of farmers did sell produce during this period."}]},{"head":"Location","index":8,"paragraphs":[]},{"head":"PRELIMINARY RESULTS","index":9,"paragraphs":[{"index":1,"size":37,"text":"Figure 1 presents an overview of the proportion of different food items that were sold by farmers between August and October 2023. During this period, a substantial proportion (74%) of farmers did not engage in any sales."},{"index":2,"size":136,"text":"Considering the remaining 26% of farmers who sold their produce, rice, wheat, maize, and mustard combined contributed to 14.54% of the total frequency of food sales. Groundnut sales contributed substantially (29.80%) to the market participation during this time period. Farmers' sales portfolios have a low representation of pulse crops, with lentil accounting for only 0.62%. This likely reflects the unseasonable time in which data were collected as pulses would be sold earlier in the year. Poultry and eggs account for a noteworthy proportion of sales (9.32% and 5.59%, respectively). Milk, derived from diverse sources such as cows, buffaloes, and goats, contributes to 14.28% of observed sales, highlighting the significance of dairy farming in these areas. Potatoes (6.85%), fish (0.62%), pumpkin (1.24%), green leafy vegetables (0.62%), brinjal (8.09%), banana (3.1%), and other fruits (4.3%) are also sold."},{"index":3,"size":48,"text":"Figure 2 shows who buys the produce from farmers, including the most prominent market participants and the primary channels through which farmers sell their commodities. More than three-fifth of farmers sell their farm produce to local traders, \"Bepari\". 11.76% sell their products directly to village neighbor consumers (households)."},{"index":4,"size":28,"text":"Only a few farmers (2.35%) sell directly to millers or processing plants. Conversely, more than one-fifth (21.76%) of farmers sell their products to vendors at the local markets."},{"index":5,"size":35,"text":"A small fraction (2.94%) opted for vendors located in other markets. This suggests that a substantial proportion of farmers are supplying their agricultural products to local markets, contributing to the food demand of local communities."},{"index":6,"size":24,"text":"More than 97% of farmers surveyed sell at either farmgate (42.94%) or weekly open markets called haats (35.29%) or village-level markets (18.82%) (Figure 3)."},{"index":7,"size":27,"text":"Respondents indicated that farmgate sales are considered easy and straightforward. This attributes to the prominence of local traders ('Bepari') in agricultural marketing in These districts of Bangladesh."},{"index":8,"size":260,"text":"Figure 4 highlights the purchasing habits of consumers for different food or food groups. Purchase frequency of protein rich animal source foods such as eggs and fish are very high (70% and 90% consumers reported buying eggs and fish at least once in a week, respectively). Interestingly significant proportion (about two-fifth) did not purchase deep fried foods, and a onefifth did not buy biscuits, however if bought these products are more often purchased at a higher frequency (more than once a week for ~30% of the respondents). Bananas were also not purchased by more than one-fifth of the respondents, though this is lilely due to seasonality of the survey. The majority of consumers (80%) bought green leafy vegetables at least once a week and only 10% did not. Dal is another food more frequently purchased -several consumers resort to multiple purchases, or use homemade, gifted, or saved sources (25.8%).   Figure 5 illustrates that the household diet encompasses a range of foods, deriving nutrients from diverse sources and including both healthy and unhealthy options. The respondents regularly consume staples such as rice, potatoes, onions, other vegetables, fruits, fish, eggs, as well as tea/coffee, biscuits, and baked sweets. There is a high consumption of healthy foods like onions, fruits, eggs, fish, and poultry. However, it is noted that several consumers did not include vegetables other than onions and milk in their diet during the recall period. On a positive note, a significant proportion of consumers avoided deep-fried foods and other unhealthy options, such as soft drinks and sweetened juices, during this period."}]},{"head":"PRELIMINARY CONCLUSIONS","index":10,"paragraphs":[{"index":1,"size":93,"text":"1. Only 26% of the producers sold any of their produce between August and October 2023. 2. Local traders, 'Bepari', are the most dominant buyers of agricultural produce and farmers most frequently sell their produce at the farmgate followed by at haats and village markets. 3. High purchasing frequency of animal source foods (eggs, poultry meat and fish), green leafy vegetables and dal as well as low frequency of deep-fried foods purchases indicates the potential for healthy diets.  To learn more, please contact: [email protected] To learn more about TAFSSA, please contact: [email protected]; [email protected]"}]}],"figures":[{"text":"Figure 1 : Figure 1: Frequency of food sales by farmers in the 1st quarter of the highfrequency market survey in Northern Bangladesh (August to October 2023).Note that only 26% of farmers did sell produce during this period. "},{"text":"Figure 2 : Figure 2: Distribution of buyers of agricultural products form farmers. "},{"text":"Figure 3 : Figure 3: Distribution of selling place of agricultural products by farmers. "},{"text":"Figure 4 . Figure 4. Consumers food purchasing patterns depicted by percentage of the total sample survey. Note that \"Used own produce\" also includes the use of gifted produce. "},{"text":"Figure 5 . Figure 5. Average percent food consumption frequency for different foods (seven days recall period). Note that in the category \"vegetables\" tomato, orange fleshed vegetables and green leafy vegetables are included. The category \"snacks\" includes deep fried foods, instant noodles and chips. "},{"text":"  "},{"text":"Respondent type Key modules Sample size  Household (HH) Farmer produce sale, food shopping, food consumption 100 Household (HH)Farmerproduce sale, food shopping, food consumption100 Village market Vendor  31 Village marketVendor31 Haats Vendor vendor characteristics, food 59 HaatsVendorvendor characteristics, food59 Upzilla market Vendor sourcing, price 50 Upzilla marketVendorsourcing, price50 Zilla market Vendor  28 Zilla marketVendor28  "},{"text":"Table 1 . Survey details (where, who, what and sample size).  "},{"text":" We would like to thank all funders who supported this research through their contributions to the CGIAR Trust Fund: https://www.cgiar.org/funders/ SUGGESTED CITATION Kabir, A.N.M.F., Cheesman, S., Chowdhury, S., Ahmed, S., Miajy, A.A., Ali M.J., Islam, M.S., Kurishi, A., Krupnik, T.J., Veettil, P.C. 2023. Exploring interaction between farmgate, markets and consumers: Initial insights from a high frequency integrated market survey in Bangladesh. Research Note 22,. CGIAR research initiative on Transforming Agrifood Systems In South Asia (TAFSSA). International Maize and Wheat Improvement Center. Dhaka, Bangladesh. TAFSSA (Transforming TAFSSA (Transforming Agrifood Systems in South Agrifood Systems in South Asia) is a CGIAR Regional Asia) is a CGIAR Regional Integrated Initiative that Integrated Initiative that supports actions improving supports actions improving equitable access to equitable access to sustainable healthy diets, sustainable healthy diets, that boosts farmers' that boosts farmers' livelihoods and resilience, livelihoods and resilience, and that conserves land, air, and that conserves land, air, and water resources in a and water resources in a climate crisis. climate crisis. ABOUT CGIAR ABOUT CGIAR CGIAR is a global research CGIAR is a global research partnership for a food secure partnership for a food secure future. Visit future. Visit https://www.cgiar.org/research/ https://www.cgiar.org/research/ cgiar-portfolio to learn more cgiar-portfolio to learn more about the initiatives in the about the initiatives in the CGIAR research portfolio CGIAR research portfolio The views and opinions The views and opinions expressed in this publication expressed in this publication are those of the author(s) and are those of the author(s) and are not necessarily are not necessarily representative of or endorsed representative of or endorsed by CGIAR, centers, our partner by CGIAR, centers, our partner institutions, or donors. institutions, or donors. This publication is licensed This publication is licensed for use under a Creative for use under a Creative Commons Attribution 4.0 Commons Attribution 4.0 International License (CC BY International License (CC BY 4.0). 4.0).  "}],"sieverID":"e8f963b2-1fa6-43b7-9149-91db9d51a29c","abstract":"This research note presents initial findings from a high-frequency market survey conducted in four districts of Northern Bangladesh. The survey examines price fluctuations from farmgate to market, food production diversification, and consumer dietary choices from August to October 2023 in the Rajshahi, Chapai Nawabganj, Rangpur, and Dinajpur Districts, which are part of TAFSSA's learning landscape locations. High-frequency data collection has occurred biweekly six times thus far and continues. Future analyses and research will delve into price transformations following the sale of diversified crops in which farmers are participating in experiments. This research note is based on six rounds of data collection and offers preliminary insights into how farmers contribute to and benefit from a sustainable food supply chain in these regions."}

data/part_1/092d1be5f168f5c0066489cc064a3371.json

@@ -0,0 +1 @@
+{"metadata":{"id":"092d1be5f168f5c0066489cc064a3371","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1c40c2f3-9f0a-4332-87e4-a1ad501cee17/retrieve"},"pageCount":12,"title":"Expressed Centromere Specific Histone 3 (CENH3) Variants in Cultivated Triploid and Wild Diploid Bananas (Musa spp.)","keywords":["CENH3","splice variants","genotype","centromere","histones","banana"],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":229,"text":"Centromeres are assembly sites for the kinetochore, a protein complex that connects chromosomes to spindle fibers during meiosis and mitosis. The structure, size, and distribution of centromeres differ with species in spite of their common function (Talbert et al., 2004). Centromeres in both plants and animals often contain arrays of rapidly evolving tandemly repeated DNA sequences (Gent et al., 2011;Verdaasdonk and Bloom, 2011). The high rate of evolution in these repeats is remarkable given the fact that the function of centromeres is highly conserved. The role of the repeats is a subject of debate with the most common proposition being that they maintain the large heterochromatic domains associated with centromeres (Malik and Henikoff, 2009;Black and Cleveland, 2011). It is reported that CENH3 [aka Centromere Protein A (CENP-A) in humans and CID in drosophila] epigenetically determines and maintains centromeres (Malik and Henikoff, 2001;Dawe and Henikoff, 2006;Ekwall, 2007;Allshire and Karpen, 2008;Fachinetti et al., 2013). CENH3 contains a highly variable N-terminal tail and a relatively conserved histone fold domain (HFD) (Ravi et al., 2010;Lermontova et al., 2014). The majority of diploid plant species have been shown to encode a single CENH3 gene (Zhong et al., 2002). However, more than one copy (alpha and beta) of the gene per genome are present in some species like wheat, barley, Arabidopsis halleri and A. lyrata (Kawabe et al., 2006;Sanei et al., 2011;Yuan et al., 2015)."},{"index":2,"size":215,"text":"The majority of cultivated bananas exist as allo-or autopolyploids and a variety of CENH3 isoforms are presumed to coexist in the nucleus. Polyploidization brings together multiple gene copies within the same background and can result in additive or non-additive gene expression leading to biased or unbiased homeolog expression (Pignatta and Comai, 2009;Hui et al., 2010;Rapp et al., 2010;Yoo et al., 2013). Unlike many diploid species where a single copy of CENH3 gene is encoded, multiple copies have been observed in newly synthesized allopolyploids of rice, wheat, brassica, and pea (Hirsch et al., 2009;Hui et al., 2010;Wang et al., 2011;Neumann et al., 2012;Yuan et al., 2015). CENH3 variants have also been characterized in wild and cultivated carrots (Dunemann et al., 2014) and in stable polyploids of different angiosperms (Masonbrink et al., 2014). Multiple CENH3 copies observed in polyploids might result from coming together of single-CENH3expressing genomes or multiple-CENH3 expressing progenitor genomes. Crosses of diploid parents encoding multiple CENH3 transcripts have resulted in stable hybrids. For example, in stable hybrids from Hordeum vulgare × H. bulbosum crosses, both alpha and beta CENH3 variants from H. vulgare were incorporated into the centromeric nucleosomes of the hybrid. In contrast, a hybrid of H. bulbosum × Triticum aestivum incorporated the H. bulbosum CENH3 variant HbαCENH3 only (Sanei et al., 2011)."},{"index":3,"size":244,"text":"Unlike stable hybrids, embryos derived from unstable crosses have been observed to undergo uniparental genome elimination, resulting in haploids carrying genetic material from only one parent (Ravi and Chan, 2010;Sanei et al., 2011;Seymour et al., 2012;Maheshwari et al., 2015). The genome of H. bulbosum in embryos from H. vulgare × H. bulbosum crosses for example was completely lost within 5-9 days post-fertilization. Despite elimination of the H. bulbosum genome later in post-zygotic mitosis, H. vulgare × H. bulbosum unstable crosses have been observed to transcribe CENH3 transcript variants from both parents (Sanei et al., 2011). In A. thaliana, uniparental genome elimination was also observed in offspring from crosses between mutant 'haploid inducer' (parent with modified CENH3) and wild-type (carrying wild-type CENH3 version) (Ravi and Chan, 2010). The modification of CENH3 in this case was generated by replacing the N-terminal tail with that of the variant H3.3 and tagging it with GFP. Apart from obtaining haploids in these crosses, novel genetic rearrangements were observed (Maheshwari et al., 2015). Currently, there are efforts undergoing to transfer this technology to many crops including banana (Comai, 2014). Crosses of A. thaliana null-mutants carrying gene constructs expressing CENH3 from distant species to plants wildtype for CENH3 have also resulted in haploids (Maheshwari et al., 2015). Furthermore, uniparental genome elimination has been observed in crosses of wild-type A. thaliana plants to null mutants complemented with CENH3 carrying missense point mutations in conserved regions of the HFD (Kuppu et al., 2015)."},{"index":4,"size":112,"text":"Banana breeding involves crossing of tetraploids to diploids to give triploids and this may add into the complexity of the space CENH3 exists. Therefore, it would be interesting and useful to understand CENH3 dynamics in cultivated polyploids and their diploid progenitors. Furthermore, a clear understanding of CENH3 behavior in cultivated crops like banana is essential if breeding tools such as CENH3-based haploid technology are to be effectively applied (Britt and Kuppu, 2016). Therefore, in this study the expression of CENH3 was characterized in cultivated triploid and wild-type diploid progenitor bananas. The existence and evolutionary relationships of CENH3 SNPs and/or splice variants as well as their predicted secondary folding of protein were analyzed."}]},{"head":"MATERIALS AND METHODS","index":2,"paragraphs":[]},{"head":"Plant Materials","index":3,"paragraphs":[{"index":1,"size":55,"text":"Six banana genotypes including wild diploids 'Calcutta 4' (AA) and 'Zebrina GF' (AA) both from the species Musa acuminata, the species M. balbisiana (BB) and cultivated triploids 'Sukali Ndiizi' (AAB), 'Pisang Awak' (ABB) and 'Gros Michel' (AAA) were used in this study. All plant materials used were obtained from in vitro collection at IITA Kenya."}]},{"head":"Identification of Genomic Sequence of Banana CENH3","index":4,"paragraphs":[{"index":1,"size":169,"text":"To identify putative genomic sequence of banana CENH3, a nucleotide BLAST (BLASTN) analysis was performed using genomic sequence of A. thaliana CENH3 (At1g01030) against the whole-genome shotgun contigs (wgs) of M. acuminata (tax id: 4641) for \"somewhat similar sequences\". In order to identify the exact genomic region of CENH3, consensus sequences from conserved regions at the beginning and end of selected monocot CENH3 CDSs were mapped to the BLASTN hit results. The conserved consensus, which we considered as representative CENH3 'landmark' regions for monocots, were obtained by aligning sequences of CENH3 from the monocots Zea mays (NM_001112050), H. vulgare (JF419328), T. aestivum (JF969285.1) and Oryza sativa (AY438639.1). To identify the genomic regions of the CENH3 from M. acuminata, BLASTN hits, we mapped the CENH3 'landmarks' and regions with >75% nucleotide identities were selected. The primers CENH3_END_F (GGCGAGAACGAAGCATC) and CENH3_END_R (TCACCAATGTCTTCTTCCTCC) were designed to amplify the CDS (from the beginning to the end of the coding region) derived from in silico analysis of the putative banana genomic sequence (Accession: CAIC01023700)."}]},{"head":"RNA Extraction and RT-PCR","index":5,"paragraphs":[{"index":1,"size":104,"text":"Total RNA was extracted from 100 mg of young incompletely open leaves. Extraction was performed using RNeasy R plant mini kit (Hilden, Germany) as per the manufacturer's protocol except for the elution volume which was reduced to 40 µl. Genomic DNA contamination was removed from the extracted RNA through DNase I (Thermo Scientific, Waltham, MA, United States) treatment by incubating at 37 • C for 30 min and then terminating the reaction by adding 1 mM EDTA and heating at 70 • C for 5 min. RNA quality and quantity were checked using a NanoDrop TM 2000 (Thermo Scientific, Waltham, MA, United States) spectrophotometer."},{"index":2,"size":41,"text":"First strand cDNA was synthesized from 1 µg of DNA-free total RNA with random hexamer primers using maxima first strand reverse transcriptase kit (Thermo Scientific, Waltham, MA, United States). Two independent cDNA synthesis reactions were performed for each of the genotype."},{"index":3,"size":192,"text":"The CENH3 transcripts were amplified from cDNA in a total of six PCR reactions (three reactions for each of the two cDNA synthesis) per genotype. Each PCR reaction was performed in a 20 µl volume, which contained 50 ng of cDNA template, 1x Q5 reaction buffer containing 2.5 mM MgCl 2 , 500 µM of each dNTP, 10 µM each of CENH3 primers (CENH3_END_F and CENH3_END_R) and 1unit of Q5 high fidelity DNA polymerase (New England Biolabs, MA). The reactions were performed in an ABI 9700 PCR machine with the conditions set at initial denaturation of 98 • C for 4 min, 35 cycles of 98 • C for 15 s, 66 • C for 30 s and 72 • C for 45 s and a final extension at 72 • C for 10 min. An aliquot of PCR product (2 µl) was run on a 1.5% agarose gel stained with GelRed (Biotium, CA) to confirm amplification. For PCR reactions in each genotype that had observable band(s) on agarose gel, the remainder (18 µl) PCR product was purified using Bioneer PCR purification kit (Daeongeon, South Korea) and eluted in 15 µl water."}]},{"head":"Cloning and Sequencing of CENH3 Genes","index":6,"paragraphs":[{"index":1,"size":165,"text":"Purified PCR products were cloned into pJET 1.2 cloning vector (Thermo Scientific, MA) and transformed into competent Escherichia coli (DH5α) cells using heat shock method. The transformed E. coli colonies were selected on Luria Bertani (LB) agar (10 g/l Tryptone, 5 g/l Yeast extract, 10 g/l NaCl, 15 g/l Agar, pH 7.5) containing 50 mg/L ampicillin. One to 10 transformed colonies from each PCR reaction were screened for presence of the insert by colony-PCR. A maximum of 60 colonies were screened for each genotype. The primer pairs pJET 1.2_F: CGACTCACTATAGGGAGAGCGGC and pJET 1.2_R: AAGAACATCGATTTTCCATGGCAG were used for colony PCR. Colonies with amplicon sizes >200 bp were cultured in LB broth medium overnight at 37 • C and plasmid DNA extracted using Qiagen plasmid miniprep kit. Each clone with product >200 bp was sequenced bi-directionally in three replicates using the primers pJET 1.2_F and Pjet 1.2_R. Sequencing was performed on ABI 3130 analyzer (Applied Biosystems, Foster City, CA, United States) using BigDye Terminator Kit version 3.1."}]},{"head":"Sequence Analysis and Multiple Alignments","index":7,"paragraphs":[{"index":1,"size":89,"text":"Sequences were analyzed in Geneious version 7.1 (Biomatter, NZ) (Kearse et al., 2012) by manually checking the quality of the chromatograms. Sequences with quality above 50% (based on Phred values) across the entire sequence length were used for analysis. Sequences were further screened and 'dirty' sections at the ends were manually trimmed to retain only high quality regions. Sequences within any of the six genotypes that were independently derived (those obtained from amplification of independently synthesized cDNA transcripts) and had 100% similarity were considered to represent the same transcript."},{"index":2,"size":74,"text":"Multiple alignments of amino acids were conducted among translated banana CENH3 sequences and monocots (Z. mays, T. aestivum, O. sativa, and H. vulgare) and dicots (A. thaliana and Brassica rapa) in MUSCLE as implemented in Geneious version 7.1 using default parameters. Phylogenetic trees comparing transcript sequences were drawn in the software \"Molecular and Evolutionary Genetic Analysis\" (MEGA) version 6.0 (Tamura et al., 2013) based on only the conserved tail sections and entire HFD region."}]},{"head":"Identification of Exon/Intron Structures","index":8,"paragraphs":[{"index":1,"size":55,"text":"Since the banana CENH3 from the genotypes used in this study had not been sequenced previously, splicing patterns for the transcript sequences were predicted by aligning them to the then available banana genomic sequence (accession number: CAIC01023700 positions 70772 to 76310) from M. acuminata genotype 'DH Pahang' using the program Splign (Kapustin et al., 2008)."}]},{"head":"Protein Structure Modeling","index":9,"paragraphs":[{"index":1,"size":65,"text":"Secondary structures of proteins were predicted using the original Garnier Osguthorpe Robson algorithm (GOR I) provided by the European Molecular Biology Open Software Suite (EMBOSS) 6.5.7 (Rice et al., 2000) and implemented in Geneious version 7.1.9 as garnier tool (Kearse et al., 2012). Predicted protein structures from transcripts of different length, SNP and splice were visually compared to determine any variation in their secondary folding."}]},{"head":"RESULTS","index":10,"paragraphs":[]},{"head":"Identification of Genomic Sequence of Banana CENH3","index":11,"paragraphs":[{"index":1,"size":150,"text":"To identify CENH3 genomic sequence from completely sequenced banana genome [doubled haploid (DH) genotype 'DH Pahang' ('Malaccensis' group)] (Hont et al., 2012), a BLASTN was performed for 'somewhat' similar targets using A. thaliana CENH3 to query M. acuminata whole-genome contigs. This search resulted in a total of 46 hits (Additional File S1). To identify the exact banana CENH3 genomic region(s), conserved consensus sequences at the beginning (ATG GCSMGMACSAAGCAYCCGGCSGTGMGSAARAGC) and end (GCAAGGCGWATMGGAGGRAGRAGRCATTGGTGATGA) of CENH3 CDSs from four monocotyledonous plants (rice, maize, barley, and millet), referred as monocot CENH3 'landmarks' , were searched within the 46 BLASTN hits. A search for these consensus sequences within the 46 BLASTN hit revealed an 82 Kb contiguous sequence (GenBank accession number: CAIC01023700) as containing the putative banana CENH3 genomic region. The exact location of the sequence within the 82 Kb contig CAIC01023700 was from positions 70772 to 76310 resulting in a 5538 bp long sequence."}]},{"head":"Banana CENH3 Sequences and Expressed Variants","index":12,"paragraphs":[{"index":1,"size":208,"text":"In an effort to identify banana CENH3 transcripts in each of the six banana genotypes, PCR products from amplification of cDNA template obtained from two independent synthesis reactions were cloned and sequenced. One to seven unique transcripts were obtained per genotype by sequencing of the multiple clones. The multiple clones sequenced were derived from three independent PCR amplifications of the two cDNA templates for a maximum of six reactions per genotype (Table 1). The genotype 'Calcutta 4' and 'M. balbisiana' had only one unique sequence each, where as 'Gros Michel' and 'Pisang Awak' had two unique sequences, 'Zebrina GF' had four and 'Sukali Ndiizi' had seven unique sequences (Table 1). All unique cDNA sequences from this study were deposited in GenBank (Table 1). The transcripts obtained were of variable lengths (471, 477, 504, 591, and 760 bp). The open reading frames of the cDNA sequences encoded proteins of about 156-167 amino acids. The CENH3 sequence from 'Calcutta 4' (KT600803) was used as a reference as it had 100% identity to the exons of the publicly available genomic sequence of banana genotype 'DH Pahang' (GenBank accession number CAIC01023700 position 70772 to 76310). The protein translation of the 'Calcutta 4' cDNA sequence resulted in a 167 amino acid long protein."},{"index":2,"size":297,"text":"Based on similarity of conserved cDNA regions (partially in the tail and entire HFD region), the CENH3 sequences were clustered into three major groups denoted as MusaCENH3-1A (transcripts of M. balbisiana-10, Gros Michel-2, Pisang Awak-4) MusaCENH3-1B (Gros Michel-1, Zebrina GF-6, 7, and 8, Calcutta 4-11, Pisang Awak-5, and Sukali Ndiizi-A, F, G and H) and MusaCENH3-2 (Sukali Ndiizi-B, C and E and Zebrina GF-9) (Figure 1 and Table 1). The transcripts within each group had slight variations mainly less than two SNPs. The first two groups (MusaCENH3-1A and MusaCENH3-1B) differed from MusaCENH3-2 with a C to G substitution within the HFD α-2 helix region that resulted in alanine (A) to proline (P) substitution in the later. In addition to this HFD SNP, transcripts in MusaCENH3-2 group consistently had a 46 bp longer exon 1 than MusaCENH3-1A and MusaCENH3-1B and also lacked extra two exons (exons 2 and 3), which were otherwise present in MusaCENH3-1A and MusaCENH3-1B groups. The 46 bp extra length in exon 1 as well as lack of exons 2 and 3 in MusaCENH3-2 suggests that this is a different type of CENH3 in bananas. However, since we did not sequence the whole genome of the genotypes used in this study, we cannot definitively prove that the missing exons or 46 bp extension are indeed different genes or splice variants (as suggested by alignment to the published sequence), but this seems likely and we will refer to them as such. There were also multiple SNPs within transcripts of each CENH3   group, majority of which were within the HFD (Figures 2, 3). In comparison to CENH3s from other monocots and dicot species, banana sequences were observed to be highly variable within the tail region and conserved only in the loop 2 of the HDF (Figure 2)."},{"index":3,"size":72,"text":"The MusaCENH3-1A and MusaCENH3-1B groups were more similar to each other in both sequence and splicing in comparison to transcripts in group MusaCENH3-2. The MusaCENH3-1A and MusaCENH3-1B transcripts differed at five SNP sites (Figure 3), which resulted in one non-synonymous amino acid substitution (Figure 2). The MusaCENH3-1A was observed in both A and B genomes. The genotypes 'Zebrina GF' and 'Sukali Ndiizi' had the highest number of SNP variants observed (Table 2)."},{"index":4,"size":95,"text":"These three banana CENH3 groups differed in the number of exons as identified by alignment to the genomic sequence obtained through BLASTN analysis (CAIC01023700 position 70772-76310). The alignment confirmed that MusaCENH3-1A and MusaCENH3-1B have seven exons whereas MusaCENH3-2 had five exons with exemptions of specific cases that differed due to exon skipping or intron retention. The MusaCENH3-1A and MusaCENH3-1B transcripts were 471 bp to 760 bp long while those in the MusaCENH3-2 group were 471 bp long. The three CENH3 groups had few SNPs among them that were observed mainly in transcripts from different genotypes."},{"index":5,"size":121,"text":"To check the homology of banana CENH3 proteins to those of other plant species, banana translated protein sequences were aligned to monocot (T. aestivum, O. sativa, and Z. mays) and dicot species (A. thaliana and B. rapa). This alignment resulted in conserved αN-helix, α1-helix, α2-helix and α3-helix of the C-terminal, a specific loop 1 and a highly variable N-terminal tail (Figure 2). The loop 1 and α2-helix of the C-terminal constitute the CENP-A targeting domain (CATD) and these two domains were found to be conserved in banana sequences except for two amino acid substitutions within the α2-helix in the sequences M. balbisiana-10 (alignment position 144) and Sukali Ndiizi-B, C, and E and in the Zebrina GF-9 (alignment position 134) (Figure 2)."}]},{"head":"Variants in Autotriploid Genotype 'Gros Michel'","index":13,"paragraphs":[{"index":1,"size":138,"text":"'Gros Michel' had two variable and unique sequences as grouped in MusaCENH3-1A (Gros Michel-2) and MusaCENH3-1B (Gros Michel-1). Over and above having the five SNPs that differentiated MusaCENH3-1A from MusaCENH3-1B, the transcript Gros Michel-1 had an 87 bp indel that resulted from retention of intron 2 and spanned alignment positions 133 to 219 (Figure 3A). This retained intron resulted in a frame shift and introduced a premature stop codon in the tail region (nucleotide position 219) rendering it non-functional. The transcript Gros Michel-2 differed to Calcutta 4 at nine SNPs and out of these, six were in the tail region. Two (alignment positions 105 and 276) out of six SNPs in the tail were synonymous substitutions. The other four SNPs were aligned at positions 244, 246, 247, and 277 resulted in a total of three amino acid substitutions."}]},{"head":"Variants in Allotriploid Genotype 'Pisang Awak'","index":14,"paragraphs":[{"index":1,"size":116,"text":"The allotriploid cultivated genotype 'Pisang Awak' had two unique transcripts that fell into the CENH3 groups MusaCENH3-1A (Pisang Awak-5) and MusaCENH3-1B (Pisang Awak-4). Despite being in the MusaCENH3-1B group, the transcript Pisang Awak-5 had retained two introns (introns 2 and 3) (Figure 3B). These retained introns resulted in a non-functional protein by introducing multiple premature stop codons the first one at nucleotide position 219 in the tail region. The transcript Pisang Awak-4 carried two additional SNPs [one in the tail and one in HFD (alignment positions 105 and 622)] in addition to the five that allowed it to be grouped into the MusaCENH3-1B. Both SNPs were silent and did not result in any amino acid substitution."}]},{"head":"Variants in Allotriploid Genotype 'Sukali Ndiizi'","index":15,"paragraphs":[{"index":1,"size":206,"text":"The allotriploid genotype 'Sukali Ndiizi' had seven variants, four within MusaCENH3-1B group (transcripts Sukali Ndiizi-A, F, G, and H) and three within MusaCENH3-2 (Sukali Ndiizi-B, C, and E). Despite being in the same MusaCENH3-1B group, the sequences of Sukali Ndiizi-A and H differed to the Calcutta 4 at one SNP position each; positions 117 (A to C) and 461 (A to G) in Sukali Ndiizi-A and H, respectively, with the latter resulting in a aspartic acid (D) to glycine (G) substitution in the protein sequence (Figures 2, 3C). The transcripts Sukali Ndiizi-F and G varied from each other with indels; Sukali Ndiizi-F had 27 bp indel (alignment position 63 -89) as well as substitution from T to C at position 184 which resulted in a serine (S) to proline (P) substitution in the protein translation. The 27 bp indel resulted in a shortened protein sequence with 158 amino acids due to a deletion in exon 1. The transcript Sukali Ndiizi-G on the other hand had a 37 bp indel from alignment positions 133-169 (from skipping of exon 3), which resulted in alternative 3 and 5 splice sites. The two splice variations did not cause any shift in the reading frames and therefore resulted in functional proteins."},{"index":2,"size":88,"text":"The transcripts falling within the MusaCENH3-2 group (Sukali Ndiizi-C, B, and E) were observed to be 471 bp long, which is 33 bp shorter than those in MusaCENH3-1A and MusaCENH3-1B and especially with Calcutta 4 (Figure 3C). The resultant proteins were all 156 amino acids long and functional. Despite all the three transcripts being in the same group (MusaCENH3-2) they differed among themselves at six nucleotide positions, four of which resulted in amino acid substitutions at positions 94 and 117, 179 and 181 in Sukali Ndiizi-C (Figure 2)."},{"index":3,"size":9,"text":"Variants in Diploid Banana 'Zebrina GF' and 'Musa balbisiana'"},{"index":4,"size":25,"text":"The diploid banana genotype 'Zebrina GF' expressed transcripts that fell into both the MusaCENH3-1B (transcripts Zebrina GF-6, 7, and 8) and MusaCENH3-2 (Zebrina GF-9) categories."},{"index":5,"size":188,"text":"The three transcripts in MusaCENH3-1B differed amongst themselves with four SNPs, three of which were non-synonymous substitutions at alignment positions 34 (T to C) and 400 (A to G) in Zebrina GF-8 and position 494 in Zebrina GF-7 (G to A) (Figure 3D). The only MusaCENH3-2 representative sequence in this genotype was transcript Zebrina GF-9, which was 471 bp encoding a 156 amino acid long protein. This transcript, like others in the same group from other cultivars, had an exon 1 that was 45 bp longer, the C to G substitution in the α-2 helix and in addition an A to G non-synonymous substitution at alignment position 80 (Figure 3D) that resulted in glycine (Q) to argenine (R) substitution at protein alignment position 28 (Figure 2). The diploid species 'M. balbisiana' had one unique 504 bp long sequence that encoded a 167 amino acid long protein. This transcript fell into the MusaCENH3-1A group and differed from others in the same group with one major non-synonymous SNP site in the HFD that resulted in the substitution of the amino acid threonine (T) to isoleucine (I) at alignment position 144."}]},{"head":"Exon/Intron Structures in Banana CENH3","index":16,"paragraphs":[{"index":1,"size":160,"text":"To get an insight into the splicing approaches and the intron/exon structures of the transcripts obtained and to also know if the differences in lengths of the transcripts were due to splicing variations, the unique banana CENH3 transcripts were mapped to genomic sequence of putative CENH3 from 'DH Pahang' (Figure 4 and Additional File S2). Three exon/intron structures (7/6, 6/5, and 5/4) were observed, which were probably as a result of differences in splicing patterns (Figure 4). The 7 exon/6 intron structure was most frequently observed (10 transcripts out of 17 unique clones). This structure was observed in both diploid and triploid genotypes with three of the four transcripts from the diploid 'Zebrina GF' (Zebrina GF-6, 7, and 8), diploid 'Calcutta 4' and 'M. balbisiana', triploid genotype 'Pisang Awak' (Pisang Awak-4), in three of the seven sequences in the genotype 'Sukali Ndiizi' (Sukali Ndiizi-A, F, and H) and in one transcript from the autopolyploid 'Gros Michel' (Gros Michel-2) (Table 1)."},{"index":2,"size":64,"text":"The 5 exon/4 intron structure was observed in genotypes 'Pisang Awak' (Pisang Awak-5), 'Sukali Ndiizi' (Sukali Ndiizi-B, C, and E) and the diploid 'Zebrina GF' (Zebrina GF-9) (Figure 4). This structure resulted from skipping of the second and the third exons in all sequences apart from Pisang Awak-5, which had this structure due to retention of introns two and three.  (Kapustin et al., 2008)."},{"index":3,"size":52,"text":"The 6 exon/5 intron pattern was observed in two transcripts of Gros Michel-1 and Sukali Ndiizi-G from the genotype 'Gros Michel' and 'Sukali Ndiizi' , respectively (Figure 4). This structure was as a result of skipping of exon 2 for Sukali Ndiizi-G and retention of intron 2 in the transcript Gros Michel-1."}]},{"head":"Alternative Splicing of CENH3 in Banana","index":17,"paragraphs":[{"index":1,"size":82,"text":"Alternative splicing achieves diversity and novelty of proteins. Alternatively spliced variants were obtained based on deviations from splicing in their respective banana CENH3 groups. Four out of the seventeen unique transcripts were alternatively spliced with two of these resulting in unique proteins while the rest introduced premature stop codons. Some of the alternatively spliced transcripts also had SNP variations. Three alternative splicing approaches were observed: exon skipping, intron retention and alternate 3 and 5 splice site (Figure 4 and Additional File S2)."}]},{"head":"Alternative Splicing by Exon Skipping","index":18,"paragraphs":[{"index":1,"size":70,"text":"Exon skipping was observed in only one transcript (Sukali Ndiizi-G) of the triploid cultivar 'Sukali Ndiizi'. This alternate splicing mechanism resulted from skipping of exon 3 and resulted in a functional transcript (Figure 4 and Additional File S2). Exon skipping resulted in shorter transcript length, where the transcript affected (Sukali Ndiizi-G) had a reduced length of 471 bp instead of the 504 bp in transcripts from the same CENH3 group."}]},{"head":"Alternative Splicing by Intron Retention","index":19,"paragraphs":[{"index":1,"size":78,"text":"Intron retention as an alternative splicing mechanism was observed in two transcripts (Gros Michel-1 and Pisang Awak-5), which retained one and two introns, respectively (Figure 4). The intron retention resulted in non-functional proteins due to introduction of at least one stop codon in either of the two transcripts. The transcript Pisang Awak-5 had five stop codons introduced, four in the tail and one in the HFD, whereas Gros Michel-1 only had one stop codon in the tail region."}]},{"head":"Splice Variation by Alternative Splice Site Selection","index":20,"paragraphs":[{"index":1,"size":92,"text":"The alternate 3 and 5 splice site selection resulted in variation in the length of exon 1 (Figure 4). Partial deletion of a 27 bp segment from positions 63-89 of exon 1 was observed in Sukali Ndiizi-F. This deletion resulted in a change of the splice junction from CCCC/GGTC to TTTC/GGTC resulting in a change in splice sites. The transcript Sukali Ndiizi-G was also observed to have a different splice site selection by retaining the nucleotide G from intron 2 (Exon 3 was skipped) and retaining the nucleotide C of intron 3."}]},{"head":"Secondary Structure Prediction","index":21,"paragraphs":[{"index":1,"size":241,"text":"There was general conservation in predicted secondary structure within each of the banana CENH3 groups, although slight variations at specific sections were observed (Figure 5). The MusaCENH3-1A and MusaCENH3-1B had similar predicted secondary folding and varied in the second and the third last turns of the N-terminal tail where they were merged into one due to the lack of the predicted intervening beta sheet in the MusaCENH3-1A group. The secondary structures in the MusaCENH3-2 had more structural variation in comparison to the MusaCENH3-1A and MusaCENH3-1B. The structural modifications included addition, loss, elongation or shortening of coils, turns, α-helices and β-sheets. Splice variations affecting the tail region resulted in loss of α-helices and beta strands, coils and turns in Sukali Ndiizi-G and F (Figure 5). The CENH3 proteins for Sukali Ndiizi-C, B, E, and Zebrina GF-9 also gained and lost domains within the tail region. The major form of variation observed within the HFD was point mutations some of which resulted in non-synonymous substitution. These substitutions resulted in elongations and/or shortening of some predicted secondary structures. The Proline (P) to Alanine (A) substitution within the HFD in Sukali Ndiizi-C, B, E, and Zebrina GF-9 resulted in an elongated loop 1 and a shortened α2 helix a clear structural feature unique to the MusaCENH3-2 CENH3 groups (Figure 5). The substitutions of glutamine (E) with glycine (G) at two different positions in Sukali Ndiizi-C resulted in structural changes within the αNand α1-helices (Figure 5)."}]},{"head":"DISCUSSION","index":22,"paragraphs":[{"index":1,"size":98,"text":"In this study, we observed that CENH3 in diploid and triploid bananas exists as single or multiple allele variants depending on the genotype. The variants were SNPs in both the tail and the HFD region of CENH3. The non-synonymous SNPs resulted in modification of the predicted secondary structures of proteins. The majority of splice variants (apart from two) were predicted to translate in-frame. These splice variations only affected the tail region of CENH3. The presence of multiple CENH3 SNP-alleles in a diploid genotype like 'Zebrina GF' suggests that bananas maybe carrying more than one CENH3 gene per genome."},{"index":2,"size":301,"text":"Cultivated bananas are mainly triploids. Banana breeding involves crossing fertile triploids with diploids to get tetraploids which are then crossed to diploid accessions to give triploid cultivars (Pillay et al., 2004). In other plant species, the presence of different CENH3s from different parents in embryos has been observed to result in uniparental genome elimination, aneuploids, or stable hybrids (Ravi and Chan, 2010;Kuppu et al., 2015;Maheshwari et al., 2015;Tan et al., 2015;Kelliher et al., 2016). The focus in banana breeding programs is to first establish tetraploids and then use them to develop triploids. It has been suggested that crosses between diploids and triploids result in viable diploids (De Langhe et al., 2010). Crosses between A. thaliana wild-type parents and pollen donors carrying specific point mutations within the HFD resulted in uniparental genome elimination-with loss of the genome derived from the mutant line (Kuppu et al., 2015). Two out of the five point mutations that resulted in uniparental genome elimination in Arabidopsis were within the centromere targeting domain (CATD). Some of the SNPs in our study were observed to be within the conserved HFD domains including α2and α3-helices. Furthermore, mutations of CENP-A (CENH3 of humans) residues resulted in reduced retention of CENP-A in centromere of human cells and this was due to the effect on α2-helix length which plays a key role of maintaining orientation at nucleosome entry and exit (Tachiwana et al., 2011). The SNPs were within the CATD and these resulted in a predicted shortening of the α2-helix. These CATD SNP variations can result in CENH3 nucleosome instability and may affect crosses of bananas having CENH3s with variation at these positions. It would be interesting to know if multiple CENH3s affect banana breeding and if they do, then it may be important to consider CENH3 type when choosing parents for crossing."},{"index":3,"size":139,"text":"We observed three CENH3 variants in both diploid and triploid bananas, which differed at the tail region and have SNPs in the HFD region. The presence of these three variants in a diploid line indicates presence of more than one CENH3 in a single banana genome. Alpha and beta CENH3 variants in wheat were observed to have different functional roles. Reduced expression of alpha version resulted in extreme dwarfing and weakened root system whereas reduced expression of the beta version resulted in reduced plant height and reproductive fitness leading to the conclusion that the two versions are involved in plant development and reproductive development, respectively (Yuan et al., 2015). Although this study did not explore the functions of the banana CENH3 variants, it would be worth conducting such studies in future to verify if the variants differ in functionality."},{"index":4,"size":73,"text":"The presence of multiple CENH3 allele variants in a wild diploid banana (four in diploid 'Zebrina GF') corroborate the hypothesis that domestication of cultivated hybrids passed through intermediate hybrids (De Langhe et al., 2010). 'Zebrina GF' is a wild diploid that has been shown to segregate during crosses, an indication that it has a high degree of heterozygozity (personal communication from Professor Rony Swennen, Banana breeder at IITA and collector of this genotype)."},{"index":5,"size":120,"text":"The observation that alternative splicing of CENH3 in bananas only affected the N-terminal tail is consistent with those made in the angiosperms Oryza spp., Brassica spp., and Gossypium spp. (Wang et al., 2011;Masonbrink et al., 2014). It was interesting to observe that some of the splice variations resulted in transcripts that were translatable into proteins as these could further add into the diversity of banana CENH3s. However, it is not clear if the in-frame splice variants translate into proteins in vivo and whether they are loaded into the centromere. The role of the outof-frame variants is also not clear and future studies targeting the CENH3 splice variants and their proteins (if translated) are required to identify their role(s) and fate."},{"index":6,"size":114,"text":"The variations observed in the three main banana CENH3 groups were observed to affect the predicted secondary structures of the respective proteins. This is interesting considering that crosses of Arabidopsis null mutant lines complemented with a CENH3 version in which tail was replaced with that of histone H3.3 and GFP-tagged to wild-type resulted in uniparental genome elimination (Ravi and Chan, 2010). The highly variable N-terminal tail of the CENH3 indicates its role in the evolving centromeric satellites (Hui et al., 2010;Ravi et al., 2010;Hayden and Willard, 2012) or affecting the targeting of centromeres that might be a mode of bringing in new CENH3 proteins in response to increased centromere size (Masonbrink et al., 2014)."},{"index":7,"size":160,"text":"The frequency of non-synonymous SNPs within each of the banana CENH3 groups was observed to be higher within the HFD region, while the frequency of both synonymous and non-synonymous SNPs between different CENH3 groups was higher in the tail region. A study on evolution of CENH3 in drosophila observed that the frequency of interspecific CENH3 polymorphisms were higher in the tail than the HFD although the ratios of such changes were lower within the same species (Malik and Henikoff, 2001). One of the CENH3 groups (MusaCENH3-1A) was observed to be specific to the diploid Musa species 'M. balbisiana' and differed from other CENH3 groups with non-synonymous substitutions, majority of which were in the tail region. Majority of the non-synonymous SNPs in transcripts within banana CENH3 group were observed to be within the CATD, which may affect CENH3 targeting to the centromere because the CATD specifically the loop 1 has been shown to be involved in localization (Dalal et al., 2007)."},{"index":8,"size":179,"text":"The number of CENH3 exons and introns in the respective exon/intron structures has been found to vary in different plant species. Seven CENH3 transcripts obtained from five rice species were observed to have 7 exons and 6 introns despite having different CDS lengths (Hirsch et al., 2009). In carrots, a similar structure of 7 exons and 6 introns was observed while in brassica two different structures were observed in CENH3s of varying lengths, one with 7 exons/6 introns and second with 9 exons/8 introns structure. In this study, three exons/introns structures (7/6, 6/5, and 5/4) were observed in bananas. The 7/6 and the 5/4 exon/intron structures were found in both diploids and triploids, however, 7/6 was most predominant. The 6 exons/5 introns structure was only observed in triploid bananas and this mechanism resulted in functional and non-functional transcripts. In this analysis, it is clear that there was more bias toward having a 7 exons/6 introns structure whereas the 5 exons/4 introns structure was minor and the 6/5 structure was a result of failure of the 7/6 to splice correctly."},{"index":9,"size":55,"text":"This study provided insight into how CENH3 is expressed in diploid and triploid bananas. Additional genotypes including tetraploids should be included in future studies. Due to the emergence of CENH3-based breeding techniques, the knowledge obtained here indicates that checking the CENH3 type may be used as a criterion in selection of parents for banana breeding."}]}],"figures":[{"text":"FIGURE 1 | FIGURE 1 | Phylogenetic tree of banana CENH3s. Unrooted Phylogenetic tree based on histone fold domain (HFD) and conserved CENH3 tail sections of six banana genotypes showing the MusaCENH3-1A, MusaCENH3-1B, and MusaCENH3-2 groups. Values at the root are bootstrap support values at 1000 replicates.The tree was drawn in MEGA 6(Tamura et al., 2013). "},{"text":"FIGURE 3 | FIGURE 3 | Alignment of transcript variants to the reference transcript from diploid banana genotype 'Calcutta 4'. Blocks (A-D) are alignments of genotypes 'Gros Michel', 'Pisang Awak', 'Sukali Ndiizi', and a combination of 'Zebrina GF' and species 'Musa balbisiana' to 'Calcutta 4', respectively. Inset in red is the nucleotide alignment similarity index. "},{"text":"FIGURE 4 | FIGURE 4 | Alignment of the CENH3 transcripts to genomic sequence of genotype 'DH Pahang' to identify splice mechanisms. The 7/6, 6/5, and 5/4 structures are represented intron/exon structures are represented. Alignment was performed using Splign(Kapustin et al., 2008). "},{"text":"FIGURE 5 | FIGURE 5 | Predicted secondary structures of banana CENH3. 1-MusaCENH3-1A, 2-MusaCENH3-1B, and 3-MusaCENH3-2. At the bottom are the different CENH3 domains, above the structures are the amino acids in logo format. Inset is the key to the secondary structures. "},{"text":"TABLE 1 | Description of CENH3 transcripts from different genotypes of banana. Genotype Genomic Banana CENH3 Unique sequence Total number of CDS Exon/Intron Functional Genbank GenotypeGenomicBanana CENH3Unique sequenceTotal number ofCDSExon/IntronFunctionalGenbank  group group identifier clones length Structure status Accession Number groupgroupidentifiercloneslengthStructurestatusAccession Number Gros Michel AAA MusaCENH3-1B 1 6 591 6/5 Non- KP878227 Gros MichelAAAMusaCENH3-1B165916/5Non-KP878227        functional  functional Gros Michel AAA MusaCENH3-1A 2 7 504 7/6 Functional KP878231 Gros MichelAAAMusaCENH3-1A275047/6FunctionalKP878231 Pisang Awak ABB MusaCENH3-1A 4 5 504 7/6 Functional KP878229 Pisang AwakABBMusaCENH3-1A455047/6FunctionalKP878229 Pisang Awak ABB MusaCENH3-1B 5 4 760 5/4 Non- KP878228 Pisang AwakABBMusaCENH3-1B547605/4Non-KP878228        functional  functional Sukali Ndiizi AAB MusaCENH3-1B G 6 471 6/5 Functional KP878221 Sukali NdiiziAABMusaCENH3-1BG64716/5FunctionalKP878221 Sukali Ndiizi AAB MusaCENH3-1B A 4 504 7/6 Functional KP878225 Sukali NdiiziAABMusaCENH3-1BA45047/6FunctionalKP878225 Sukali Ndiizi AAB MusaCENH3-1B F 7 477 7/6 Functional KP878222 Sukali NdiiziAABMusaCENH3-1BF74777/6FunctionalKP878222 Sukali Ndiizi AAB MusaCENH3-1B H 3 504 7/6 Functional KP878226 Sukali NdiiziAABMusaCENH3-1BH35047/6FunctionalKP878226 Sukali Ndiizi AAB MusaCENH3-2 B 5 471 5/4 Functional KP878238 Sukali NdiiziAABMusaCENH3-2B54715/4FunctionalKP878238 Sukali Ndiizi AAB MusaCENH3-2 C 4 471 5/4 Functional KP878236 Sukali NdiiziAABMusaCENH3-2C44715/4FunctionalKP878236 Sukali Ndiizi AAB MusaCENH3-2 E 4 471 5/4 Functional KP878239 Sukali NdiiziAABMusaCENH3-2E44715/4FunctionalKP878239 Zebrina GF AA MusaCENH3-1B 6 7 504 7/6 Functional KP878223 Zebrina GFAAMusaCENH3-1B675047/6FunctionalKP878223 Zebrina GF AA MusaCENH3-1B 7 9 504 7/6 Functional KP878224 Zebrina GFAAMusaCENH3-1B795047/6FunctionalKP878224 Zebrina GF AA MusaCENH3-1B 8 5 504 7/6 Functional KP878220 Zebrina GFAAMusaCENH3-1B855047/6FunctionalKP878220 Zebrina GF AA MusaCENH3-2 9 3 471 5/4 Functional KP878237 Zebrina GFAAMusaCENH3-2934715/4FunctionalKP878237 Musa balbisiana BB MusaCENH3-1A 10 13 504 7/6 Functional KT600804 Musa balbisianaBBMusaCENH3-1A10135047/6FunctionalKT600804 Calcutta 4 AA MusaCENH3-1B 11 13 504 7/6 Functional KT600803 Calcutta 4AAMusaCENH3-1B11135047/6FunctionalKT600803  "},{"text":"TABLE 2 | Minimum banana CENH3 allele and splice variants. Banana Genotype Minimum number of Minimum number of Splicing mechanism (s) Splice variant CENH3 Banana GenotypeMinimum number ofMinimum number ofSplicing mechanism (s)Splice variant CENH3  SNP-allele variants splice variants  group(s) SNP-allele variantssplice variantsgroup(s) Gros Michel 2 1 7/6, 6/5 MusaCENH3-1A and -1B Gros Michel217/6, 6/5MusaCENH3-1A and -1B Pisang Awak 2 1 7/6, 5/4 MusaCENH3-1A and -1B Pisang Awak217/6, 5/4MusaCENH3-1A and -1B Sukali Ndiizi 4 6 7/6, 5/4, and 6/5 MusaCENH3-1A, -1B and -2 Sukali Ndiizi467/6, 5/4, and 6/5MusaCENH3-1A, -1B and -2 Zebrina GF 4 1 7/6 and 5/4 MusaCENH3-1B and -2 Zebrina GF417/6 and 5/4MusaCENH3-1B and -2 Musa balbisiana 1 0 7/6 MusaCENH3-1A Musa balbisiana107/6MusaCENH3-1A Calcutta 4 1 0 7/6 MusaCENH3-1B Calcutta 4107/6MusaCENH3-1B  "}],"sieverID":"035c5741-52be-4fe9-b835-d899db813801","abstract":"Centromeres are specified by a centromere specific histone 3 (CENH3) protein, which exists in a complex environment, interacting with conserved proteins and rapidly evolving satellite DNA sequences. The interactions may become more challenging if multiple CENH3 versions are introduced into the zygote as this can affect post-zygotic mitosis and ultimately sexual reproduction. Here, we characterize CENH3 variant transcripts expressed in cultivated triploid and wild diploid progenitor bananas. We describe both splice-and allelic-[Single Nucleotide Polymorphisms (SNP)] variants and their effects on the predicted secondary structures of protein. Expressed CENH3 transcripts from six banana genotypes were characterized and clustered into three groups (MusaCENH-1A, MusaCENH-1B, and MusaCENH-2) based on similarity. The CENH3 groups differed with SNPs as well as presence of indels resulting from retained and/or skipped exons. The CENH3 transcripts from different banana genotypes were spliced in either 7/6, 5/4 or 6/5 exons/introns. The 7/6 and the 5/4 exon/intron structures were found in both diploids and triploids, however, 7/6 was most predominant. The 6/5 exon/introns structure was a result of failure of the 7/6 to splice correctly. The various transcripts obtained were predicted to encode highly variable N-terminal tails and a relatively conserved C-terminal histone fold domain (HFD). The SNPs were predicted in some cases to affect the secondary structure of protein by lengthening or shorting the affected domains. Sequencing of banana CENH3 transcripts predicts SNP variations that affect amino acid sequences and alternatively spliced transcripts. Most of these changes affect the N-terminal tail of CENH3."}

data/part_1/098edc34c9a55acea1aafacf0c08e27d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"098edc34c9a55acea1aafacf0c08e27d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1108a482-5715-4543-8c02-bf37e1d721df/retrieve"},"pageCount":33,"title":"Development of low input systems such as organic farming by optimising the use of legumes in a dry region of Nicaragua to strengthen soil fertility, yield, human nutrition and farm income","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[]},{"head":"Organic farming","index":2,"paragraphs":[{"index":1,"size":165,"text":"Organic farming is for many farmers more and more an alternative to manage successfully their farm. Advantages are: reduced costs for agricultural inputs, reduction of soil erosion, development of soil fertility, higher yields and in some cases better income by linking to international organic markets. In tropical countries like Nicaragua where traditional agriculture is predominant, organic farming practises are less common, but gain an increasing interest among the farmer communities. Often, the economic situation of the farmers doesn't allow for agricultural inputs, except the most important ones like seeds, and sometimes fertilizer and pesticides. Optimal use of natural resources is therefore key to maintain or increase soil fertility. Specific research for organic farming cropping systems in tropical environments is very rare. There is a need to invest more in the development of especially legume based systems to sustainably increase crop yields. Effects of such systems in Nicaragua (e.g. Schmidt & Orozco, 2003) and in Kenya (e.g. Lelei, 2004;Lelei et al., 2004) had shown convincing results."}]},{"head":"Legumes","index":3,"paragraphs":[{"index":1,"size":104,"text":"Legumes are of major importance in agriculture worldwide. Many of them (Fabacaea) have root nodules being evidence of symbiosis with nitrogen-fixing bacteria (Rhizobium) allowing a crude protein content of the plant up to 35% and even increasing nitrogen availability for other non-nitrogen fixing crops like cereals. Furthermore, biomass yields of many legumes are high, making them suitable as cover crops maintaining soil humidity and providing green manure, reducing erosion, suppressing weeds and strengthening of the antiphytopathogenic potential of the soil. The high protein content in combination with an often regular or even good palatability makes legumes also an important source of protein for livestock."}]},{"head":"Use of legumes in mixed crop-livestock systems","index":4,"paragraphs":[{"index":1,"size":139,"text":"The use of drought tolerant forage legumes as animal feed is an effective strategy to reduce production decrease in the dry season. This research focuses on the introduction and evaluation of new forage germplasm. Species and accessions having shown reasonable yields and a decrease of less than 48% in biomass production in the dry season are considered for further evaluation. In pastures, addition of forage legumes enhances animal production twofold: through higher biomass production and through increasing the overall nutritive value. Small farms based on maize and beans and often including cattle characterize the dominant farming system in Central America. Soil nutrient depletion is a common problem leading to degraded soils, a decline in agricultural productivity, and, eventually, to food insecurity and poverty. Legumes can decrease soil erosion, optimise farm-energy balance, and increase soil fertility and soil waterholding capacity."}]},{"head":"Former research findings","index":5,"paragraphs":[{"index":1,"size":304,"text":"Preceding activities in the research region (CIAT, Universidad National Agraria (UNA), local partners) consisted of workshops with local farmers in which current problems were articulated identifying causes and interactions between crop management and soil resources. Main focus was the evolution of the production systems over time and reasons for change. These workshops were the first step in a learning alliance process with farmers in San Dionisio (Orozco & Franco, 2001). A survey on the use of organic matter in San Dionisio (Dohmeyer, 2003) showed that, although local and national organizations have been working on cover crops/green manures (CCGM) in San Dionisio in the last decade, there were only 36 farmers who knew about the benefits of CCGM, and only 30% of them can be considered of having integrated CCGMs into their production system. Studies on the nutrient flows at farm levels revealed crop residue management as a main cause for decreasing soil fertility. As above ground residues are burnt, and in the case of beans below ground residues are pulled out (and subsequently burnt), soil organic matter decreases and nutrient balances are negative. Decreasing crop yields are the consequences, which can not be made up for through increased chemical fertilizer application. In order to complete the process of learning about soil resources in San Dionisio we conducted a characterization survey (\"feria de suelo\" (Trejo et al, 1999)), where farmer matched local soil quality indicators with scientific ones, including physical (texture, colour, infiltration, consistency), chemical (pH, SOM), and biological parameters such as rhizobia presence and soil fauna. Farmer groups then conducted maize experiments with different N-P-K fertilizer levels to identify the most important nutrient on their fields. Nitrogen resulted as the most important nutrient throughout the watershed, while the application of P only resulted in a marginal effect on maize yield. Potassium had no effect."}]},{"head":"Conclusions and outlook","index":6,"paragraphs":[{"index":1,"size":91,"text":"From the above described activities and results it was concluded that traditional fertilization can be substituted through a single legume crop prior to maize crops. There are options to enhance farmer production systems in the dry hillsides of Nicaragua and reverse the current tendency of these soils to degrade leaving farmers with higher yields and lower production costs. This report presents an overview of the project results of the experiments during both project periods, the first from February 2005 to October 2007 and the second from November 2007 to April 2010."}]},{"head":"Objectives","index":7,"paragraphs":[{"index":1,"size":60,"text":"The objective of this project jointly carried out by the University of Natural Resources and Applied Life Sciences (BOKU), Vienna, Austria, the Universidad Nacional Agraria (UNA), Managua, Nicaragua and CIAT is to develop options based on legumes as green manure and animal feed. More specifically, the original targets of the project as mentioned in the project document were as follows:"},{"index":2,"size":59,"text":"(a) On-station trials: 1. To find out the impact of different legume species / varieties, planted in the dry season, on soil organic matter after a four year rotation (see 2.1). 2. To study the performance of different legume species / varieties about root biomass, above ground biomass, nitrogen fixation and the effects on subsequent maize performance (see 2.1)."},{"index":3,"size":109,"text":"(b) On-Farm trials: 3. To investigate the impact of cover crops/green manure (CCGM) improved residue grazing in the dry season on subsequent maize performance in comparison with non-grazed cover crops/green manure (CCGM) rotations, as well as their labour and economic impacts (see 3.1). 4. To analyse the impact of cover crops/green manure (CCGM) species / varieties on subsequent maize performance, as well as their labour and economic impacts (see 2.1). 5. To implement support strategies for farmer/researcher to farmer training / knowledge transfer, experience exchange -combining on station trial knowledge with farmer specific knowledge (site specific techniques) accompanied by B.Sc. / M.Sc. students and local farmer organizations (see 3.2)."}]},{"head":"Activities February 2005 -September 2007","index":8,"paragraphs":[{"index":1,"size":6,"text":"This chapter consists of two parts:"},{"index":2,"size":77,"text":"• An experiment carried out by the Universidad Nacional Agraria to evaluate the adaptability of 16 genotypes of forage legumes. • A research carried out by a Danish student (Signe Borgen, University of Copenhagen) together with the Universidad Nacional Agraria to evaluate (1) (potential) N-contribution (N-fixation, mineralization) of four cover legumes (as green manure) to the soil and subsequent crops and ( 2) research the adoption (potential) of green manure and other organic production methods by farmers."},{"index":3,"size":22,"text":"This part reflects the outcomes and conclusions as presented in technical reports of UNA and the thesis by Mrs. Borgen (Borgen, 2007). "}]},{"head":"Evaluation","index":9,"paragraphs":[]},{"head":"Variables measured","index":10,"paragraphs":[{"index":1,"size":37,"text":"• Germination rate: measured up to 15 days, hereafter the proportion of surviving plants per furrow and per plot. • Cover height: to be assessed every 15 days in the three central furrows of each experimental plot."},{"index":2,"size":16,"text":"• Biomass (kg): in each parcel three square metres, at the onset of the flowering stage."},{"index":3,"size":16,"text":"• Cover %: every 15 days till the end of the biological cycle of the crops"}]},{"head":"Experimental results","index":11,"paragraphs":[{"index":1,"size":117,"text":"After the establishment of the experiment on 08/10/05 assessments were done every 15 days of the following variables: germination rate, survival rate, cover % and cover height. We found that some treatments showed low germination rates. This might be due to the seed quality. In subsequent assessments germination rates of some accessions increased slightly. In addition, rabbits ate the few plants that survived. On 26/11/05 the penultimate assessment was done and the survival rates varied between 13% and 60%. Based on these results it was decided to replant, but results were disappointing, leading to our conclusion that the seed germination quality was low. A next assessment on 10/12/05 showed that rabbits had eaten the few remaining plants."},{"index":2,"size":50,"text":"• The Lablab purpureus accessions and Canavalia brasiliensis showed relatively better germination rates • Germination rates of Vigna unguiculata were very low • Only Vigna umbellata \"testigo\" showed a germination rate of over 50% • Canavalia ensiformis did not germinate at all • There was no significant difference between blocks"}]},{"head":"Conclusions","index":12,"paragraphs":[{"index":1,"size":55,"text":"• There were no significant differences between blocks and between species (p<0.05), however it was possible to identify the robustness of the different germplasm. • Survival rates show the same tendency as germination rates, the Lablab purpureus accessions performing relatively well, as well as Vigna umbellata \"testigo\" • Survival rates of Vigna unguiculata are low"}]},{"head":"General recommendations","index":13,"paragraphs":[{"index":1,"size":67,"text":"• Although not mentioned in the original report, another factor leading to this disappointing outcome was a prolonged drought period (personal communication by involved UNA personnel). It is therefore recommended to do a next trial in the primera (from May to August) instead of the postrera (from September to December) growing season. • It is highly recommended to do germination tests with seed intended for an experiment."},{"index":2,"size":36,"text":"However,the heterogeneity of seed material has always to be taken into account. • It is recommended to protect plots against rabbits and other animals (chicken wire might be too expensive, but there are also other options)."},{"index":3,"size":17,"text":"• Low seed quality and other natural limiting factors can extensively affect yields, even of improved germplasm."}]},{"head":"Biophysical adaptation of legume green manures and social adoption analysis in subhumid Nicaraguan hillsides of San Dionisio","index":14,"paragraphs":[{"index":1,"size":8,"text":"(based on the MSc. thesis by Signe Borgen)"},{"index":2,"size":24,"text":"Adaptation of four legume species was evaluated in the sub-humid hillsides of Nicaragua for its i) N fertilizer potential and ii) social adoption potential."},{"index":3,"size":22,"text":"The first component tested the biophysical niche of the legumes at the end of the rainy season, represented by the following hypothesis:"},{"index":4,"size":36,"text":"Hypothesis 1: Canavalia brasiliensis, Lablab purpureus, Vigna unguiculata and Vigna umbellata are drought resistant and biophysically well-adapted to conditions in San Dionisio and similar environments as green manures established at the end of the rainy season."},{"index":5,"size":35,"text":"The social analysis evaluated the human, social and physical capitals in relation to green manure use and three other organic production methods as well as farmers' adoption behaviour and is embodied by the following hypothesis:"},{"index":6,"size":22,"text":"Hypothesis 2: Factors related to social, human and physical capital hinder farmers' adoption of green manure and organic production methods in general."}]},{"head":"Field trial","index":15,"paragraphs":[{"index":1,"size":43,"text":"The legume trial had a randomised block design consisting of four legumes (Canavalia brasiliensis, Lablab purpureus, Vigna unguiculata and Vigna umbellata) with and without compost application in three replicates, resulting in 24 plots of 4x6 m with an actual sample size of 5x3m."},{"index":2,"size":25,"text":"Only Canavalia brasiliensis persisted, while the three other legumes performed poorly. Germination rates were low (estimated at 40%, probably caused by chickens eating the seed)."},{"index":3,"size":21,"text":"Vigna umbellata disappeared within 45 days after planting, and only few plants of Lablab purpureus and Vigna unguiculata survived till maturity."},{"index":4,"size":358,"text":"The trial was further impaired by pests (mainly beetles and ants), which affected Canavalia brasiliensis less than the other legumes. Canavalia yields were estimated at 900 kg/ha DM (2500 kg/ha fresh weight) for the control plot and at 1000 kg/ha with compost application (2600 kg/ha fresh weight). In comparison to literature and local data from CIAT experiments (with yields up to 5300 kg/ha fresh weight) these yields were low. The positive effect of compost on biomass production is likely caused by higher water retention in the early stages and a possibly higher nutrient availability later on. N 2 fixation rates (measured using the Natural Abundance Method) were high, though the poor biomass production indicated that the plants were not performing well. Total N contributions from fixation were calculated, and compared for the compost and control treatment. The pot experiment verified that nodules were present and actively fixing N 2 in the local soil. Compatible rhizobia were present for both Lablab purpureus and Vigna unguiculata, and symbiosis could therefore be expected, even without inoculation. Due to lack of seeds, Canavalia brasiliensis was not included in the pot experiment, but nodules were present and active in plants in the field. Vigna unguiculata and Lablab purpureus did not associate with the same Rhizobium genus: the first with the slow-growing Bradyrhizobium Rhizobium strains and the latter with a fast-growing strain of the Rhizobium genus. Average nodule numbers per plant were 8.8 and 7.7 for Vigna unguiculata and Lablab purpureus respectively. N 2 fixation was 81 and 52 %Ndfa for Lablab purpureus and Vigna unguiculata respectively, and nodules were actively fixing without inoculation. Canavalia brasiliensis was found more suitable than the other legumes as a late rainy season green manure, resisting pest and drought stress. This plant showed the highest N contribution (estimated at 13.5 kg N/ha after 180 days with an N 2 fixation of 64% Ndfa). Compost application had a negative effect on N 2 fixation but increased biomass production, resulting in a similar net N contribution. Further experiments including on compost quality are needed to determine if compost should be recommended to increase N contribution from dry season green manures."}]},{"head":"Incubation experiments","index":16,"paragraphs":[{"index":1,"size":102,"text":"Two incubation experiments were done, one to determine inorganic N content of the compost during four weeks with weekly measurements and a second to determined mineralization patterns of Vigna unguiculata, Canavalia brasiliensis and Lablab purpureus during four weeks with measurements every 14 days. Water content of all soils was 50% of their water holding capacity. Compost and plant material were added in a quantity of 11% and 1% of soil weight respectively. Incubation took place at 25ºC under aerobic conditions. Samples were mixed with 1 M KCl for 45 min, filtered and analysed for nitrate and ammonium by flow injection analysis (FIA)."},{"index":2,"size":95,"text":"The net N mineralization of Vigna unguiculata, Lablab purpureus and Canavalia brasiliensis varied according to material quality and the soil used for incubation. The trial residues immobilized between 0 and 65 mg N/ha after four weeks incubation with an N content of the plant residues close to 2% of DM. Experimental conditions like residue particle size and incubation period may have led to a higher immobilization compared to field conditions. In conclusion, Canavalia brasiliensis is not considered an immediate N source, but contributes to long-term soil fertility build-up, with potential for remineralization after one month."}]},{"head":"Social survey","index":17,"paragraphs":[{"index":1,"size":228,"text":"Together with three UNA students an evaluation of human, social, and physical resources influencing green manure adoption was conducted. The survey was conducted with 182 representative farmers selected by a stratified sampling procedure using the following criteria: farm size, farm type and membership of an organization. The themes covered were live barriers, composting, green manure and biological pest control. Some farmers mentioned lack of information as the most important constraint for all themes, in spite of high awareness of (in descending order) live barriers, composting, and green manure. Awareness and know-how was very high for live barriers (95% and 80%), composting (86% and 59%) and green manure (72% and 48%) but lower for biological pest control (72% and 48%), which might be due to the less precise description of this method. Adoption rates found were 57, 37, 33 and 17% for live barriers, composting, green manure, and biological pest control, respectively, and were higher for farmers with higher education and belonging to an organization. Adoption of green manure was especially limited by lack of access to seed. Land tenure influenced adoption live barriers more than the other factors. Lack of information was mentioned most often (28% of the farmers) as the main constraint to use organic production methods. Almost half of the respondents claimed to know how to use green manure and a third had actually practiced this."},{"index":2,"size":74,"text":"A positive correlation was found between organization membership and knowledge level. Knowledge level tended to increase with farm size, but no differences were found in adoption rates of organic production methods of small (70%), medium (78%) and large (65%) farmers. Hence, knowledge of methods does therefore do not automatically lead to their application, possibly because from the point of view of these farmers they are not suitable for larger farmers who are more mechanized."},{"index":3,"size":233,"text":"There is generally a high awareness and knowledge on organic production methods in San Dionisio, but this has generally not been translated into their concrete application at farm level limiting farmers' experience.. Human capital seems therefore not the most limiting factor for adoption of organic production methods. Social capital is more important: a positive relation exists between organization membership and adoption. The institutional presence in San Dionisio is quite large, which is reflected in relatively high adoption rates of especially live barriers. Approximately 40% of farmers in San Dionisio are farming under insecure tenure conditions. This influences adoption of long term organic farming methods, reducing the use of live barriers with 24% and using of green manure with 10%. These results comply with general findings indicating that tenure and especially lack of access to land restricts adoption of green manure and other organic production methods. Physical capital, primarily in terms of availability of seeds and land, was the main limiting factor for 61% of the respondents in the adoption of green manure, lack of seeds accounting for more than 60%. Labour availability could also be a constraining factor if short-duration legumes are planted at the end of the rainy season and incorporation would coincide with harvesting coffee and postrera beans in December/January. Incorporation in March/April of long-duration green manures such as Canavalia brasiliensis would not be likely to compete with other farming activities."}]},{"head":"Conclusions and recommendations","index":18,"paragraphs":[{"index":1,"size":218,"text":"It could be argued that the poor agricultural production in areas such as San Dionisio could be increased by facilitation of credit schemes enabling purchase of chemical inputs. However, whereas mineral fertilizers -especially phosphorus -increase production, organic soil improving methods are much more effective, especially at the long-term. For instance, the post-Mitch situation (after the hurricane Mitch in October 1998, which devastated large parts of Honduras and Nicaragua) emphasized once more the importance of increasing agroecosystem resilience. Additionally, organic fertilizers require less monetary inputs and green manures could play an important role by providing nitrogen and organic matter to increase soil fertility. This research showed that Canavalia brasiliensis can be used as a green manure in the late rainy season, with potential N remineralized and available for the following crop. Further trials are necessary to determine the biomass potential of Vigna unguiculata, Lablab purpureus and Canavalia brasiliensis planted at the end of the rainy season. Biological pest control could probably reduce pest attacks, however to identify strategies, an elaborate research design is to be established. Use of green manures is not widespread in San Dionisio. However, biophysically adapted species are available. Limiting factors are lack of physical resources, such as seed availability. This constraint can be lifted in various ways, most requiring intervention from government or development agencies."},{"index":2,"size":36,"text":"A seed system also offering access by the poorest farmers should be established. Lending schemes show potential, but are not accessible to everybody. Distribution and access to land is another barrier, where political action is needed."}]},{"head":"Perspectives for organic farming in San Dionisio","index":19,"paragraphs":[{"index":1,"size":210,"text":"Sustainable and/or organic farming practices are being already implemented in San Dionisio and awareness and use of live barriers is widespread. However, one practice alone clearly cannot sustain an organic production system and it is arguable whether the present soil fertility levels and fragility of agro-ecosystems can allow sufficient production with immediate effect without the application of agrochemicals. On the other hand, results suggest that integrating organic components like legumes and compost offer better long-term solutions and it is therefore recommended to embark on a gradual conversion to organic production. The presence of agricultural organizations in San Dionisio promoting organic methods is a first step. Appropriate and adaptable, innovations could spread spontaneously. Farmer involvement in project formulation, implementation and identification of objectives is also a positive step. Dissemination of the concept of sustainability of environmental as well as social aspects might create an innovative spirit amongst farmers, enabling adaptation of farming methods according to individual needs. The land tenure issue is not likely to hinder adoption of organic production methods if yields increase while labour and financial inputs remain equal or decrease. Institutional support from development organizations and the Nicaraguan government, focusing on seed availability of cover legumes and distributing information on organic farming, may provide a solid starting point."}]},{"head":"Activities October 2007 -April 2010","index":20,"paragraphs":[{"index":1,"size":39,"text":"Since the project activities had only been partially fulfilled, it was decided to restart in October 2007. Representatives of the implementing institution UNA (Universidad Nacional Agraria), as well as research sites and students were identified and experiments were designed."},{"index":2,"size":15,"text":"The targets of the project as mentioned in the revised project document are as follows:"},{"index":3,"size":158,"text":"(a) On-station trials: 1. To find out the impact of different legume species / varieties, planted in the dry season, on soil organic matter after a four year rotation. 2. To study the performance of different legume species / varieties about root biomass, above ground biomass, nitrogen fixation and the effects on subsequent maize performance. (b) On-Farm trials: 3. To investigate the impact of cover crops/green manure (CCGM) improved residue grazing in the dry season on subsequent maize performance in comparison with non-grazed cover crops/green manure (CCGM) rotations, as well as their labour and economic impacts. 4. To analyse the impact of cover crops/green manure (CCGM) species / varieties on subsequent maize performance, as well as their labour and economic impacts. 5. To implement support strategies for farmer/researcher to farmer training / knowledge transfer, experience exchange -combining on station trial knowledge with farmer specific knowledge (site specific techniques) accompanied by B.Sc. / M.Sc. students and local farmer organizations"},{"index":4,"size":8,"text":"The following four main activities were carried out:"},{"index":5,"size":211,"text":"1. Evaluate 16 genotypes of forage legumes in trial plots at two experiment sites in the Pacific region of Nicaragua and their effect on maize production (project target 1, 2, 4). These experiments took place at the Ranch Ebenezer and the Finca Santa Rosa. A complete randomised block was established with 16 treatments and three replicates (see Annex 2 for details). 2. Evaluate the effect of four genotypes of leguminous shrubs/trees at one experiment site (El Plantel, research farm of UNA) on soil fertility and maize production (alley cropping) (project target 2, 4) (see Annex 3 for details). 3. Evaluate the agronomic and production characteristics of five forage legumes in semi-arid conditions (project target 3, 4) 4. On-farm and community research. This part includes a Participatory Rapid Appraisal (PRA) and training workshop on use of both introduced and local herbaceous forage legumes and leguminous shrubs for improvement of soil fertility and animal feed in Pacora, San Francisco Libre, Managua (project target 5). Additionally a student from the University of Potsdam -BOKU did research on (1) the behaviour of both indigenous and introduced legumes and their effect on maize during the growing period and after mulching and (2) a community analysis on development project activities, their effectiveness, lessons learned and success factors."},{"index":6,"size":8,"text":"UNA Personnel and students involved in the project: "}]},{"head":"Legumes Agronomic characteristics","index":21,"paragraphs":[{"index":1,"size":98,"text":"Plant development differed considerably per site. Though at both sites legumes performed quite well, at Niquinohomo the maize harvest failed due to drought. An important agronomic characteristic is tolerance to pests, and therefore pest incidence was evaluated (Table 2). At both sites, Centrosema plumieri was most resistant. The Vigna and Legume N-content N-content of varied considerably between the different legumes (Table 4). The Vigna umbellata accessions showed relatively low contents (under 2%), whereas Lablab purpureus accessions contained up to 3% of nitrogen, with Canavalia brasiliensis and Clitoria ternatea also in the upper ranges. Cowpea accessions showed intermediate results."}]},{"head":"Effect of forage legumes on agronomic maize parameters","index":22,"paragraphs":[{"index":1,"size":76,"text":"The main objective of this experiment is the evaluation of the effect on maize of intercropping with legumes. The following production indicators were evaluated: plant height (Table 5), stem diameter, germination rate and incidence of pests and diseases.  In Santa Rosa, intercropping with Vigna unguiculata 284/2 provided best results, in contrast to the combination with Vigna unguiculata FHIA and Vigna umbellata 24360. At the Niquinohomo site Lablab purpureus 2 (Dl) and Vigna unguiculata 131-2 were most"}]},{"head":"Evaluation of four leguminous shrubs intercropped with annual species under conditions of drought","index":23,"paragraphs":[{"index":1,"size":108,"text":"The trial was established in June 2008 at the UNA \"El Plantel\" farm. The climate is characterized by an annual rainfall of 1100 mm with a rainy season of six months (May to November) within which a relatively dry period during August and September. Average temperature is 26 degrees C. Soils are Mollisols of volcanic origin, with intermediate soil depth and well drained (Table 7, for more details see Annex 4). Four leguminous shrubs were planted as alley crops with maize: Gliricidia sepium, Leucaena leucocephala, Caesalpinia velutina and Erythrina poeppigiana. Canavalia brasiliensis was planted between the alleys. Calopogonium sp. was also evaluated. Soil samples were taken and analysed."},{"index":2,"size":58,"text":"The experimental test design consisted of three randomised blocks, each block was divided into 5 experimental plots of 300 m2 each. The measured variables were: survival rate, plant height, plant diameter, maize height, biomass production of Canavalia and Calopogonium sp., the soil was analysed for pH, organic matter, nitrogen, available phosphorus and potassium, calcium, magnesium and electric conductivity."}]},{"head":"Results:","index":24,"paragraphs":[{"index":1,"size":5,"text":"• Highest plants: Leucaena leucocephala "}]},{"head":"Conclusions:","index":25,"paragraphs":[{"index":1,"size":10,"text":"• Leucaena leucocephala and Gliricidia sepium show best agronomic results"},{"index":2,"size":16,"text":"• Leucaena leucocephala is suitable as an intercrop (alley) with the most productive legume Canavalia brasiliensis."}]},{"head":"Agronomic and production characteristics of five forage legumes in semi-arid conditions","index":26,"paragraphs":[{"index":1,"size":85,"text":"The experiment took place at the Finca \"Santa Rosa\" of UNA, altitude 80 masl, characterized by sandy loamy soils, with a pH from 6-7, with Organic Matter content of approx. 4% but low fertility (see Table 1 and Annex 4 for more details). The climate is sub-humid, with annual rainfall between 800 and 1200 mm, and a relative humidity between 60 and 90%. Treatments consisted of five forage legumes: three accessions of Vigna unguiculata (Verde Brasil, 9611 and IITA 284/2), Vigna radiata and Pueraria phaseoloides."}]},{"head":"Objectives","index":27,"paragraphs":[{"index":1,"size":15,"text":"General: assess the agronomic and production characteristics of five forage legumes in semiarid conditions Specific:"},{"index":2,"size":28,"text":"• determine the agronomic behaviour of five forage legumes • determine biomass production (fresh and dry), as well as production of seed • select the best performing species/accessions"}]},{"head":"Material and methods","index":28,"paragraphs":[{"index":1,"size":71,"text":"The experimental area (512 m 2 ) consisted of five plots, each of them was planted with a different forage legume in eight rows, with a distance of 0.4 m between rows and 0.3 m between plants. The agronomic variables were germination, growth, plant height, cover, pest and disease incidence. Production variables were biomass weight (fresh and dry) and seed production (number of pods per plant, number of seeds per pod)"}]},{"head":"Results","index":29,"paragraphs":[{"index":1,"size":55,"text":"Vigna unguiculata 9611 and IITA 284/2 showed both highest biomass and seed production, and a sustained growth even during the first part of the dry season. Biomass and seed production of Vigna unguiculata Verde Brasil was lowest. Pueraria phaseoloides established well but was attacked by pests (insects) leading to loss of the plot (Table 8). "}]},{"head":"Conclusions","index":30,"paragraphs":[{"index":1,"size":25,"text":"• The Vigna unguiculata accessions 9611 and IITA 284/2 are suitable materials for semiarid conditions, showing reasonable biomass and seed production and good pest resistance."}]},{"head":"On-farm and community research","index":31,"paragraphs":[{"index":1,"size":107,"text":"4.4.1 The behaviour of local and introduced legumes and their effect on maize during the growing period and after mulching This research was done by the MSc. student Diana Kurzweg in collaboration with UNA and took place in Pacora, a community of the municipality of San Francisco Libre situated approx. 30 km. north of Managua, close to lake Managua, with approximately 250 habitants in 50 families. The region is relatively dry, with an annual rainfall from 1000 -1200 mm (mainly during the wet season between May and October), usually with long dry spells. The soils are loamy and poor (N = 0.9 g/kg, P = 0.00 ppm)."}]},{"head":"Objective","index":32,"paragraphs":[{"index":1,"size":166,"text":"The objective was to investigate the behaviour of Canavalia brasiliensis (CIAT 17009) and Vigna unguiculata (9611) and their effect on maize production, in comparison to maize as a monocrop without and with fertilizer. Methods Both legumes were intercropped in rows between maize to observe their growth characteristics and their effect on the maize plants, when sown ten days after the maize and used as mulch at flowering. These treatments were compared to fertilized and unfertilised plots without legumes. The treatments are presented in Table 9. Expected outcomes included a dense plant cover to protect against erosion, to keep soil temperature low reducing evaporation, and to decrease growth of weeds. An additional treatment included cutting the legumes before flowering and using them as a mulch, in order to increase the amount of plant available nitrogen in the soil for the subsequent (maize) crop. Legume biomass and total N content were measured at the onset of the flowering stage for a first estimate of the potential N release."}]},{"head":"Results","index":33,"paragraphs":[{"index":1,"size":67,"text":"Average biomass production was 599 kg DM/ha for C. brasiliensis and 308 kg DM/ha for V. unguiculata. Although -because of unusual drought -these values are far lower than usual, the plants stayed green and vital throughout the experiment. No differences were found in maize yields between fertilized and unfertilized plots, even though the maize plants in the fertilized plots were higher and showed more resistance to wind."},{"index":2,"size":98,"text":"Additionally, a field trial was carried out comparing the performance of Canavalia brasiliensis CIAT 17009 with the three indigenous legume species Teramnus uncinatum, Macroptilium atropurpureum, Centrosema macrocarpum under local conditions. The three tested indigenous species showed good drought resistance and little vulnerability against pests and diseases once they were established. They performed however poorly in comparison with C. brasiliensis. Germination rates were low, as well as the survival rate during the initial stage and biomass production. Reasons were probably strong weed pressure (especially from Cyperus spp.), heavy pest attacks during the initial growth, low rainfall and poor soils."}]},{"head":"Conclusions:","index":34,"paragraphs":[{"index":1,"size":54,"text":"• The legumes Canavalia brasiliensis CIAT 17009 and Vigna unguiculata 9611 showed resistance against drought but did not directly affect maize production under unusual conditions of drought. Additional experiments would be needed to elaborate further on these results. • When compared to indigenous legumes, C. brasiliensis showed better resistance against weeds, pests and drought."}]},{"head":"Community analysis on development project activities, their effectiveness, lessons learned and success factors","index":35,"paragraphs":[{"index":1,"size":22,"text":"Additionally to the field trials, the MSc. student Diana Kurzweg carried out a community analysis during her four months' fieldwork. General objective:"},{"index":2,"size":18,"text":"To identify how and why local farmers participate in activities of research and development agencies at community-farm level."}]},{"head":"Methods:","index":36,"paragraphs":[{"index":1,"size":127,"text":"Qualitative formal and informal interviews were held with members of 14 families in Pacora on development project activities, their effectiveness, lessons learned and success factors. The research evaluates former rural development projects and influence of research that have been done in that village, including their impact on poverty reduction and contribution to protect natural resources. The focus was on transfer of knowledge, but also on donations and external influences in general. Reasons for success of projects as well as for failure are explained and recommendations for further work are given. Different types of projects are compared regarding their success. These types include top-down approaches, participatory research, farmer trainings, farmer-to-farmer programs, offered possibilities for farmer to do research on their own, implementation of local businesses, and on-site trials."}]},{"head":"Results:","index":37,"paragraphs":[{"index":1,"size":86,"text":"It was assumed that ecological obstacles for new crops were a reason for failure of transfer knowledge to the people. That means that people did not adopt new practices that aid agents tried to introduce, because in their case the practices just did not work convincingly. Adverse ecological conditions is one reason why people rarely implement new crops or cropping practices, such as use of legumes or planting of fruit trees and vegetables. However, various other obstacles have been detected leading to failure of projects, including:"},{"index":2,"size":203,"text":"• difficulties in spread of knowledge due to lack of communication and community feeling • difficulties to implement knowledge into daily life, for instance because big changes of routine are unusual -new methods are often perceived as too labour intensive, effects are usually not directly visible or only provide long-term benefits • techniques not adapted to the local situation • lack of (financial) resources implement new practices Livelihoods have not improved much due to lack of self-initiative from the community members, to lack of input of knowledge and ideas, a bias towards prestige and western values rather than basic principles for survival and a healthy life and external influences causing unwanted side-effects. The effect of the variety of different project approaches and research activities has generally been small. However, some contributions and knowledge have been accepted well by the people, and could partly contribute to protect natural resources, mainly because they fitted well in local practice and did not require much extra labour. The objective of the appraisal and workshop was to obtain and share information on native and introduces forage legumes, to improve farm management applying a combination of local knowledge and introduced technologies on use of forage legumes in dry conditions."}]},{"head":"Methods:","index":38,"paragraphs":[{"index":1,"size":44,"text":"The appraisal included the use of participatory tools like group meetings, semi-structured interviews and field visits and involved 5 students. The workshop consisted of a training on use of forage legumes. The activities were facilitated by the university teachers who participate in the project."},{"index":2,"size":71,"text":"Plant species and parts used as animal feed by the different farm animals were identified. Apart from this, 21 community members received a training on use and management of legumes. The PRA consisted of collecting, identifying and determining the use of the forage species, using the following elements as mentioned in Table 10: The results were analysed statistically and presented to the community to share, discuss and confirm the findings Results:"},{"index":3,"size":122,"text":"• A total of 16 shrub and 16 tree species were identified • Shrubs and trees are part of the diet of most livestock species, especially cattle and small ruminants • Most consumed shrubs are Palo Grande, Chagüite, Flor Amarilla, Zorrillo Blanco, Malva, Guacimito and Chilillo de Gallina • Most consumed trees are Leucaena (Leucaena leucocephala), Marango (Moringa oleifera), Guácimo de ternero (Guazuma ulmifolia), Brasil y Tamarindo (Tamarindus indica), of the fruits Marango (Moringa oleifera), Guácimo de ternero (Guazuma ulmifolia), Brasil, Tamarindo (Tamarindus indica) and Carbón (Acacia pennatula) • The components most consumed of shrubs are leaves (70%. The other parts (branches, flowers, fruits account each for approx. 10%). • The components most consumed of trees are leaves (55%) and fruits (45%)."}]},{"head":"Conclusions:","index":39,"paragraphs":[{"index":1,"size":31,"text":"Leaves of shrubs and trees are mainly eaten by cattle, followed by horses, goats and sheep. Branches (of shrubs) are predominantly consumed by cattle and goats, followed by horses and sheep."}]},{"head":"General observations and conclusions","index":40,"paragraphs":[{"index":1,"size":14,"text":"Table 11 provides an overview of the different sites and participants of the project. "}]},{"head":"X","index":41,"paragraphs":[{"index":1,"size":74,"text":"Farming systems research: Some data are still being analysed or need some further work and final results will become available by the end of 2010. However, it can already be concluded that this project has contributed significantly to increasing the understanding of the (potential) role of herbaceous legumes in mixed crop-livestock farming systems in Nicaragua, especially regarding their adaptability in conditions of drought and poor soils, and as intercrop with cereals (maize) and shrubs/trees."}]},{"head":"Capacity building:","index":42,"paragraphs":[{"index":1,"size":123,"text":"The project has contributed substantially to institutional and individual capacity development within the partner UNA (Universidad Nacional Agraria), in the form of graduated students (10) and involved staff members (3). Furthermore, two students from universities from the North (BOKU in collaboration with University of Potsdam, Germany, and University of Copenhagen) did their fieldwork as a basis of their MSc. graduation. As pointed out in the introduction, the project built on preceding activities in the research region (CIAT, UNA, local partners) based on farmers' issues on causes and interactions between crop management and soil resources. The involvement of BOKU (in the form of Prof. Freyer and participating MSc. students) has led to a strengthening of North-South cooperation between universities (BOKU-UNA) and research centers (BOKU-CIAT)."},{"index":2,"size":37,"text":"Research results (thesis, other publications) and developed capacities in the form of graduated students (UNA, BOKU, University of Potsdam, University of Copenhagen), staff (UNA) and farmers in the research areas are direct sustainable outcomes of the project."}]},{"head":"Dissemination of results:","index":43,"paragraphs":[{"index":1,"size":119,"text":"The project has a direct impact on over 20 farmers in the community of Pacora, participating in experiments, surveys and receiving training. Indirect impact can be expected from disseminated research results translated into extension messages for farmers, but above all use of these results as inputs for further research, contributions to content of curricula and other teaching materials, and project proposals. For instance, recently a new project partly based on ULLIS and named \"Eco-efficient crop and livestock production for the poor farmers in the sub-humid hillside areas of Nicaragua \", was started. The activity leans heavily on on-farm work, is funded by ADA and implemented by CIAT in collaboration with BOKU, UNA and the Nicaraguan Agricultural Research Institute -INTA."}]}],"figures":[{"text":"  "},{"text":"of the adaptability of 16 genotypes of forage legumes in the sub-humid zone of San Dionisio, Matagalpa General objective  Material and methods Material and methods The experiment was established in San Dionisio, Matagalpa, situated at 165 km from The experiment was established in San Dionisio, Matagalpa, situated at 165 km from Managua. The geographical coordinates are 12 o 45´ 45´´ latitude North and 85 o 51´ 10´´ Managua. The geographical coordinates are 12 o 45´ 45´´ latitude North and 85 o 51´ 10´´ longitude East. longitude East. The zone is semi-arid and characterized by extensive livestock keeping. The population is The zone is semi-arid and characterized by extensive livestock keeping. The population is poor and depends mainly on agriculture based on maize and beans. Annual rainfall varies poor and depends mainly on agriculture based on maize and beans. Annual rainfall varies usually between 800 and 1100 mm with peaks up to 1600 mm but distribution is unequal with usually between 800 and 1100 mm with peaks up to 1600 mm but distribution is unequal with a rainy season of maximally seven months. Average temperature varies between 22.5 and 25 a rainy season of maximally seven months. Average temperature varies between 22.5 and 25 o C (ITLAPLAN, 1996 cited by Barreto et al., 1997). o C (ITLAPLAN, 1996 cited by Barreto et al., 1997). Four soil types can be distinguished: alluvial soils, latosols, meteorized soils and forest soils. Four soil types can be distinguished: alluvial soils, latosols, meteorized soils and forest soils. In this region mollisols, inceptisols, entisols and alfisols predominate; soil depths vary from In this region mollisols, inceptisols, entisols and alfisols predominate; soil depths vary from shallow to deep. shallow to deep. Description of the experiment Description of the experiment A complete randomised block was established with 16 treatments and three replicates, the A complete randomised block was established with 16 treatments and three replicates, the total experiment area was 975 m 2 . The area of each plot was 3m* 4m = 12m 2 (useful area: 4.5 total experiment area was 975 m 2 . The area of each plot was 3m* 4m = 12m 2 (useful area: 4.5 m 2 . The treatments were: m 2 . The treatments were: • Vigna umbellata CIAT 24466, CIAT 4279, CIAT 24469, CIAT 466, CIAT 522, CIAT • Vigna umbellata CIAT 24466, CIAT 4279, CIAT 24469, CIAT 466, CIAT 522, CIAT 24360, and a local variety (\"Testigo\"): 24360, and a local variety (\"Testigo\"): • Vigna unguiculata INTA 1, INTA 2, IITA 715, IITA 573-5 • Vigna unguiculata INTA 1, INTA 2, IITA 715, IITA 573-5 • Lablab purpureus CIAT 52535, Highworth, CIAT 21603 • Lablab purpureus CIAT 52535, Highworth, CIAT 21603  "},{"text":"Table 1 : Soil characteristics of Santa Rosa and Niquinohomo Agropecológico en Especies Menores\" Ebenezer (RAEME), is situated in the municipality of Niquinohomo, Masaya Department at an altitude of 400 masl, an average rainfall of 1,200 mm most of which falls in the rainy season from July to November. Soils are clay loam with an effective depth of 40 cm. Main purpose is breeding of small livestock goats (Nubia), sheep (Pelibuey), rabbits, pigs and poultry. Around 7 ha are used as pasture and small household gardens. Faculty of Natural Resources (FARENA) Faculty of Natural Resources (FARENA) Dr. Emilio Pérez Castellón Dr. Emilio Pérez Castellón  "},{"text":"Table 3 : Legume biomass production (DM, in kg/ha) at Santa Rosa and Niquinohomo  Treatment Santa Rosa Niquinohomo TreatmentSanta RosaNiquinohomo Canavalia brasiliensis CIAT 17009 2017 950 Canavalia brasiliensis CIAT 170092017950 Centrosema plumieri 554 79 Centrosema plumieri55479 Clitoria ternatea 439 8 Clitoria ternatea4398 Lablab purpureus 2 3140 962 Lablab purpureus 23140962 Lablab purpureus CIAT 21603 2454 693 Lablab purpureus CIAT 216032454693 Lablab purpureus CPI106471 1656 399 Lablab purpureus CPI1064711656399 Lablab purpureus CPI-676 1866 622 Lablab purpureus CPI-6761866622 Lablab purpureus CQ-2975 1865 269 Lablab purpureus CQ-29751865269 Vigna umbellata CIAT 24360 1746 290 Vigna umbellata CIAT 243601746290 Vigna umbellata CIAT 26469 91 4 Vigna umbellata CIAT 26469914 Vigna unguiculata IITA 131-2 1931 635 Vigna unguiculata IITA 131-21931635 Vigna unguiculata IITA 284/2 1446 1124 Vigna unguiculata IITA 284/214461124 Vigna unguiculata IITA 390/2 131 197 Vigna unguiculata IITA 390/2131197 Vigna unguiculata 9611 846 177 Vigna unguiculata 9611846177 Vigna unguiculata Verde Brasil 1772 1486 Vigna unguiculata Verde Brasil17721486 Vigna unguiculata FHIA 386 214 Vigna unguiculata FHIA386214  "},{"text":"Table 4 : Legume N-content  Treatment N content (%) Duncan* TreatmentN content (%)Duncan* Canavalia brasiliensis CIAT 17009 2.94 a b Canavalia brasiliensis CIAT 170092.94a b Centrosema plumieri 2.07 c d Centrosema plumieri2.07c d Clitoria ternatea 2.70 a b c Clitoria ternatea2.70a b c Lablab purpureus 2 2.74 a b c Lablab purpureus 22.74a b c Lablab purpureus CIAT 21603 2.81 a b c Lablab purpureus CIAT 216032.81a b c Lablab purpureus CPI106471 2.34 a b c d Lablab purpureus CPI1064712.34a b c d Lablab purpureus CPI-676 3.00 a Lablab purpureus CPI-6763.00a Lablab purpureus CQ-2975 2.77 a b c Lablab purpureus CQ-29752.77a b c Vigna umbellata CIAT 24360 1.97 c d Vigna umbellata CIAT 243601.97c d Vigna umbellata CIAT 26469 1.63 d Vigna umbellata CIAT 264691.63d Vigna unguiculata IITA 131-2 1.80 d Vigna unguiculata IITA 131-21.80d Vigna unguiculata IITA 284/2 1.81 d Vigna unguiculata IITA 284/21.81d Vigna unguiculata IITA 390/2 2.14 b c Vigna unguiculata IITA 390/22.14b c Vigna unguiculata 9611 2.19 a b c d Vigna unguiculata 96112.19a b c d Vigna unguiculata Verde Brasil 2.34 a b c d Vigna unguiculata Verde Brasil2.34a b c d Vigna unguiculata FHIA 2.02 c d Vigna unguiculata FHIA2.02c d  "},{"text":"Table 5 : Maize height at Santa Rosa and Niquinohomo   Santa Rosa Niquinohomo Santa RosaNiquinohomo Treatment height (cm) Duncan* height (cm) Duncan* Treatmentheight (cm)Duncan*height (cm)Duncan* Canavalia brasiliensis CIAT 17009 138.53 c d e 61.74 e f g Canavalia brasiliensis CIAT 17009138.53c d e61.74e f g Centrosema plumieri 125.54 f e g 70.03 b c d e Centrosema plumieri125.54f e g70.03b c d e Clitoria ternatea 159.2 a b 74.92 b c Clitoria ternatea159.2a b74.92b c Lablab purpureus 2 139.21 c d e 86.73 a Lablab purpureus 2139.21c d e86.73a Lablab purpureus CIAT 21603 144.07 c 66.43 d e f Lablab purpureus CIAT 21603144.07c66.43d e f Lablab purpureus CPI106471 150.6 b c 71.31 b c d Lablab purpureus CPI106471150.6b c71.31b c d Lablab purpureus CPI-676 151.46 b c 72.85 bc Lablab purpureus CPI-676151.46b c72.85bc Lablab purpureus CQ-2975 148.84 b c 67.8 c d e f Lablab purpureus CQ-2975148.84b c67.8c d e f Vigna umbellata CIAT 24360 117.18 f g 64.47 d e f Vigna umbellata CIAT 24360117.18f g64.47d e f Vigna umbellata CIAT 26469 128.87 d e f 64.71 d e f Vigna umbellata CIAT 26469128.87d e f64.71d e f Vigna unguiculata IITA 131-2 160.23 a b 65.35 d e f Vigna unguiculata IITA 131-2160.23a b65.35d e f Vigna unguiculata IITA 284/2 167.98 a b 77.08 b Vigna unguiculata IITA 284/2167.98a b77.08b Vigna unguiculata IITA 390/2 142.52 d c d 61.23 f g Vigna unguiculata IITA 390/2142.52d c d61.23f g Vigna unguiculata 9611 137.46 c d e 59.78 f g Vigna unguiculata 9611137.46c d e59.78f g Vigna unguiculata Verde Brasil 139.9 c d e 71.41 b c d Vigna unguiculata Verde Brasil139.9c d e71.41b c d Vigna unguiculata FHIA 113.73 g 65.65 d e f Vigna unguiculata FHIA113.73g65.65d e f no intercrop (local check) 120.03 f g 55.54 g no intercrop (local check)120.03f g55.54g  "},{"text":"Table 7 : Soil characteristics of \"El Plantel\"   depth pH OM N P K Ca Mg clay loam sand texture depthpHOMNPKCaMgclayloamsandtexture  cm  %  ppm  me / 100 soil   %  class cm%ppmme / 100 soil%class El Plantel 0-15 6.77 2.4 0.12 12.1 1.09 25.03 11.25 34 34 32 clay-loam El Plantel0-156.772.4 0.12 12.11.0925.03 11.25343432clay-loam  0-30 6.88 1.8 0.09 2.5 0.90 25.73 11.28 34 34 23 0-306.881.8 0.09 2.50.9025.73 11.28343423  "},{"text":" Canavalia brasiliensis was highest in plots associated with Leucaena leucocephala • Biomass of Calopogonium sp was highest in plots associated with Gliricidia sepium, lowest with Caesalpinia velutina.  "},{"text":"Table 8 : Biomass and seed production of five forage legumes  Accession Biomass production (DM Seed production (kg/ha) AccessionBiomass production (DMSeed production (kg/ha)  kg/ha)  kg/ha) Vigna unguiculata Verde Brasil 250 0 Vigna unguiculata Verde Brasil2500 Vigna unguiculata 9611 1300 480 Vigna unguiculata 96111300480 Vigna unguiculata IITA 284/2 1150 465 Vigna unguiculata IITA 284/21150465 Vigna radiata 650 200 Vigna radiata650200 Pueraria phaseoloides n/a (pests) n/a (pests) Pueraria phaseoloidesn/a (pests)n/a (pests)  "},{"text":"Table 9 : Treatments of intercropping experiment in Pacora  Treatment Treatment  "},{"text":"Table 10 : Elements of PRA on use of forage legumes for animal feed  Plant type: Shrub, Shrub    Plant type: Shrub, Shrub Type of animal Leaves Branches Flowers Fruits Season Observations Type of animalLeavesBranches Flowers FruitsSeasonObservations Cattle     Cattle Horse     Horse Goat     Goat Sheep     Sheep Pig     Pig Rabbit     Rabbit Poultry     Poultry  "},{"text":"Table 11 : Sites and participants of research components   Nr. of San Sta Rosa El Rancho Pacora (San El Plantel Nr. ofSanSta RosaEl RanchoPacora (SanEl Plantel  students Dionisio (farm UNA) (Niquinohomo) Francisco (farm UNA) studentsDionisio(farm UNA)(Niquinohomo)Francisco(farm UNA)      Libre) Libre) herbaceous 1 (Univ. of     herbaceous1 (Univ. of legumes / Copenhagen),     legumes /Copenhagen), adaptability + N-fixing + 3 (Fac. of Agronomy) X    adaptability + N-fixing+ 3 (Fac. of Agronomy)X potential      potential adoption 1 (Univ. of     adoption1 (Univ. of potential of organic farming Copenhagen), + 3 (Fac. of X    potential of organic farmingCopenhagen), + 3 (Fac. ofX  Agronomy)     Agronomy) herbaceous 2 (Fac. of     herbaceous2 (Fac. of legumes / maize Natural Resources)  X X  legumes / maizeNatural Resources)XX leguminous 2 (Fac. of     leguminous2 (Fac. of shrubs / maize Natural Resources)     X shrubs / maizeNatural Resources)X herbaceous 2 (Fac. of     herbaceous2 (Fac. of legumes / animal Animal Sciences)  X   legumes / animalAnimal Sciences)X production      production intercropping 1 (University     intercropping1 (University maize with Vigna and of Potsdam -BOKU)    X maize with Vigna andof Potsdam -BOKU)X Canavalia      Canavalia diagnosis, several (Fac.     diagnosis,several (Fac. workshops etc. of Natural     workshops etc.of Natural with farmer Resources)     with farmerResources) groups      groups  "}],"sieverID":"9551228e-f43c-45eb-ba0b-a63edbe1879b","abstract":"systems ULLIS Glenda Bonilla (MIS/UNA) Emilio Perez (UNA) Carlos Ruiz (UNA) Rein van der Hoek (CIAT) Diana Kurzweg (BOKU) Bernhard Freyer (BOKU) University of Natural Resources and Applied Life Sciences (BOKU) Universidad Nacional Agraria (MIS/UNA) Centro Internacional de Agricultura Tropical (CIAT)Table of contents Acknowledgements ."}

data/part_1/0a7cd00a454eaff1823b0250b033cf4a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a7cd00a454eaff1823b0250b033cf4a","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/26/4195_FISH-2017-08.pdf"},"pageCount":32,"title":"Aquaculture in Zambia: An overview and evaluation of the sector's responsiveness to the needs of the poor Authors","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":165,"text":"Countries in Africa have been touted for their high aquaculture potential based on land and water availability, ideal temperatures and animal husbandry and agricultural practices (Brummet et al. 2008;Kaspetsky 1994;Aguilar-Manjarrez and Nath 1998). Increased production of farmed fish could help improve the food and nutrition insecurity situation in many of these countries and contribute positively to overall economic growth (Brummet and Williams 2000;Beveridge et al. 2010). Despite the potential, the development of aquaculture in most African countries has been sluggish compared to other regions, mostly because of weak infrastructure, markets, government policies and a lack of knowledge and skills to build the sector (Brummet et al. 2008). The total share of global production is still only 2.3%, with production in Egypt making up the bulk of the total output (FAO 2016). Recently, however, aquaculture production in sub-Saharan Africa has increased at an annual average growth rate of 12.6%, and there is evidence of commercial growth in certain countries such as Nigeria, Ghana, Uganda and Kenya."},{"index":2,"size":151,"text":"A similarly positive trend can also be seen in Zambia, which has become the sixth-largest producer of farmed fish in Africa. In the 1980s, the farmed fish production was reported to be around 750 t, of which 86 t (11.5%) were produced by small-scale rural fish farmers, 94 t (12.5%) by government fish culture stations and 570 t (76%) by private larger-scale farmers (Mudenda 2009). By 2014, aquaculture in Zambia grew to a total output of 20,000 t, with three quarters of production coming from the commercial sector, namely intensive pond-based rearing units and cage culture. Zambia is the biggest producer of tilapia in the South African Development Community (SADC), and some of the largest freshwater commercial farms in Africa operate in Zambia (FAO 2016). The value chain is made up almost entirely of tilapia, and in recent times, there have been large investments made into the seed and feed sectors."},{"index":3,"size":84,"text":"Much of the development of the small-scale sector in Zambia was and still is supported by national and international development programs (Mudenda 2009;Harrison 1996). While the promotion of aquaculture was prioritized for the small-scale sector through interventionist methods and to boost household fish consumption and food and nutrition security, new approaches today recognize the growing importance of promoting aquaculture as an enterprise. It is believed that pursuing aquaculture as a business would enable farmers to sustainably manage their systems for increased incomes (Edwards 2000)."},{"index":4,"size":124,"text":"In 2017, the African Development Bank (AfDB) 1 approved a loan for the Zambian government to implement the Zambia Aquaculture Enterprise Development Project (ZAEDP) to present the aquaculture subsector as a viable and inclusive business opportunity for small-to medium-sized farmers and enhance production and productivity for improved livelihoods along the aquaculture value chain. From an economic perspective, increased uptake of aquaculture by small-scale farmers could help increase per capita income, diversify livelihoods and combat poverty, as seen in the case of Ghana (Kassam 2013;Kassam and Dorward 2017). This is of critical importance given that in 2015, 54.4% of the population lived below the poverty line (76.6% in rural areas and 23.4% in urban areas) and 40.8% of people were considered extremely poor (CSO 2016)."},{"index":5,"size":141,"text":"Broadly, an increase in crop, livestock or fish production could result in more stable prices of these commodities (Haddad 2000) and, therefore, become more available and accessible for people who are not directly involved in production (Toufique and Belton 2014). A higher intake of fish, for example, can have a positive impact on human health as fish is not only rich in protein but also in fatty acids, micronutrients and vitamins, such as zinc, iron and calcium and vitamins A, B and B12 (Roos et al. 2006;Kawarazuka and Béné 2010;Zhao et al. 2016). Thus, from a health perspective, increased fish consumption among the poor could help reduce the high prevalence of chronic and acute malnutrition, which is particularly pertinent in Zambia, where 45% of children under 5 years of age are stunted, 15% are underweight and 6% are wasted (UNICEF 2013)."},{"index":6,"size":75,"text":"Given this wider context and the recent expansion and commercialization of aquaculture in Zambia, an important question that needs to be explored is how have the recent changes in the Zambian aquaculture sector contributed to the needs of the poor? The aim of this report is to (a) outline the current trajectory of aquaculture development in Zambia and (b) evaluate whether these development efforts are inclusive of and responsive to the needs of the poor."},{"index":7,"size":140,"text":"Figure 1 presents a schematic to further explain how aquaculture development efforts can help meet the needs of resource poor people, enabling them to benefit from their involvement in activities throughout the aquaculture value chain. There are many points of entry through which resource poor people can benefit from developments in the aquaculture sector. First, they can directly benefit through upstream or downstream activities in the value chain, i.e. through production or from postharvest activities. For instance, the increased production and sale of fish by largescale farms/wholesalers could subsequently increase the supply of cheaper fish and create jobs (both formal and \"informal\"). In addition, larger-scale hatcheries, feed mills and other input suppliers could invest in improving the availability and quality of seed, feed and other aquaculture inputs (e.g. lime, cages, hapa material, etc.), thereby making it more feasible and less"}]},{"head":"Analytical framework","index":2,"paragraphs":[{"index":1,"size":131,"text":"Aquaculture is often promoted as one means of enabling small-scale farmers to improve their economic, food and nutrition security (Harrison 1996;Lewis 1997;Edwards 2000). Stevenson et al. (2009) attempted to systematically explore whether involvement in aquaculture is linked with poverty alleviation. In line with a range of research findings (Edwards 2000;Ahmed and Lorica 2002;Kassam 2013;Toufique and Belton 2014), participation in aquaculture by resource poor farmers derives benefits through \"income\", \"employment\" and \"consumption\" pathways. Beveridge et al. (2013) refer to the contribution of fish to improved household food and nutrition security of resource poor consumers as a function of increasing the availability of fish, people's access to fish and ensuring fish preferences are accommodated, all of which are important factors that must be considered in the production and sale of farmed fish products."},{"index":2,"size":128,"text":"Figure 1. Pro-poor aquaculture framework (Genschick et al. in prep). Water and sanitation capital-intensive for small-scale farmers to get involved in production. Second, resource poor consumers can indirectly benefit from aquaculture development efforts by accessing fish that have been processed following improved food safety standards such as safer packaging with appropriate and easy-to-understand nutrition information. Growth in the aquaculture sector can also have significant impacts on women and youth empowerment outcomes, and in particular, increasing women's access to appropriate/lower-cost technologies or creating opportunities for youth to gain skills and knowledge by working as laborers on commercial farms. However, without direct policies and stakeholder involvement to ensure these benefits are realized, aquaculture development runs the risk of being highly exclusionary, especially in low-income settings (see Belton and Little 2011)."},{"index":3,"size":156,"text":"For this report, we use the framework above to evaluate Zambia's current aquaculture growth trajectory and especially its ability to provide direct benefits (e.g. increased incomes, employment opportunities and access to fish) to resource poor farmers and consumers. Secondary literature sources were reviewed, including government reports and the published scholarly and grey literature. Participant observation and years of experience working in the sector by the authors of this report were also drawn on to enrich the analysis and fill in some gaps when the secondary literature was unable to supply it. Given the relatively nascent state of aquaculture growth and development in Zambia, very little information or research on the indirect benefits of aquaculture exists in the secondary literature. Thus a key recommendation from our review suggests that more research is needed to adequately determine the overall benefits (both direct and indirect) that aquaculture development efforts have brought about, especially for resource poor farmers and consumers."},{"index":4,"size":9,"text":"Small-scale farmer training at Misamfu Aquaculture Research Station, Kasama."}]},{"head":"Aquaculture sector overview in Zambia","index":3,"paragraphs":[{"index":1,"size":106,"text":"A typology of aquaculture production systems used in Africa is differentiated by their extensive, semiintensive and intensive nature, as seen in Table 1 (adapted from Hecht 2007). Systems fall between an extensive and intensive continuum based on the technologies, species and level of capital investment, labor and management practices they employ. These three systems exist in Zambia; however, the Zambian government characterizes them using a rather narrow typology, either as small-scale or large-scale production systems. This characterization creates a somewhat blurry line between extensive and intensive systems used by small-to medium-sized enterprises and fails to account for fish that is cultivated for subsistence versus commercial purposes."},{"index":2,"size":91,"text":"During the years 2004-2014, the overall aquaculture production yield showed a positive upward trend in Zambia (Figure 2), almost doubling and thus providing an important source of fish that was traditionally only available from capture fisheries in Zambia. Small-scale aquaculture had, until recently, dominated the sector, though mostly for subsistence purposes with little impact on total fish supply for ordinary consumers. Today, the large-scale, commercial sector is rapidly expanding and overtaking the small-scale sector in total output providing hundreds of tons of fish weekly to consumers, albeit mostly in urban areas."},{"index":3,"size":172,"text":"The rapid growth in the large-scale commercial sector is largely responsible for the increase in aquaculture production in the past few years. The sudden production increase from 12,988 t in 2012 to 20,271 t in 2013 was exclusively attributed to the expansion of entrepreneurial aquaculture, particularly in the cageculture sector on Lake Kariba and from large-scale pond-based enterprises (DoF 2015). The relevance of the large-scale commercial sector is becoming even more apparent considering that the small-scale sector faced a 27% drop in production between 2011 (4060 t) and 2014 (2954 t) (DoF 2012 and2015). Large-scale commercial aquaculture (land-based and cages) accounted for the largest contribution (71%) to the estimated overall aquaculture production in 2014, as seen in Figure 2 (DoF 2015). Extensive systems, such as small-scale ponds and stocking small water bodies or dams, accounted for only 29% of total estimated production. This has been a remarkable shift in the source of production, whereby less than 10 years ago the small-scale sector was producing about 75% of total aquaculture production in Zambia."}]},{"head":"Extensive aquaculture systems","index":4,"paragraphs":[{"index":1,"size":99,"text":"The small-scale sector can be defined as using a range of systems between extensive and semiintensive, encompassing anything from rudimentary earthen pond systems that are extensive in nature (no intentional nutritional inputs to feed the system) to semi-intensive pond systems that-through fertilization and/or use of supplementary feedprovide a farmer with fish for household consumption and/or income (see Edwards and Demaine 1997 for a description of these types of systems). Productivity is generally low in such systems in Zambia, depending on farm byproducts and seasons, as farmers attempt to balance fish farming with crop and vegetable production and livestock rearing."}]},{"head":"Small-scale pond aquaculture","index":5,"paragraphs":[{"index":1,"size":160,"text":"Estimates show that small-scale aquaculture is scattered throughout Zambia in all 10 provinces with a total of 12,010 farmers engaged in fish production in 2014. The largest numbers of small-scale farmers are found in Northern and North-Western Provinces (see Table 2), where, according to DoF statistics, farmers produce the highest output. The number of smallscale farmers in a province or district is attributed in part to the presence of the DoF and the availability of extension services and/or government-run aquaculture research stations that also act as the main source of seed in most provinces. Access to perennial sources of water also impacts the number of smallscale farmers in a given province or district. Small-scale aquaculture is more likely to be adopted based on the capacities of extension officers or development agencies to impart knowledge on how to farm fish rather than on the economic viability of engaging in aquaculture, such as whether or not output markets are accessible (Mudenda 2009)."},{"index":2,"size":130,"text":"While provinces like Northern or North-Western have higher total production as a result of the large number of farmers, farm productivity per hectare is higher in Lusaka, Luapala and Copperbelt provinces. The proximity to extension services and a multitude of private enterprise actors and service providers can better support the smallscale sector, especially in the more urbanized Lusaka and Copperbelt provinces. The close links to output markets around these provinces also favor the integration of small-scale farmers into formal market value chains. In Northern or Eastern Province where there are much smaller urban markets and a larger geographical spread between farmers, access to input and output markets is generally lower, and thus the farming landscape is made up of mostly rural, resource poor farmers producing for subsistence or basic incomes."},{"index":3,"size":59,"text":"Figure As shown in Table 2, the overall output from smallscale aquaculture is estimated at 2,954 t from a total of 12,010 registered farmers in 2014. In comparison to previous years, it is evident that estimated output from small-scale aquaculture has declined strongly (27%), when production was estimated to be higher in 2010 (3985 t) and 2011 (4060 t)."},{"index":4,"size":220,"text":"A survey of farmers in Northern Province conducted by Nsonga (2015) found that most farmers were concerned about input and production constraints, such as inadequate quality of fingerlings, insufficient animal manure, lack of affordable fish feed, insufficient extension services and a lack of mobility to access markets from remote and often isolated pond sites. While numerous government policies and development agencies have attempted to develop and sustain the sector through extension projects, capacity building or the supply of inputs (fingerlings and feed), many projects have not made a significant impact developing the small-scale sector, mostly because of a lack of being able to provide sustainable options after the implementation phase. Musuksa and Musonda (2013) have found that a reliance on subsidized inputs without effective linkages to long-term government-run extension services fails to sustain the skills and inputs required to reach an optimal level of productivity in the rural fish-farming sector in Zambia. This is the case in other case studies across Africa (Brummet et al. 2008). With aquaculture being one of many farming activities for most smallscale farmers, and without the presence of a more integrated value chain with private actors (who can provide inputs and services), farmers tend to have low productivity or lose interest altogether and abandon their ponds (several fisheries officers in Northern Province personal communication, 2016)."},{"index":5,"size":232,"text":"The most recent estimations made by the DoF on small-scale aquaculture production for 2014 are based on four assumptions: (1) an average stocking density of 3 fish per m 2 , (2) fish harvested at a weight of 250 g, (3) one production cycle per year for farmers and (4) a 10% mortality rate (DoF 2015). According to this formula, per ha productivity in small-scale aquaculture is estimated to be 6.75 t/ha. In accordance with the variation in the number of farmers per province, average farm productivity varies from 0.02 t to 0.79 t/ ha with an average of 1.8 ponds per farmer, totaling an average of 230 m 2 (circa 23 x 10 m) that is under production (Table 2). The DoF acknowledges the limitations in collecting data from over 12,000 farmers countrywide, with limited funding and human resources. Subsistence farmers in impoverished areas are likely to be motivated by irregular and need-driven harvest regimes for consumption and immediate incomes, making the timing of data collection difficult as well. There are also no clear seasons in small-scale aquaculture with some farmers stocking ponds in the warmer months while others prefer to stock in the winter months when there are less crop and vegetable activities. Because of the absence of recordkeeping, funding, a lack of extension officers and accurate monitoring, an assessment of production output is very difficult to make (DoF 2015)."},{"index":6,"size":84,"text":"In a study with over 170 farmers in Northern Province, Nsonga (2015) found that small-scale farmers produce an average of 2 t/ha, while for North-Western Province, Simataa and Musuka (2013) found that 53% of smallscale farmers produce up to 1.5 t/ha, 37% produce between 1.6-4.5 t/ha and only 9% produce between 4.6-6 t/ha. It is worth noting that these productivity numbers were obtained from small-scale farmers in Zambia using a recall method and thus could be Table 2. Small-scale aquaculture production 2014 (DoF 2015)."},{"index":7,"size":140,"text":"severely low or inflated. It is worth noting that a range of productivity is expected for small-scale farmers, based on the typology presented in Table 1, where the sector runs along a spectrum from those who have access to few inputs and resources and therefore dig and manage ponds mostly for subsistence and household consumption, to those who have access to some services and inputs and attempt to target more formal markets. The SAAP (2014) report suggests that farmers with little or no inputs can reach an average productivity of 1.08 t/ha, while those having some limited access to inputs can reach an average of 3.1 t/ ha. This suggests that an average productivity of 6.75 t/ha ascribed by the government to roughly 12,000 farmers in the country, and the total output from small-scale farmers, is probably an overestimation. 2"}]},{"head":"Intensive aquaculture","index":6,"paragraphs":[{"index":1,"size":218,"text":"Intensive aquaculture is largely defined as entrepreneurial (commercial) farming in the form of diversifying cash crops by shifting some capital out of traditional agriculture to aquaculture (Brummet et al. 2008) or placing investments solely in different aquaculture technologies, most often in large-scale, land-and/or tank-based pond systems, raceways or cages in rivers and lakes. Large-scale aquaculture in Zambia has a relatively short history compared to extensive small-scale aquaculture. The colonial authorities of Northern Rhodesia (present-day Zambia) established two fish culture stations in the 1950s (Mudenda 2006). The Zambian government added several more fingerling production stations in the 1960s and 1970s that serviced a select few commercial farmers who grew fish using agricultural and livestock byproducts. It was not until the late 1980s and 1990s, after a few donor-supported development projects strived to increase the agricultural productivity of rural farmers, that the private sector started to take notice of the potential for fish farming, learning especially from their southern neighbor, Zimbabwe (Mudenda 2006). Today the commercial sector is largely located in the south of the country in Lusaka and Southern Provinces. Cage culture farming is situated mostly around Lake Kariba with large-scale intensive landbased enterprises located around the Kafue Flats. The majority of production from the commercial sector still comes from land-based pond operators, though cage culture is growing rapidly."},{"index":2,"size":26,"text":"Some of the biggest land-based intensive fish farms today, such as Kafue Fisheries Ltd, started fish farming to recycle and use the metabolic waste from piggeries."},{"index":3,"size":13,"text":"Other farms, like Kalimba Farms, integrate crocodiles and tilapia production (Mudenda 2006;SAPP 2014)."},{"index":4,"size":125,"text":"In the 1990s, there were only three cages in Siavonga District in Lake Kariba. Aquaculture in the early 1990s was a fringe activity for most enterprises. On the other side of Lake Kariba, in Zimbabwe, cage culture had started growing rapidly in the 1990s with a total yield of 3500 t compared to Zambia's reported 30 t from cage culture (Halwart et al. 2007). By 1996, as little as 1500 t was being produced by the whole private sector in Zambia compared to an estimated 13,600 t in 2014. This translates to an annual growth of 11.56%, going from less than 5% of the total fish catch in Zambia (including capture fisheries) in the 1990s to more than 20% of the fish supply in 2014."}]},{"head":"Land-based commercial aquaculture","index":7,"paragraphs":[{"index":1,"size":121,"text":"In 2014, there were over 20 intensive land-based commercial farmers in Zambia covering 216 ha countrywide. Land-based large-scale commercial farmers in Zambia are defined as those who employ intensive pond (or tank) culture, stocking mono-sex seed at higher stocking densities and who rely on the use of artificial feeds and make greater capital and labor investments. Intensive land-based systems include the construction of sophisticated earthen ponds and/or concrete or plastic water holding facilities. Production systems are usually distinguished in terms of size between 100 and 10,000 m 2 with a stocking density of around 3-5 fish per m 2 and a productivity of between 15-18 t/ha, with the average for commercial tilapia growth in Africa being around 16 t/ha (Jamu 2001)."},{"index":2,"size":148,"text":"In Zambia, aquaculture practices employed by largescale commercial farmers vary, depending on stocking densities, tank or pond parameters and the types of species cultured. The use of artificial or organic fertilizers and feeds may differ as well. For the most part, however, there is a preference for monoculture of species with a few polyculture and shellfish enterprises existing as well. Generally, farmers of all sizes are legally permitted to farm Nile tilapia (Oreochromis niloticus) in certain areas of the country and only if permits are obtained. Farmers also cultivate local species such as the three-spotted bream (Oreochromis andersonii), the greenhead bream (Oreochromis macrochir), the redbreast bream (Coptodon rendalli) and the Tanganyika bream (Oreochromis tanganicae), with the majority growing these species because they are located in areas where the cultivation of O. niloticus is banned or because they are the only type of seed available, usually from government hatcheries."},{"index":3,"size":32,"text":"Given that most large-scale commercial farms are located in areas where the cultivation of O. niloticus is permitted, it can be argued that the policy might Figure 3. Aquaculture landscape in Zambia."},{"index":4,"size":5,"text":"12 Lusaka Province: Some medium- "}]},{"head":"Cage aquaculture","index":8,"paragraphs":[{"index":1,"size":152,"text":"On Lake Kariba, intensive cage fish farming was introduced in the late 1990s using O. niloticus. Today, there are more than 100 cages on Lake Kariba, up from only three in the late 1990s. Many operators still regard the high cost of formulated feeds, access to high quality seeds and the need for expensive EIAs as obstacles to the growth of the sector in Zambia. However, the introduction of two major companies, Kariba Harvest (a subsidiary of the Zimbabwean aquaculture giant Lake Harvest Ltd) and Yalelo in 2011, has transformed the sector. The latter injected USD 2.3 million and the former remains the biggest multinational cage culture producer in Africa. Together, they amount to 85% of total volume of cages on Lake Kariba in 2014. Lake Harvest Ltd alone produced about 2000 t of the 3805 t in 2014, and Yalelo aims to produce over 6000 t by the end of 2017."},{"index":2,"size":68,"text":"The arrival of these two players has dramatically altered the value chain and established cage culture in Zambia with an estimated production going from only 30 t in the late 1990s up to an estimated 4000 t in 2015 (DoF 2015). This is expected to have increased to over 8000 t in 2017, though yet to be verified in government reports. The growth of the sector has led"},{"index":3,"size":8,"text":"Large-scale cage culture on Lake Kariba, Yalelo, Siavonga."},{"index":4,"size":187,"text":"13 Photo credit: Steven Cole/WorldFish some companies to expand, such as Yalelo investing in an out-grower scheme called Kambashi Fisheries in Chilubi on Lake Bangweulu (farming O. macrochir) in an effort to measure the viability of cage culture in other water bodies and expand the sector. Lake Kariba is not the only cage-culture site: Mpende Fisheries, located on the shores of Lake Tanganyika, produces around 200 t of O. tanganicae in cages every year. Lake Harvest Ltd operates its own hatchery and selective breeding facility and owns a state of the art processing plant in Zimbabwe, which produces fresh fillets for air shipment to high-end markets in Europe (Brummet et al. 2008). Lake Harvest Ltd in Zimbabwe exports tilapia to suppliers in South Africa, Zambia, Botswana, Malawi and even the UK, though sales to Europe only make up 5% of its total sales (Corsin et al. 2010). Prices in regional and domestic markets can now be higher than in Europe, and companies are focusing on marketing their products in Africa (Cocker 2014) with Kariba Harvest in Siavonga producing almost entirely for the Lusaka and Copperbelt provincial markets."},{"index":5,"size":192,"text":"Intensive cage culture in other water bodies has yet to take off as it has in Siavonga, on Lake Kariba, and some major challenges including capital investment, infrastructure, breeding capabilities, proximity to larger urban markets and access to high quality feed and seed still inhibit expansion. In places such as Northern and Luapula provinces, the proximity to major capture fisheries such as Bangweulu, Tanganyika, Mweru and Mweru-Wantipa mean that cheaper wild fish is readily available to supply local markets. This combined with the recent introduction of cheap imports of Chinese tilapia make it difficult for small-and medium-scale enterprises (SMEs) to establish lucrative markets for locally produced farmed fish. This might be a further reason why the largescale, commercial sector has yet to establish itself in these areas where cheaper imported fish seem to penetrate through the likes of extensive retail outlets such as those owned by Capital Fisheries Ltd, who import and distribute fish around the country. The proximity of places such as Lake Kariba to urban markets makes it more attractive for intensive aquaculture (and in particular cage culture), meaning that almost all production from cage culture comes from Southern Province."}]},{"head":"Seed supply","index":9,"paragraphs":[]},{"head":"Hatcheries and farmer-to-farmer networks","index":10,"paragraphs":[{"index":1,"size":299,"text":"Difficulties in accessing secure supplies of high quality feed and seed are often described as the biggest barriers to aquaculture development in Africa (Dey et al. 2006;Hecht 2006;Brummett et al. 2008;Beveridge et al. 2010). The fish seed supply sector in Zambia has experienced major changes over the past decade. In the past, there were only nine state hatcheries that supplied the entire aquaculture sector with mixed-sex tilapia fingerlings. Today, the growth of commercial aquaculture has seen large-scale aquaculture producers developing their own hatcheries that produce mixed-sex and male sex-reversed fingerlings for grow-out purposes. Through on-site hatchery production (a form of vertical integration), some largescale producers have more control over costs, quality and continuity in supply by producing their own seed. This is a major trend for commercial operators in Zambia. The core business of a commercial operator is thus defined by the production of fry and fingerlings, either for their own grow-out or for selling to small-to medium-sized farmers, with most companies favoring the former, while only four operators have found niches in the latter. Palabana Fisheries has, for instance, begun supplying tilapia fingerlings (mostly O. niloticus) to small-scale farmers located in close proximity to the company through out-grower schemes that attempt to stimulate the small-scale sector. This out-grower scheme was tested and funded by the Swedish International Development Cooperation This was confirmed by a small-scale fish farm survey (Kaminski et al. In press) that attempted to uncover the main source of fingerlings of such farms in Northern Province. The same study also collected data on the fingerling sales from a state-run hatchery in the province to investigate where fingerlings were being sold and how they were being distributed. The results show that the main sources of fingerlings for small-Hatchery producing native O. tanganicae, Great Lake Products Ltd, Mpulungu."},{"index":2,"size":146,"text":"scale farmers in Northern Province are neighboring farmers (44% of respondents), development projects (24%), natural sources (16%), and directly from the state-run hatchery (15.4%), though almost all fingerlings (except those recruited from natural sources) originate from the state-run hatchery. This reveals the importance of farmer-to-farmer networks that supply farmers with seed from hatcheries, though it is unlikely that such networks match the level of development and sophistication seen in Asia, with farmers haphazardly recruiting fish from various sources. It is likely, and subsequently reported by DoF officers, that many of these fish are inbred and/or stunted as farmers attempt to satisfy their own seed demand by recycling their fish in their own ponds or from neighbors' ponds. In press). The small-scale sector in Zambia has for decades been dependent on state-run hatcheries and extension services for inputs, which has so far resulted in little sustained growth."},{"index":3,"size":113,"text":"Among surveyed small-scale farmers in the Kaminski et al. (In press) study in Northern Province, where the use of O. niloticus is banned, C. rendalli was the most commonly used seed (81% of surveyed farmers), followed by O. macrochir (30%) and O. andersonii (5%), with no farmers using O. niloticus. These trends vary from province to province where there may be more availability of O. andersonii or O. macrochir. There is some criticism that the ban gives farmers located in areas where it is not enforced an unfair advantage and further marginalizes small-scale farmers who reside in areas where it is enforced from accessing better performing strains of seed (Simataa and Musuka 2013)."},{"index":4,"size":52,"text":"This surfaces an important debate on food supply, food and nutrition security and the conservation of biodiversity. This also points to a potential need for future investments in genetic enhancement of indigenous strains to meet the demands of farmers in areas where the O. niloticus ban applies and to satisfy environmental concerns."}]},{"head":"Feeds and fertilization","index":11,"paragraphs":[{"index":1,"size":45,"text":"Feed is another important challenge facing the development and growth of aquaculture in Africa (Brummett et al. 2008;Gabriel et al. 2007;Hecht 2006Hecht , 2007) ) where it can account for over 60% of the total Woman feeding fish in extensive pond system, Kawala, Mbala District."},{"index":2,"size":8,"text":"costs of fish production (Jamu and Ayinla 2003)."},{"index":3,"size":177,"text":"For decades, the small-scale sector in Zambia has attempted to feed and fertilize ponds in integrated systems using locally sourced materials (Bentley and Bentley 2005) promoted by government-run or donordriven programs. Feeding/fertilization regimes in rural areas have not changed significantly and can be categorized according to three different technologies: fertilization/manuring, on-farm feed (using by-products from local crop and vegetable production) or pelleted commercial feed application. A combination of these regimes exists when access permits. A study conducted by Musuka and Mainza (2015) found that the majority of small-scale farmers are dependent on manure to fertilize ponds and nourish fish through a natural bloom of phytoplankton. This was confirmed by a farm survey (Kaminski et al. In press) where 25% of the surveyed farmers reported the use of pelleted commercial feed (77% of which was distributed by development projects), 11% used on-farm produced feeds (made from home-grown products) and all the farmers from the survey practiced fertilization using mostly compost and household or animal waste, which was the only source of pond nutrients for 75% of the farmers."},{"index":4,"size":142,"text":"The growth of the commercial sector has started to stimulate the development of the feed sector. Numerous existing feed mills, such as Savanna Streams, Farm Feeds, Olympic Milling, Tiger Feeds, and Novatek Animal Feeds, invested into the development of aquafeeds over the last 5 years and started diversifying their product portfolio to satisfy the requirements and needs of large-scale commercial fish farms. Kaminski et al. (In press) estimated that these companies produced around 30,000 t of feed in 2015. Novatek Animal Feeds, for example, produces about 600-800 t of feed per month with four different product lines (fry mash, juvenile crumble, starter pellets and grower pellets), none of which existed on the market in Zambia before 2015. In anticipation of future aquaculture production expansion, large-scale commercial operators ventured into partnerships with feed mills to better control supply, quality and prices of feeds."},{"index":5,"size":280,"text":"To date, however, almost all micro-ingredients, such as fishmeal, premixes and vitamins, are still being imported, which is keeping the price of commercial feeds relatively high in Zambia. This may contribute to why feed companies have yet to distribute aquafeeds to small-scale farmers around the country where there is little demand for expensive feed products (Kaminski et al. In press). Feed companies such as Novatek Animal Feeds have retail outlets all over the country and express the desire to distribute the product to small-scale farmers, though not until there is sufficient demand from the sector. Additionally, and according to local DoF extension officers, many small-scale farmers also do not know how to use commercial feeds, which hinders their ability to demand such products. This is expected to change, however, with the investment of two large, foreignowned feed companies in Zambia in 2017. Aller Aqua has partnered with Yalelo, and Skretting with Lake Harvest Ltd to build two feed factories in Siavonga. This is envisaged to radically reshape the feed sector by the end of 2017 and provide an additional 75,000 t of aquafeed in the country. These large-scale producers have partnered with the international feed giants to secure a consistent source of cage feed for their own production and the feed companies in turn have seen an opportunity to expand the feed supply chain in the region. The Aller Aqua factory is expected to be the largest fish feed factory in Africa with an expected 50,000 t to be produced by the end of 2017. Personal communication with representatives from these companies suggest that Zambia aims to be an exporter of fish feeds to neighboring countries in the coming years."}]},{"head":"Markets and prices","index":12,"paragraphs":[{"index":1,"size":112,"text":"Markets in the value chain differ across geographic locations, rural and urban areas, and wealth status of consumers. The pond-based, small-scale sector produces mainly for household consumption and local sales, but very rarely as a primary agricultural activity. The fish farm survey carried out by Kaminski et al. (In press) showed that 41% of surveyed farming households use most of the harvest for household consumption, 57% sell their harvest in local markets and 2% use their fish mainly for barter and trade. Other studies in Zambia also confirm that about 40% of fish farming households consume all of their fish and do not sell within local markets (Nsonga 2015;Musuka and Musonda 2013)."},{"index":2,"size":86,"text":"The Kaminski et al. (In press) study further shows that when small-scale farmers sell their fish, 64% sell their tilapia at pond site. Fish farmers use social institutions such as churches and community meetings as marketing strategies and communication channels to announce the harvest and sell directly from their farms. Some farmers use the local DoF extension officers to help sell their produce in local markets. The DoF officers can also sometimes secure customers from nearby towns to visit the farm (DoF officers, personal communication 2016)."},{"index":3,"size":39,"text":"Almost one-third of farmers from the survey sold their fish in the village by going door-to-door. This highlights the importance of local, \"informal\" markets for the smallscale sector. In most cases, farmers use a combination of these marketing strategies."},{"index":4,"size":95,"text":"The majority of farmers from the same survey (94%) stated that their fish was sold at a higher price than fish from capture fisheries. The remainder was sold at the same price, and no fish from small-scale aquaculture was sold at a lower price than capture fisheries. Absolute fish prices were difficult to assess as fish was sold based on the species and the size of the fish, not by weight. Smaller fish (<100g) are usually sold in bundles that can consist of 10-30 fish while larger fish (>200g) are sold per single whole piece."},{"index":5,"size":151,"text":"Large-scale commercial farms, meanwhile, mostly target urban areas as primary markets for selling fish to the middle and upper classes. Across the different operators, the majority of the overall production is transported to and sold in the capital, Lusaka, either through company-owned retail outlets, or wholesale depots. Some large-scale producers have their own ice production, freezing facilities and refrigerated trucks. Some actors operate with only one wholesale depot, while others directly engage with a small number of retailers, and one company (Lake Harvest Ltd.) distributes its produce to 27 wholesale depots in five provinces. Capital Fisheries Ltd is a major trader of wild, farmed and imported fish and also buys fish from small-to large-sized farms that do not engage in their own processing. Capital Fisheries Ltd is one of the only large-scale processors in the value chain that sells packaged gutted/scaled whole fish and a small percentage of packaged filleted tilapia."},{"index":6,"size":88,"text":"According to Kaminski et al. (In press), the price of commercially farmed fish in Zambia is slightly higher than from capture fisheries, though this largely depends on fish size and is often subject to unpredictable price fluctuations. The latter are largely based on a volatile exchange market and an erratic capture fisheries supply. Generally, farmed fish from the commercial sector is categorized into three different grades: (1) grade 1 describes fish that weighs more than 300 g and is currently sold for ZMW 24-27 (USD 2.55) per kg;"},{"index":7,"size":55,"text":"(2) grade 2 comprises fish that weighs 100 g to 250-300 g and is sold at ZMW 18 (USD 1.80) per kg; and (3) grade 3 is for fish that weighs less than 100 g and is sold at about ZMW 8 (USD 0.80) per kg. Products are sold whole in fresh or frozen form."},{"index":8,"size":88,"text":"Particularly interesting is the fact that grade 3 fish, which is not sold in formal supermarkets, is highly demanded by mostly female retailers who purchase fish from depots in Lusaka when it arrives together with the larger fish intended for formal retail. Personal communication with Kafue Fisheries Ltd and Lake Harvest Ltd revealed a definite undersupply of smaller fish to these traders and that over 80% of these traders are made up of women. These fish are taken for trade in \"informal\" markets in lower-income areas in Lusaka"},{"index":9,"size":7,"text":"Farmed fish depot, Lake Harvest Ltd, Kitwe."},{"index":10,"size":52,"text":"where they can compete with tilapia from capture fisheries because of their size and price. This indicates that there is a significant market in lower-income areas in Lusaka, though the same companies expressed that this is a small percentage of their total sales as the fish is almost treated as a byproduct."}]},{"head":"Employment","index":13,"paragraphs":[{"index":1,"size":75,"text":"There were about 8000 jobs created through aquaculture in Zambia in 2014 (DoF 2015), with the bulk being created by the large-scale commercial sector, including in the feed and seed sectors as well as in processing (e.g. Capital Fisheries Ltd). A more recent World Bank report (Krishnan and Peterburs 2017) pins this number as high as 13,000 jobs, which are primarily on-farm jobs (including mostly jobs on small-scale farmers, i.e. digging ponds) and mostly unskilled."},{"index":2,"size":37,"text":"The report claims that as many as 22,000 jobs may be available in the sector by 2022. Currently, Yalelo has about 500 employees, which means that they have about one person hired for every 4 t produced."},{"index":3,"size":106,"text":"The 12,000 registered farmers in the country will hire laborers to dig ponds and net fish. Although these jobs are \"informal\" and considered piecework in nature, they play an important role in the development of the small-scale sector. According to a WorldFish ( 2014) report for the ILO, for every 10,000 t of feed produced there could be 100 jobs. This means that by the end of 2017 there could be between 800 and 1000 jobs in the feed sector alone. The same report estimates that for every 1000 t of fish produced, about 100 jobs are created in the value chain (trading, logistics, gastronomy, etc.)."},{"index":4,"size":172,"text":"Other benefits not directly accrued within aquaculture in the value chain are those in the agricultural sector that will supply feeds. According to the same WorldFish ( 2014) report, considering a food conversion ratio (FCR) of 1.7, every metric ton of fish produced will require 1.5 metric tons of soya and maize. Every 10,000 t of fish will therefore require 5,000 t of soya and 1500 t of maize. While this is a market that can be enjoyed by hundreds of farmers, it has to be balanced with the food and nutrition security of rural populations who still depend on maize, specifically as their primary staple food. Other benefactors, such as the female retailers discussed above, are the street vendors, restaurants and traders who can integrate into the value chain. The WorldFish (2014) report states that if the average vendor sells 20 kg of fish a week, and if 5000 t were sold in this way every week, this would create 2500 jobs for traders that can distribute this fish every week."},{"index":5,"size":74,"text":"It is unclear about the role of women and youth in the sector, particularly in small-scale production, which is a topic that requires immediate research if the gains made in the growth of aquaculture are to be equitably beneficial for certain groups. Based on a sample of small-scale registers supplied by district DoF officers, women's involvement in farmed fish production is less than men's and in some districts women's participation is overwhelmingly low. 4"}]},{"head":"Fish supply, consumption and food security","index":14,"paragraphs":[{"index":1,"size":80,"text":"There is limited data available on the consumption of farmed fish in Zambia. While there is some literature on fish consumption in general, with the acknowledgment that farmed fish plays a role in filling the gap between national fish supply and demand (Hichaambwa 2012;Longley et al. 2014;NFDS 2016), disaggregated data on the consumption of farmed fish are not available, and therefore we infer the patterns of consumption based on data from consumption studies on capture fisheries (including mostly tilapia species)."},{"index":2,"size":117,"text":"According to the national Demographic and Health Survey (DHS) conducted by the Central Statistics Office (CSO) and the Ministry of Health (MoH) and ICF International ( 2014), child malnutrition (stunting) rates are still very high in Zambia, although they have declined slightly over the past 5-10 years from 45.4% in 2007 to 40.1% in 2013. Fish provides 55% of the animal protein consumed by Zambians and is an extremely important source of micronutrients and often the only accessible and/or affordable animal-source food for resource poor people in rural areas (Longley et al. 2014;NFDS 2016). In addition, tilapia is a highly favored food for most Zambians though not always affordable for all (NFDS 2016;Genschick et al. In press)."},{"index":3,"size":195,"text":"The consumption of fish varies greatly according to geographic location and wealth status. Fish consumption is generally higher in rural areas and low-income groups spend proportionally more on fish than on any other animal-food source, in comparison to high-income groups, though this differs when disaggregated by fish species (Hichaambwa 2012;Longley et al. 2014). In absolute terms, fish consumption per capita is also higher in rural areas than in urban areas, in particular in Northern, Western and Luapula provinces where there are established capture fisheries (NFDS 2016). Some rural areas have high fish consumption per capita-13.9 kg/year reported in Chililabombwe and 27.2 kg/year in Siavonga. The bulk of this fish is made up of dried small pelagic fish or small indigenous wetland species rather than large tilapia (NFDS 2016). This might have an implication on the productivity of small-scale fish farmers and motivation to practise aquaculture as the supply of fish is largely met by capture fisheries in these areas. While in general, the demand for farmed fish in the country might be high, small-scale fish farmers struggle to reach these markets because of poor infrastructure, long distances to markets and the absence of cold chains."},{"index":4,"size":17,"text":"The price of fresh fish has become the lowest among all animal-source foods in Zambia (Hichaambwa 2012)."},{"index":5,"size":45,"text":"Because of an absence of cold chains, fresh fish might not be readily available in rural areas and small towns, and sun-dried and smoked tilapia are still highly favored, especially among resource poor people who do not have the means to freeze fish (Hichaambwa 2012)."},{"index":6,"size":47,"text":"Aquaculture producers sell fish fresh and/or frozen and rarely smoked and/or dried or salted. Despite the high demand and consumption of fish among poor populations, most farmed fish in fresh and/or frozen form is targeted to formal retail outlets and middle-income consumers in urban or peri-urban areas."},{"index":7,"size":60,"text":"Overall, the fish supply per capita in Zambia is on the rise. Figure 4 shows the positive effect that aquaculture has had on fish supply per capita in the country, especially since 2011. The figure shows a rapidly growing population, erratic supply from capture fisheries, increased aquaculture production and imports, resulting in an overall increase in fish supply per capita."},{"index":8,"size":68,"text":"The cultivation and sales of fish of an additional 13,690 t by commercial enterprises in Zambia and increasing imports have helped maintain fish supply per capita, regardless of the growing population, and has resulted in an increase in supply per capita, reaching 11 kg in 2014. This is still significantly below the global average of 19.2 kg/year, but above the sub-Saharan African average of 8.9 kg/year (FAO 2016)."},{"index":9,"size":236,"text":"While the increased supply of farmed fish since 2011 has played an important role in the net fish supply, a more significant contribution seems to come from the rapid increase in fish imports over the same period (Figure 4). This drastic growth from 2011 does not seem to be slowing down and the fish sector as a whole in Zambia is being reshaped as consumers are introduced to different fish products such as horse mackerel (Trachurus spp.) from Namibia, which was barely on the market a decade ago. Figure 4 shows the importance of fish imports to national fish supply with the net weight of fish and total production exponentially increasing in the last six years to a total of over 55,000 t (more than half of what came from capture fisheries in 2014). Figure 5 shows the change in the fish value chain and imports over time, with dried fish once dominating the import market and today being replaced by frozen fish, namely horse mackerel and tilapia products. In 2014, the market imported just over half the total amount of tilapia produced domestically thus providing an alternative source of farmed tilapia. It is reported in Kaminski et al. (In press) that the imported tilapia is more often of a smaller size and sold at a lower price than domestically produced tilapia, thus potentially providing a marketing barrier for smaller companies to compete in the market. "}]},{"head":"Year","index":15,"paragraphs":[{"index":1,"size":60,"text":"Without fish imports however, the fish supply per capita rate would drop by 3.9 kg (Kaminski et al. In press). This means that imports are providing a crucial function in food security and if the price is lower than domestically produced fish, it is likely that poorer populations are benefitting from this increased availability and cheaper price of tilapia products."},{"index":2,"size":121,"text":"The results of a consumption study in urban Lusaka (Genshick et al. In press) shows that poorer groups there rely on small, dried fish products found only Figure 5. Net weight (kg) of imported fish into Zambia by country or region (2004)(2005)(2006)(2007)(2008)(2009)(2010)(2011)(2012)(2013)(2014) in capture fisheries while wealthier groups tend to consume larger, fresh fish products, such as tilapia, which are partly supplied by aquaculture producers in the country and imported from abroad. The results imply that poorer groups are less likely to supplement their fish demand with fish products from domestically produced aquaculture, possibly because commercial producers generally target the upper-end markets where prices are still high. It also shows that tilapia products may be generally produced for more middleincome populations."},{"index":3,"size":98,"text":"This paper has explored the structure of the aquaculture subsector in Zambia, providing a descriptive account of various components, segments and nodes in the value chain. In this section we attempt to discuss the evident growth and trajectory of the sector and its current responsiveness to the needs of the poor, providing both direct and indirect benefits. The needs of the poor were identified as a need for income, access to a means of production, access to acceptable, nutritious, safe and diverse fish, empowerment (in particular for women and youth), knowledge and access to clean water and sanitation."},{"index":4,"size":128,"text":"Given the fact that aquaculture in Zambia is still in its infancy and that there is a shortage of data, the evaluation focuses mostly on how aquaculture provides or does not provide direct benefits to resource poor people by creating income opportunities, increasing their access to inputs and increasing their access to fish. To date, little or no data has been collected or made available on the environmental performance of aquaculture technologies, fish food labeling, empowerment of women and youth (see Harrison 1996 for an exception), or food safety in aquaculture in Zambia. There is a strong need to further research the contemporary role of women in the aquaculture value chain and identify challenges and opportunities for further integration and equitable participation of women in the value chain."}]},{"head":"Income opportunities","index":16,"paragraphs":[{"index":1,"size":84,"text":"Aquaculture contributes directly and indirectly to income generating opportunities in Zambia. There are about 12,000 registered small-scale farmers in the country, of which the majority can be considered relatively resource poor. As small-scale aquaculture enables rural farmers to generate income through the retail of fish as well as for home consumption, a relatively small proportion of the total population benefits directly. With an average household size of eight persons per household, less than 1% (0.64%) of all households in Zambia are engaged in aquaculture."},{"index":2,"size":30,"text":"Given the low productivity in small-scale aquaculture, commonly managed by household members and only occasionally requiring seasonal, informal labor, on-farm job opportunities are still very limited in the smallscale sector."},{"index":3,"size":34,"text":"In the commercial sector, according to government statistics, there were about 8000 jobs in aquaculture in Zambia in 2014 (DoF 2015), though this is expected to increase to around 13,000 in 2017 (Krishnan and"},{"index":4,"size":28,"text":"Evaluation of aquaculture' s responsiveness toward the needs of the poor Peterburs 2017). This also includes employment in the feed and seed sectors as well as in processing."},{"index":5,"size":189,"text":"The large-scale aquaculture producers, with vertically integrated production systems, as well as other actors in the supply chain are currently expanding and increasing the number of jobs in the commercial aquaculture value chain. In addition to formal employment opportunities, new niche markets are emerging that are occupied, for example, by street vendors, who access smaller amounts of fish from commercial aquaculture that is traded \"informally\" in urban areas. Although no data are available, it is believed that \"informal\" job opportunities are likely to have a greater effect on poverty reduction, especially within downstream value chain activities, and potentially more than from direct jobs in aquaculture production (one large-scale operator can hire around 1 person per 4 t of output, for example). Further jobs within the feed and seed sector have also not been quantified but the introduction of two major foreign feed companies means that formal jobs and also secondary benefits to farmers who need to provide ingredients for local feed production can be realized. Generally, the creation of jobs through aquaculture is directly or indirectly benefitting economic development and likely to make a positive contribution to poverty reduction."}]},{"head":"Access to the means of production","index":17,"paragraphs":[{"index":1,"size":332,"text":"The aquaculture value chain in Zambia has experienced a major transformation as a result of upgrades in preand post-production (Kaminski et al. In press). Many of those upgrades have been initiated by large-scale commercial producers, who have vertically integrated advanced feed production and hatchery technologies into their operations or from direct partnerships between companies and different actors in nodes in the value chain (Kaminski et al. In press). Feed mills and private hatcheries have invested in upgrading technologies too. Higher-quality inputs for aquaculture production, namely feed and seeds, have become more widely available, but are mostly utilized by large-scale commercial producers. Thus, although production inputs are being made more available, access to these inputs by small-scale fish farms remains low and cost-prohibitive. To date, access to the means of production in small-scale aquaculture is largely made up of horizontal linkages, such as in the form of farmer networks for fingerling supply and a strong reliance on on-farm resources for feeds and organic fertilizer. By improving access to enhanced production technologies and knowledge, small-scale aquaculture productivity could increase and more on-farm jobs would be created, which would mean a stronger uptake and integration of aquaculture into rural livelihoods. Fundamental to achieving these development outcomes is making microfinance (with low interest rates) accessible to small-scale farmers to purchase inputs and sustain production. These should be made especially available to women and youth. Currently no microfinance options exist other than through the government-supported Citizens Economic Empowerment Commission (CEEC) 5 or those trialed by development organizations such as SIDA and the FAO-ILO. The demand and preference for fish and in particular the availability of land and water in many rural areas are not considered to be constraining factors to small-scale aquaculture development in the country unlike the accessibility to inputs (including microfinance) and markets, which present the biggest challenges. As cage aquaculture is usually more capital intensive than land-based pond aquaculture, the latter holds the biggest potential for resource poor farmers to venture into aquaculture production."}]},{"head":"Access to farmed fish","index":18,"paragraphs":[{"index":1,"size":169,"text":"The recent aquaculture growth in Zambia has contributed to an increase in fish supply (tilapia) in the country. To date, approximately 20% of the fish sourced in Zambia comes from domestically produced aquaculture. The large-scale commercial sector is the main supplier of farmed fish in the country and accounts for 71% of the approximately 20,000 t of fish produced in 2014 (DoF 2015). The remainder of farmed fish is produced by small-scale fish farmers, though there is high uncertainty on how accurate the statistics are on the total production in small-scale aquaculture. There is an immediate need to quantify not only total production by small-scale farmers, but also to determine the existing number of active fish farmers (disaggregated by sex and age) throughout the country to accurately paint a picture of the smallscale aquaculture sector and assess its inclusion in/or exclusion from a rapidly developing value chain. This would also enable a more thorough assessment of the impact small-scale aquaculture has on food and nutrition security in rural areas."},{"index":2,"size":11,"text":"Employees on commercial farm sorting fish, Great Lake Products Ltd, Mpulungu."},{"index":3,"size":87,"text":"Photo credit: Chosa Mweemba/WorldFish Fish from small-scale aquaculture is consumed, to a certain extent, within the producing household, of which the majority can be considered resource poor. Despite the fact that productivity is low, the 12,000 households in small-scale aquaculture create their own access to fish. The amount of fish that is produced is difficult to decipher and it is common that farmers engage in partial harvesting throughout a cycle in order to supplement their food and nutrition needs or pay for basic expenses (e.g. school fees)."},{"index":4,"size":101,"text":"The production share that can be retailed locally is usually more expensive than fish from capture fisheries and hence not very competitive in rural markets. It is therefore usually sold to a limited number of slightly higher-income buyers from small district towns and peri-urban areas (e.g. civil servants, teachers, etc.). While these types of transactions only occur for those farmers who are able to produce a surplus, these fish are not generally bought by resource poor people in rural areas who largely meet their fish demands with smaller dried fish products from capture fisheries (both from within and outside 7 Zambia)."},{"index":5,"size":83,"text":"In contrast to the accessibility of farmed fish from the small-scale sector, some larger companies from the commercial sector have positioned their production and retail infrastructure in areas with favorable production and marketing conditions (e.g. Lusaka and Copperbelt provinces), where they market their produce directly through their own and other retail outlets. The marketing and placement of these retail outlets do not seem to directly meet the needs of poorer urban populations as fish are mostly targeted to and consumed by middle-income populations."},{"index":6,"size":62,"text":"Population growth and a growing urban middleclass are expected to further increase the demand for fish, which can be met by the rapidly expanding aquaculture sector. The questions that remain are whether the small-scale sector has the means to be able to compete and supply fish for this market and whether resource poor urban consumers will be able to afford farmed fish?"},{"index":7,"size":125,"text":"It is unlikely that commercial aquaculture will supply consumer preferences and the needs of population groups with limited purchasing power as long as the middle-class demand is still not satisfied. This would require producing small-sized fish, which for now is being filled mostly by imported tilapia. Poorer urban population groups are only benefitting through the \"informal\" retail of smaller-sized, low grade fish from commercial aquaculture, which is regarded as a \"bycatch\" and only available in small-quantities in urban areas. This does, however, present an opportunity for small-scale aquaculture to consistently supply smallersized tilapia to these lower-income peri-urban and urban markets. Small-scale farmers struggle to grow their fish to larger than 300 g, while the commercial sector markets fish between 300 and 600 g or more."},{"index":8,"size":19,"text":"There is certainly a market for fish between 100 and 300 g, which is currently filled by imported tilapia."},{"index":9,"size":103,"text":"There is an argument, therefore, that small-scale farmers could produce for this market using minimal inputs if they were to be further integrated into the value chain (e.g. cold chain and transport). The argument is not to supply immature fish but rather to either sell fish that are fed on low-cost feeds and grow to an average size of say 200 g over say a 6-month cycle, or find new species of indigenous fish that have fast growth rates and reach a smaller adult size than what producers are currently supplying to the market today. More research is required to explore such avenues."},{"index":10,"size":286,"text":"The price difference between local and imported fish, as well as the high demand for fish, has allowed both aquaculture supply and fish imports to grow simultaneously in the country with little or no appearance of an adverse effect on each other yet, while also contributing to a rising supply of fish per capita. It remains to be seen what effect increasing fish imports will have on the development of the aquaculture sector. Personnel communication with several large-scale producers reveals that this is still a major cause of concern for commercial farmers. From a consumer perspective, imports may be keeping the price of fish produced and sourced in Zambia relatively low, and thus more accessible for low to middle-income consumers. Little is known, however, on Zambians' preferences for imported fish compared to locally produced fish. Resource poor consumers in urban areas, where most of the imported and commercial farmed fish is retailed, may still have limited access to farmed or imported fish and the main source of fish (e.g. dried, smaller pelagic and wetland species) would still likely be cheaper. This may change if production from capture fisheries continues to decline. The low accessibility of farmed fish by poor consumers is likely caused by the price of fish and not by its acceptability or taste though this requires further research and validation. Tilapia, the dominant species in Zambian aquaculture, is highly preferred across income groups in urban Lusaka (Genschick et al. In press) though it is not always accessible and/or affordable. The outlook for the growth of tilapia farming looks promising, though there is also scope to debate the possibility of further introductions of other species into the sector to diversify the products on the market."}]},{"head":"Final outlook on the aquaculture value chain","index":19,"paragraphs":[{"index":1,"size":258,"text":"The future of the sector will depend on the availability and price of locally produced feeds. The results from this report suggest that commercial feeds are being developed rapidly in Zambia, and new products (inputs) that were not available five years ago are readily available today, albeit mostly in urban centers or commercial production zones such as Siavonga. Two of the largest commercial companies are now partnering with international feed companies, which will likely boost jobs and allow for greater access to feeds by small-and medium-scale farmers. The sector is likely to grow significantly in the coming years and has the potential to transform aquaculture in the country. There are still concerns about the cost of fishmeal and a lack of alternative animalprotein sources in a country with a low diversity of agricultural production. A transformation in the feed industry will largely depend on the source of the ingredients, and the government may have to address the synergies between the agriculture sector and the supply of ingredients for fish feed in a country where food security is still a major concern. Additionally, the cost of commercial feeds is still too high for the majority of small-scale farmers in the country, and the development of supply chains and distribution networks also needs to be addressed. One option to improve the distribution network is through publicprivate partnerships in which private companies become involved in improving the supply chain (e.g. outgrower schemes) as well as through microfinance institutions that can provide the means for small-scale farmers to invest in their systems."},{"index":2,"size":253,"text":"The aquaculture sector will have to look into the aspect of attaining high-quality seed strains and these need to be made available to more small-to mediumscale farmers. As in many other African countries, this is compounded by the concerns around local fish biodiversity and the effects of introducing improved strains of non-native fish. In Zambia, this has resulted in the ban on O. niloticus outside the southern part of the country where the species was already introduced prior to the recent surge in aquaculture growth. This gives the commercial sector around Southern and Lusaka provinces a competitive advantage over other areas where there is mainly small-scale production, such as in Northern and North-Western provinces. This also means it is unlikely that commercial players will spread beyond their current geographical boundaries. This, in turn, means the small-scale sector outside these areas is unlikely to benefit from any spillover effects that commercialization of improved feeds and seeds and better-established supply market chains Analyses from Egypt, Ghana, Nigeria, Kenya and Uganda show that the sector grows where conditions support the emergence of small-and medium-scale aquaculture enterprises with a more commercial market-led orientation (Asiedu et al. 2015;Beveridge et al. 2010;Brummett et al. 2008;Hecht 2006). Market demand, resulting from urbanization and a growing middle class, will likely keep driving the expansion of aquaculture on the continent on a more commercial level (Beveridge et al. 2013;Hall et al. 2011). The smallscale sector requires value chain integration strategies and investment plans that remove the sector's dependency on donor-led development projects."},{"index":3,"size":55,"text":"Although the integration of the small-scale sector is important, the development of the commercial sector also needs to be nurtured, as it still faces challenges related to practical skills and experience, limited supply of fingerlings and sometimes low quality fry, and low quality and expensive fish feed, as well as infrastructure challenges such as transport."},{"index":4,"size":177,"text":"Even though these are all issues that require more research in the sub-Saharan African context, the case of Zambia has shown that, on the one hand, capital influx and market-led approaches can significantly develop the aquaculture sector and have spillover effects on the inputs industry (such as feed and seed), while also producing more fish for markets. The commercial sector also seems to hold potential for spillover effects into the small-scale sector, especially on input supply, though evidence for this is limited to a few areas adjacent to commercial operators. On the other hand, there is a possibility that these developments will further marginalize small-scale farmers, since they might be unable to compete with the commercialization of the industry and to supply a market dominated by middle-class consumers. Small-scale farmers may need to develop a different niche among lower-income consumers. Food security is still a major concern in Zambia and the increase in production of fish could be an important contributor to mitigate malnutrition. More effort needs to be Small-scale farmers netting a pond, Kawala, Mbala District."},{"index":5,"size":49,"text":"Photo credit: Alexander Kaminski/WorldFish made to make farmed fish more accessible to poorer populations, whether by introducing new species into the sector that are cheaper to cultivate, decreasing the costs of production to produce cheaper fish, or for some farmers to generally produce smaller-sized fish that require lower-cost inputs."}]},{"head":"Conclusion","index":20,"paragraphs":[{"index":1,"size":262,"text":"It is evident that there have been vast developments and improvements in aquaculture in Zambia in recent years. Aquaculture production is on the rise though mainly driven by the large-scale commercial sector, which is generally detached from the small-scale sector. These sectors are responding to the needs of the poor differently, and have the potential to respond better in the future. The small-scale aquaculture sector can be characterized as low input-low output where the resource poor people access fish from their own production and to generate some income through the local retail of fish. Both the consumption and income linkages, although nominal, are considered important for poverty reduction and household food security. Improved access to inputs such as feed and seed are likely to help increase productivity and hence stimulate incentives for more small-scale farmers to venture into aquaculture. To allow small-scale farmers to produce more fish and to follow more business-oriented farming, market access needs to be improved. Fish from aquaculture is expensive compared to most small fish from capture fisheries and thus current markets in rural areas are limited and competitive for farmed fish. Most resource poor people who are not directly involved in small-scale aquaculture are not able to directly or indirectly benefit from fish farming, neither through improved access to fish nor through on-farm job opportunities. Such indirect benefits, however, emerge partly from the developments in the large-scale commercial aquaculture value chain. The growth of the commercial value chain demands more labor and creates formal and \"informal\" income opportunities in on-farm production as well as in pre-and post-production."},{"index":2,"size":130,"text":"The fish produced by the large-scale commercial aquaculture sector, however, is mainly feeding the urban middle-class in selected provinces. Hence, poorer consumers in many parts of Zambia do not benefit from an increased fish supply through large-scale commercial aquaculture. While it is assumed that the large-scale commercial sector will keep growing, it will be important for producers and input suppliers to increase their market share and devise products that are more accessible for lower-income populations, i.e. by lowering the cost of production. The aquaculture value chain in Zambia is an important exemplar for the development of the sector in the region, and while some challenges still remain, the sector should be carefully studied over the next years in order to track the trajectories and assess the impacts on poverty alleviation."}]}],"figures":[{"text":" The state-run hatchery, Misamfu Aquaculture Research Station in Northern Province produced 1,062,314 fingerlings between 2005 and 2015-only half of what one large company such as Yalelo can produce in a year. Of these fingerlings, 54% were part of government-run programs to restock small water bodies and dams in the province over a 10year period. The other 46% were distributed to small-scale farmers, 59% of which were bought by development organizations (e.g. World Vision, Caritas, Self Help Africa) for distribution in donor-driven, small-scale aquaculture projects. The DoF distributed the remaining fingerlings to small-scale farmers in the province over the same period(Kaminski et al.     "},{"text":"Figure 4 . Figure 4. Fish supply per capita in Zambia (2004-2014). Source: Kaminski et al. (In press).Human population (in millions of people) "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Poor consumer needs Pro-poor aquaculture      Health      Health  Shelter         Shelter    Access to good     Access to good    nutrition      nutrition Income Access to prod. means  Access to food  Women's empowerment Knowledge (information and awareness)  IncomeAccess to prod. meansAccess to foodWomen's empowermentKnowledge (information and awareness) Jobs knowledge and Low-cost technology Accessible fish Available fish Acceptable fish Nutritious fish Vegetables job opportunities technologies and Inclusive/ gender-sensitive Food marketing and labeling Clean/ sustainable technologies Jobsknowledge and Low-cost technologyAccessible fishAvailable fishAcceptable fishNutritious fishVegetablesjob opportunities technologies and Inclusive/ gender-sensitiveFood marketing and labelingClean/ sustainable technologies   On-farm       On-farm  Down-or upstream-VC   Fish processing   Down-or upstream-VCFish processing  "},{"text":"Production volume (t) 2. Fish output (t) by contribution from aquaculture and fisheries(2006)(2007)(2008)(2009)(2010)(2011)(2012)(2013)(2014) (Kaminski et al. forthcoming). 25,000                    25,000 20,000                    20,000 15,000                    15,000 10,000                    10,000 5,000                    5,000 0                    0 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 19951996199719981999200020012002200320042005200620072008200920102011201220132014          Year          Year Large-scale ponds   Large-scale cages   Small-scale all Large-scale pondsLarge-scale cagesSmall-scale all  "},{"text":"Province No. fish farms No. ponds Facility area Est. production (t) t/ha Mean prod. per farm (t) No. ponds per farm Mean size ponds  Central 1,018 1,578 470,144 317.35 6.75 0.31 1.6 297.94 Central1,0181,578470,144317.356.750.311.6297.94 Copperbelt 1,203 2,732 706,866 477.13 6.75 0.40 2.3 258.74 Copperbelt1,2032,732706,866477.136.750.402.3258.74 Eastern 1,533 1,368 199,200 134.46 6.75 0.09 0.9 145.61 Eastern1,5331,368199,200134.466.750.090.9145.61 Luapala 485 1,761 262,273 177.03 6.75 0.37 3.6 148.93 Luapala4851,761262,273177.036.750.373.6148.93 Lusaka 282 646 328,128 221.49 6.75 0.79 2.3 507.94 Lusaka282646328,128221.496.750.792.3507.94 Muchinga 1,573 2,265 44,055 29.74 6.75 0.02 1.4 19.45 Muchinga1,5732,26544,05529.746.750.021.419.45 Northern 2,436 4,940 1,180,794 797.04 6.75 0.33 2.0 239.03 Northern2,4364,9401,180,794797.046.750.332.0239.03 North-Western 2,915 4,538 990,075 668.3 6.75 0.23 1.6 218.17 North-Western2,9154,538990,075668.36.750.231.6218.17 Southern 207 225 34,987 23.62 6.75 0.11 1.1 155.50 Southern20722534,98723.626.750.111.1155.50 Western 358 506 159,854 107.9 6.75 0.30 1.4 315.92 Western358506159,854107.96.750.301.4315.92 Total 12,010 20,559 4,376,376 2,954.06 6.75 0.29 1.8 230.72 Total12,01020,5594,376,3762,954.066.750.291.8230.72  "},{"text":" Simataa and Musuka 2013). The newly approved ZAEDP program run by the government in partnership with WorldFish aims to develop a genetic improvement program for O. andersonii to provide an improved strain of indigenous fish for farmers located outside of the O. niloticus zone. and investment in aquaculture was and still is seen as a risky venture. This might change, however, with the speed at which aquaculture is developing in Zambia, as this report reveals. discriminate against those farmers located outside     discriminate against those farmers located outside the main output markets and who have less access to   9 the main output markets and who have less access to9 indigenous tilapia seed and commercial feeds, among    indigenous tilapia seed and commercial feeds, among other inputs (Most commercial land-based pond farmers do not   3 The introduction of two major cage culture operators 1 2 11 22 LUAPULA NORTHERN 10 in Siovonga between 2011 and 2013 created a sudden surge in large-scale commercial farming, with improved access to high quality feeds and seed as well as the introduction of a new aquaculture policy (Fisheries Act No. 22 of 2011) that provided other inputs (Most commercial land-based pond farmers do not3 The introduction of two major cage culture operators 1 2 11 22 LUAPULA NORTHERN 10 in Siovonga between 2011 and 2013 created a sudden surge in large-scale commercial farming, with improved access to high quality feeds and seed as well as the introduction of a new aquaculture policy (Fisheries Act No. 22 of 2011) that provided match the scale of production of Kafue Fisheries Ltd,  enabling conditions for a sudden growth in the sector. match the scale of production of Kafue Fisheries Ltd,enabling conditions for a sudden growth in the sector. which produces about 1500-2000 t per year at a rate 4 of about 20-50 t per pond for each rearing cycle with  21 At the same time, five new enterprises entered the MUCHINGA intensive land-based aquaculture sector (Musuka and which produces about 1500-2000 t per year at a rate 4 of about 20-50 t per pond for each rearing cycle with21 At the same time, five new enterprises entered the MUCHINGA intensive land-based aquaculture sector (Musuka and two cycles every year. Land-based pond commercial 16 fish farmers are mainly located in Lusaka (34%), 17 Musonda 2012). In 2014, intensive land-based farmers 5 accounted for 51% of aquaculture production with two cycles every year. Land-based pond commercial 16 fish farmers are mainly located in Lusaka (34%),17Musonda 2012). In 2014, intensive land-based farmers 5 accounted for 51% of aquaculture production with 18 Copperbelt (52%) and Southern provinces (11%), COPPERBELT 9805 t being produced, followed by cage culture 18 Copperbelt (52%) and Southern provinces (11%),COPPERBELT 9805 t being produced, followed by cage culture NORTH-WESTERN with the remainder located in Northern Province   6 enterprises accounting for 20% of the production. NORTH-WESTERN with the remainder located in Northern Province6 enterprises accounting for 20% of the production. (4%). Currently, Kafue Fisheries Ltd is the largest land-based commercial fish producer in Africa, with a pond 19 20 Together, the large-scale commercial sector accounts EASTERN for 71% of the country's aquaculture production, (4%). Currently, Kafue Fisheries Ltd is the largest land-based commercial fish producer in Africa, with a pond1920 Together, the large-scale commercial sector accounts EASTERN for 71% of the country's aquaculture production, surface area of 100 ha, marketing an average of 4-6 t CENTRAL which is a significant difference from 2009 when the commercial sector only produced 25% of the 5000 t surface area of 100 ha, marketing an average of 4-6 t CENTRALwhich is a significant difference from 2009 when the commercial sector only produced 25% of the 5000 t     12 LUSAKA 12LUSAKA WESTERN SOUTHERN 7 13 8 14 WESTERNSOUTHERN713814     15  15 While the Food and Agricultural Organization (FAO)     While the Food and Agricultural Organization (FAO) (2004) reported that there were about 20-24 large-     (2004) reported that there were about 20-24 large- scale commercial land-based farmers in 2004,     scale commercial land-based farmers in 2004, Mudenda (2006) and Musuka and Musonda (2012)     Mudenda (2006) and Musuka and Musonda (2012) reported a decline to 11-15 farmers between 2006     reported a decline to 11-15 farmers between 2006 and 2012 with the number of large-scale commercial    and 2012 with the number of large-scale commercial 5 farmers growing again to more than 20 in 2014. Kitwe: National Aquaculture Research and Development Center (NARDC) and hatchery Musuka and Musonda (2012) reported that the decline    5 farmers growing again to more than 20 in 2014. Kitwe: National Aquaculture Research and Development Center (NARDC) and hatchery Musuka and Musonda (2012) reported that the decline 6 can be attributed to a struggling economy during Chipata Research Station and hatchery     6 can be attributed to a struggling economy during Chipata Research Station and hatchery that period, a lack of government policy at the time,    that period, a lack of government policy at the time, 7 high credit loans, lack of availability in quality seed Kasaka Fisheries Training Institute     7 high credit loans, lack of availability in quality seed Kasaka Fisheries Training Institute 8 and feed, high environmental impact assessment Chiilanga Research Station and hatchery + DoF HQ (EIA) costs and red tape bureaucracy. Today, there is     8 and feed, high environmental impact assessment Chiilanga Research Station and hatchery + DoF HQ (EIA) costs and red tape bureaucracy. Today, there is  "},{"text":" (SIDA) together with the FAO and International Labour Organization (ILO).3   There are six operating state-run hatcheries in the country that produce fingerlings primarily for smallscale aquaculture and stocking in small local water bodies. These hatcheries, however, only produced about 516,000 fingerlings in 2015 (mostly O. macrochir, C. rendalli and O. andersonii), which cannot possibly meet the fingerling demand of over 12,000 registered farmers around the country. To put this into context, Kafue Fisheries Ltd, one of the largest commercial landbased pond farms in Zambia, produces more than 2 million fingerlings every year. Most private hatcheries, so far, only supply for their own grow-out operations, and almost all of them are located in either Southern Province or in major cities such as Lusaka, Kitwe and Ndola. This means that most small-scale farmers in the country do not have access to fingerlings from private hatcheries and are largely dependent on state-run hatcheries that do not have the capacity to supply all registered small-scale farmers.  "},{"text":" may bring. The situation surrounding the use of O. niloticus is unique to Zambia, but the development of a program for improved indigenous strains could potentially counter this issue, and there is potential for improving indigenous tilapia strains such as O. macrochir, O. tanganicae and O. andersonii to make local strains more available for small-scale farmers. The new loan provided by the African Development Bank aims to develop a genetic improvement program for O. andersonii in partnership with WorldFish, and it remains to be seen what dissemination strategies are used for the sector to adopt this strain.  "}],"sieverID":"67a5471e-6f19-4506-a31b-3917b4077cc0","abstract":""}

data/part_1/0a7dc8881d0f071467532d3c3e6d0510.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a7dc8881d0f071467532d3c3e6d0510","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1f2d4ab2-e28f-4b72-9b10-e62d34b64e20/retrieve"},"pageCount":13,"title":"","keywords":[],"chapters":[{"head":"TRANSHUMANCE INTER-PLAYS","index":1,"paragraphs":[{"index":1,"size":23,"text":"• Transhumance is the seasonal movement of pastoralists and their herds from their usual grazing land, mainly in search of water and pasture"},{"index":2,"size":9,"text":"• Mobility is NOT OPTIONAL, but a critical ingredient"}]},{"head":"SECURITY IN MOBILITY IN THE IGAD REGION","index":2,"paragraphs":[{"index":1,"size":60,"text":"• Regional (cross-border) mobility is the primary coping and resilience mechanism for pastoralist communities • Seasonal mobility of livestock and herders in search of water and pasture occasioned by the cyclic climate variability • Can lead to upsurge of resource-based conflicts, disease spread if not well managed. • Regional Protocol on Transhumance is strategy to optimize production and for survival."}]},{"head":"WHY THE PROTOCOL ON TRANSHUMANCE","index":3,"paragraphs":[{"index":1,"size":2,"text":"Protocol Objective"}]},{"head":"1.Free, safe and orderly cross-border mobility for pasture & water","index":4,"paragraphs":[]},{"head":". C o m m i t M S t o i n v e s t a d e q u a t e r e s o u r c e s t o p a s t o r a l r e g i o n s","index":5,"paragraphs":[]},{"head":". I m p r o v e d s u r v e i l l a n c e","index":6,"paragraphs":[{"index":1,"size":29,"text":"& m o n i t o r i n g o f t r a n s h u m a n t h e r d s "}]},{"head":". A c c e s s t o s o c i a l s s e r v i c e s","index":7,"paragraphs":[]}],"figures":[{"text":"• ( e d u c a t i o n & h e a l t h ) b y p a s t o r a l i s t s Protocol Endorsed by IGAD Committee of Ambassadors in Khartoum, Sudan (February 2020) •Roadmap for Implementing the TP Validated by High Level Technical Experts and Endorsed by Sectoral Ministers in Entebbe, Uganda (November 2020) • Protocol & Roadmap Adopted by the 72 nd Extraordinary Session of Council of IGAD Ministers of Foreign Affairs on 24 th June 2021 • Reader-friendly version of the Adopted Protocol to be used in sensitizing the border communities • Mapping of transhumance corridors in IGAD Clusters • Sensitized national parliamentarians in Sudan, South Sudan, Uganda and Ethiopia and discussed ratification and domestication processes "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"c1fc2255-adeb-4de7-8893-c301ce427477","abstract":""}

data/part_1/0ad22bee0efe1e83804923373bb1c10d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ad22bee0efe1e83804923373bb1c10d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/703c69a2-a7e4-4557-b33d-e7b9e1362a2b/retrieve"},"pageCount":14,"title":"Smallholder Agroprocessors' Willingness to Pay for Value-Added Solid-Waste Management Solutions","keywords":["cassava processors","smallholders","solid waste","pollution","value-added","willingness to pay"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":87,"text":"Annual cassava production in Africa is about 84 million tonnes, of which Nigeria produces over 30 million tonnes, as the world's largest cassava producer [1][2][3]. However, cassava processing is considered to contribute significantly to environmental pollution globally by depleting water resource quality through natural toxic cyanogen and the production of unpleasant odour [4]. Over 55.0% of the waste produced from cassava processing is disposed of in dumping sites, creating both environmental pollution and negative health impacts on the population in the neighbourhood of cassava processing facilities [5]."},{"index":2,"size":75,"text":"In Nigeria, cassava is mostly produced and processed by small-scale farmers at the family or village level [6]. Cassava farming provides livelihood opportunities for both men and women involved in its production and consumption cycle. Both males and females make significant labour contributions to the cassava industry, with each sex specialising in different tasks. Women are, however, the backbone of the agricultural sector, in that they account for 60% to 80% of farm labour [7]."},{"index":3,"size":72,"text":"Within the cassava industry, processing is a major contributor to environmental pollution [4]. This is so due to the massive waste generated during the processing stages. The available technology of processing cassava roots primarily involves peeling, washing, grating, fermenting, dewatering, frying, drying, and milling. Waste is often produced at each of these processing stages. The type and composition of the waste depend on the processing method and type of technology used [8]."},{"index":4,"size":138,"text":"Solid waste is unwanted solid material generated from residential, industrial or commercial activities in a given area [9]. It may be categorised according to its origin (domestic, industrial, commercial, construction, or institutional), its content (organic or inorganic), or its hazard potential (toxic, non-toxic, flammable, radioactive, infectious) [10]. Cassava waste is organic and exists in both solid and liquid forms. Peel is the first type of solid waste generated by cassava root-processing activities. Subsequently, when the peeled cassava roots are grated and dewatered, wastewater is obtained. After dewatering, the resultant semi-solid mass is sieved, and the ungrated fibre (chaff) is discarded as the final solid waste [11]. Cassava peel is the primary solid cassava waste that constitutes 20 to 25.0% of the weight of the roots [12,13]. The proportion of waste can be higher, especially during hand peeling [14]."},{"index":5,"size":131,"text":"Disposal of waste products resulting from cassava processing is often inadequate. This led to varying environmental and health hazards, causes a foul smell and an unattractive sight, and produces widespread environmental pollution at cassava processing sites [15]. Cassava waste from processing centres has contributed significantly to environmental contamination. About 75.0% of the cassava roots harvested in Africa are fermented, causing the release of cyanogenic compounds and other pollutants into farmlands, rivers, streams, and groundwater [16]. In Nigeria, cassava effluent is directed to streams, resulting in a reduction in water quality and loss of aquatic life owing to its toxic nature [16], while stagnant streams of effluent produce a strong offensive odour [17]. Dumpsites for solid waste and liquid effluent also breed insects and other organisms that lead to disease outbreak [18]."},{"index":6,"size":138,"text":"More than 60.0% of the rural population in Nigeria is engaged in cassava-based cottage industries, and millions of tonnes of cassava waste are produced [19]. Waste management has been a major challenge to processors, as wastes need to be managed and, if possible, re-utilized without causing any harm to the environment. Over 55.0% of the waste produced from cassava processing is dumped at tips near the processing sites, becomes landfill, and/or is burnt, thereby, posing a serious threat to the environment and constituting a health hazard to the processors [5]. Few cassava processors derive any financial benefit from cassava waste [5], while most of them lack either awareness or expertise regarding the conversion of waste to any form of useful resource. However, studies [13,20] have shown that agricultural waste can be profitably utilized and recycled without attendant externalities."},{"index":7,"size":35,"text":"Against this background, we conducted a study to examine the waste management approaches used by smallholder cassava processors, their willingness to pay for value-added solid-waste management solutions, and the factors that may influence their behaviour."},{"index":8,"size":34,"text":"The next section gives details of the theoretical framework of willingness to pay, including estimation methods. This is followed by a section on materials and methods, the study results and discussion, and finally conclusion."}]},{"head":"Theoretical Framework","index":2,"paragraphs":[{"index":1,"size":142,"text":"An essential component of every business transaction is willingness-to-pay (WTP) computation, in which buyers assess the maximum amount of financial resources they are willing to expend in exchange for the item being sold [21]. Willingness to pay is the maximum amount of money that a consumer would pay to enjoy an improvement in product quality [22]. Rodríguez et al. [23], defined it as \"the difference between consumers' surplus before and after adding or improving a given product attribute\" in monetary terms. In WTP surveys, a respondent is asked a series of structured questions that are designed to determine the maximum amount of money he or she is willing to pay for a product or service. Various tools are employed in measuring WTP. The three most common are the hedonic pricing method, the contingent valuation method (CVM), and the travel cost method [24,25]."},{"index":2,"size":123,"text":"Notwithstanding the debate regarding its underlying economic theory, the contingent valuation method (CVM) is considered superior and preferred to other methods because it deals with both use and non-use values [26]. It is a simple, flexible and non-market valuation method popular for cost-benefit analysis and environmental impact assessment [27,28]. The CVM involves asking sampled respondents directly whether they would be willing to pay or accept compensation for the change in preferences. The method has been adjudged to conform to the theoretical core of economics [28]. In general, we assume that person 'i' is willing to pay Y* i for training on improved cassava waste management, and that this payment is related to a set of the person's characteristics (X i ), so that:"},{"index":3,"size":55,"text":"Although Y* i is unobserved, it is assumed to lie within the bound of such person's willingness to pay, which is (Y i1 , Y i2 ). This interval is based on responses to a series of questions asked in the contingent valuation interview [29]. The likelihood of the person paying is, therefore, stated as:"},{"index":4,"size":18,"text":"This equation is the basis for the use of discrete choice models for estimating the contingency valuation method."}]},{"head":"Materials and Methods","index":3,"paragraphs":[]},{"head":"Study Area and Sampling Procedure","index":4,"paragraphs":[{"index":1,"size":203,"text":"This WTP study was carried out in three states (Edo, Kwara, and Ogun) within the humid forest and savannah zones of Nigeria (see Figure 1). A multi-stage sampling technique was used to select respondents for the research. The first stage was a purposive selection of the three states based on their high level of cassava production and processing [30]. The second stage was a random selection of two agricultural zones in each state. In the last stage, 75 respondents were randomly selected from each agricultural zone. A total of 450 copies of a questionnaire were administered to obtain information on demographic and socioeconomic characteristics of cassava processors, the quantity of waste produced, the waste management methods used, and the willingness of the processors to adopt and pay for financially-rewarding solid-waste management methods. Four hundred and three (403) copies of the questionnaire were used in the final analysis, while 47 were discarded because they contained incomplete information. Furthermore, three major technology research and extension institutions with waste management research mandate within the survey zones (humid and savannah) were purposively selected. Interviews were conducted with key informants in these institutions to identify the improved waste management technologies developed and available in the zones and Nigeria. "}]},{"head":"Estimation Methods","index":5,"paragraphs":[{"index":1,"size":36,"text":"The selected variables for this study comprised age, sex, marital status, education level, household size, years of experience, source of credit, and scale of operation. A complete description of these variables is presented in Table 1.  "}]},{"head":"Estimation Methods","index":6,"paragraphs":[{"index":1,"size":105,"text":"The selected variables for this study comprised age, sex, marital status, education level, household size, years of experience, source of credit, and scale of operation. A complete description of these variables is presented in Table 1. A logit model based on the cumulative probability function was adopted to determine the factors that influence current solid-waste management systems as well as the mean willingness to pay for a value-added solid-waste management system and the factors influencing processors' willingness to pay. This was because the model could deal with a dichotomous dependent variable. The approach for this model follows the one adopted by Yusuf et al. [31]."},{"index":2,"size":7,"text":"The logit model is specified as follows:"},{"index":3,"size":28,"text":"where y i represents the response of ith processor's willingness to pay for a value-added solid-waste management system, which is either 1 if yes or 0 if no."},{"index":4,"size":72,"text":"For the model to estimate the factors influencing current use of solid-waste management system; y i is the 'yes or no' response of the smallholder processor to each of the four systems (dumping, giving out free, selling wet and selling dry). B 0 is a constant; β 1 is the coefficient of the independent variables; while X i is the price that the ith processor stated for a value-added solid-waste management system."},{"index":5,"size":27,"text":"The mean willingness to pay of the smallholder cassava starch processors for improved solid-waste management was calculated using the formula adopted by [32] and is given by:"},{"index":6,"size":44,"text":"To assess the factors influencing processors' willingness to pay for an improved solid-waste management system, the processor's responses to the WTP question-1 if yes and 0 if no-were then regressed against the socioeconomic characteristics of each processor. The regression logit model is specified as:"},{"index":7,"size":44,"text":"where Y represents the processor's response to the WTP question, which is either 1 if yes or 0 if no; and Z i is equal to β 0 + β 1 X i . Transformed into a linearized form, the model is expressed as:"},{"index":8,"size":76,"text":"where Y is willingness to pay for improved waste management training, X 1 is sex (male = 0; female = 1), X 2 is household size (number), X 3 is quantity of cassava processed (kg), X 4 is processing experience in years, X 5 is years of education, X 6 is member of association (yes = 1, no = 0), and X 7 is awareness of value-added solid-waste management systems (yes = 1, no = 0)."}]},{"head":"Results and Discussion","index":7,"paragraphs":[]},{"head":"Summary of Description of Cassava Processors","index":8,"paragraphs":[{"index":1,"size":126,"text":"Table 1 presents the descriptive statistics of the respondents. The table shows that the majority (68.7%) of the interviewees were female. This result is similar to the results of [32,33], who revealed that female processors are in the majority in global cassava processing. This suggests that female processors would be predominant in the sector in the study areas. More than half of the processors fell within the age range of 46 to 65 years. The mean age of the respondents in the study was 48 years, which is similar to the mean age of cassava processors found by [34] in Ogun State. This shows that the majority of the respondents were of an active working age and may appreciate the opportunity to use value-added solid-waste management."},{"index":2,"size":141,"text":"On average, the processors had received approximately 7 years of education. Education is expected to increase awareness of the negative impact of solid waste on humans and the environment. The mean household size of the respondents was about six persons. This is in line with the findings of [34], where the average household size for a cassava farmer in Ogun State is seven. Most (83.3%) of the respondents owned their processing centres and over half (57.0%) had used their own funds to establish their enterprises. In terms of the scale of operation, the study showed that 62.3% of the respondents' processed 1 to 10 tonnes of cassava roots monthly. In addition, liquid waste consisting of suspensions of starch, solid materials, and cyanogenic cassava compounds was produced and released into the surrounding channels, streams, and rivers, thereby, causing major environmental pollution [35][36][37]."}]},{"head":"Summary of Solid Waste Produced by Cassava Processors","index":9,"paragraphs":[{"index":1,"size":242,"text":"This section presents the summary of the two main solid wastes-peel and chaff-identified in the study. The result presented in Table 2 revealed that an average of 737 ± 954 kg and 511 ± 561 kg of peel was generated per processor during the high and low processing seasons, respectively; while an average of 141 ± 131 kg and 94 ± 92 kg of chaff was produced per processor during the same respective periods. About half (50.4%) of the processors generated up to 500 kg of cassava peel per month during the peak season; while almost 45.0% of them produced 500 to 1500 kg per month during this period. During the low season, nearly 64.0% produced up to 500 kg of cassava peel per month and about 35.0% generated 500 to 1500 kg per month. Similarly, 84.0% and 69.8% of the cassava processors produced up to 150 kg of cassava chaff per month during the high and low seasons, respectively. In addition, 21.4% and 14.8% of the processors generated 300 kg and 151 kg of chaff during the high and low processing seasons, respectively. The low processing season was from October to March, while the high processing season was from April to September. In this section, we present the summary of different cassava solid-waste management systems currently in use by the cassava processors (Table 3). We also isolate the factors that determined the use of each of the systems identified (Table 4)."}]},{"head":"Summary of Current Cassava Solid-Waste Management Systems Used","index":10,"paragraphs":[{"index":1,"size":71,"text":"Waste management practices varied across the processing centres, and the processors utilised one or more waste management practices. Four management practices were identified as commonly used by the processors (see Table 3). These were dumping, gifting, selling wet waste, and selling dry waste. The processors could adopt one or more of these options, but a greater percentage of them (59.6%) dumped their waste or passed it on as a gift (58.1%)."},{"index":2,"size":522,"text":"In most community cassava-processing centres, cassava waste dumps are often a source of environmental pollution and a danger to aquatic animals, plants, and humans. A study conducted by Anikwe and Nwobodo [38] in southeastern Nigeria revealed that there were differences in soil particle size distribution between municipal dump and non-dump sites used for urban agriculture. Soil bulk density was lower, by 9 to 13.0%, while total porosity and hydraulic conductivity were higher, by 9 to 14.0% and 240 to 463.0%, respectively, at the dump sites compared with the non-dump sites. Similarly, the study by Arimoro et al. [39] on the effect of cassava effluents on macroinvertebrates downstream showed that cassava effluents caused a decrease in dissolved oxygen and pH and an increase in biochemical demand (BOD) and nitrates from the samples taken from three stations along the Orogodo River course (upstream of the cassava-impacted site, at the cassava-impacted site, and downstream of the cassava-impacted site) in the Niger Delta. In addition, another study by Izugbara and Umoh [40] on indigenous waste management practices in urban Nigeria, revealed careful waste segregation and sorting, selective burning and burying, composting and conversion as some of the common indigenous waste management practices used by the sampled respondents. In addition, a small percentage of the respondents sold the solid waste in fresh (27.8%) or dry (35.5%) form. After identifying the current waste management systems in use by smallholder cassava processors, the study examined the factors that determined the use of these systems. The results for each management system in use by the cassava processors are presented in Table 4. The likelihood ratios were significant at 1% across the four waste management systems in use. The result also indicated that the likelihood of using dumping as a waste management system increased significantly with the quantity of cassava processed (marginal scale) and the processors who produced fufu (27.8%) and garri (36.7%). However, an increase in cooperative/partnership ownership structure rather than sole ownership and being resident in Kwara State reduced the likelihood of dumping. This implies that processors of a large quantity of cassava and those engaged in the production of fufu and garri may have found the dumping system more useful than any other waste management system for getting rid of their solid waste. However, this may not be true for processors residing in Kwara state who had a lower preference for the use of dumping as indicated by the negative sign associated with Kwara state location variable. The information obtained from the respondents in Kwara State [41] revealed that over 54.0% of the processors dispose of solid waste through the three other forms of waste management systems (giving out free, selling dry and selling wet) particular to those who rear animals, while only 13.0% used the dumping waste management system. The processors in cooperative/partnership ownership may also not have sole decision-making power in determining the use to which solid waste is put in the processing concern. This finding is in contrast with Olukanni and Olatunji [13], that found dumping as the most common waste management system used by over 90.0% of the cassava processors in Ogun State, Nigeria."},{"index":3,"size":204,"text":"The likelihood of giving solid waste out free increased significantly with being female (1.3%), cooperative/partnership ownership structure rather than sole producer (1.1%), residency in Ogun State (27.3%), production of garri (50.0%) and lafun (15.6%). Furthermore, the likelihood of selling cassava solid waste in a wet form significantly increased with years of experience (0.6%), membership of association (10.0%), cooperative/partnership ownership structure (32.7%) and residency in Kwara State (13.8%). However, it reduced significantly for the processors resident in Ogun State (14.3%). Similar results were obtained by Ekere et al. [42] who found that gender, peer influence, land size, location of household and membership of environmental organisations explain household waste utilisation and separation behaviour. In addition, a study conducted by Sackey and Bani [5] found that three-quarters of the cassava processors in the selected districts of Ghana gave cassava peels out freely to feed ruminants, while the rest one-quarter disposed of it by dumping in open areas. The likelihood of selling of cassava solid waste in dry form increased with the quantity of cassava produced, albeit on a very small scale (4.45 × 10 −6 ) and with residency in Kwara State (11.4%). However, it reduced with being resident in Ogun State (11.0%) and producing fufu (20.8%)."}]},{"head":"Willingness to Pay for Improved Waste Management Systems","index":11,"paragraphs":[{"index":1,"size":352,"text":"There are improved waste management systems that enable processors to make such value-added products as mushrooms, feed, ethanol, biofuel, and organic manure from cassava waste. The products generated from improved waste hold promise for environmental preservation and income generation for the cassava processors. As captured in Table 5, 61.8% of the processors indicated a willingness to pay for training in converting cassava waste into organic manure, while 56.3% indicated a willingness to pay for training in mushroom production. Similar results were obtained by Odediran and Ojebiyi [32], who found that most of the cassava processors at a technology demonstration in Ogun State were willing to adopt the technology to produce mushrooms from cassava waste. In addition, following [31], the coefficient of the price of processors willing to pay for value-added solid-waste management (β 1 ) was found to be positive for both types of training, thus, suggesting that the processors were willing to pay (see Table 6). The estimated mean value of WTP was 504.63 ($3.00) for training on production of mushrooms from cassava waste and 159.15 ($1.00) for training on converting cassava waste into organic manure. Organic manure from cassava peel is not often used by the farmers in the study areas. Thus, the processors are not motivated to invest in producing manure since they believe the product will be difficult to sell. Furthermore, the use of cassava waste to produce mushrooms has limitations in the study area because mushrooms are not a staple food in Nigeria but more of a luxury food item [43]. Moreover, most of the processors interviewed believed that additional production activity around cassava peel would be time-consuming and distract them from their main processing activities. In many study areas, wild-mushroom hunting is common among women, youths, and children [44,45]. This decreases the importance of mushroom production from cassava waste for the processors. Therefore, it could be inferred that the considerable low WTP estimates for training on conversion of waste to economic use via manure and mushroom production can be attributed to the lack of awareness of the benefits of these two products within the study communities."}]},{"head":"Determinants of Willingness to for Improved Solid-Waste Management System","index":12,"paragraphs":[{"index":1,"size":16,"text":"Table 7 presents the results of factors affecting WTP for the above-mentioned two types of training."},{"index":2,"size":335,"text":"Concerning training on mushroom production, the results revealed that the model was significant at 1%, while the McFadden's R squared (pseudo R 2 ) equalled 18.8%. The model coefficients revealed that processor's sex had a positive and significant relationship on WTP for the training, suggesting that the female gender increases the likelihood of WTP for the training by about 0.14. Similarly, the significance of household size, large scale of operation and awareness of new management system at 5% suggest that these variables are likely to increase the WTP for mushroom cultivation training by about 0.03, 0.15 and 0.32, respectively. The significance of the variable on awareness of new management systems is contrary to the conclusion of Odediran and Ojebiyi [32], who reported that there was no significant relationship between their respondents' awareness of cassava waste utilisation technologies and the WTP for them. The indication is that awareness of new management systems would likely increase the WTP for mushroom production training by a probability of about 0.32. Conversely, the quantity of cassava processed, though significant at 1%, had an opposing sign, thus, suggesting the variable's likelihood to decrease WTP by not too obvious a margin. However, the decrease in WTP associated with the quantity of cassava produced may be restricted to small-scale cassava processors. The positive significance of the variable on large-scale operation processor seems to suggest that this group of processors will be more disposed to participating in mushroom training than their small-scale operation counterparts. The model on processors' willingness to pay for training on organic manure was significant at 1%, while the McFadden's R squared (pseudo R 2 ) equalled 13.9%. Concerning the individual variables, the sex of processors had a positive relationship, with the WTP for organic manure training and was highly significant. This suggests that female respondents were more likely to be willing to pay for organic manure production training than their male counterparts. A unit increase in the household size equally increased the probability of WTP for the training by 0.03."},{"index":3,"size":124,"text":"The significance of both awareness of new waste management systems and years of processors' education seems to indicate their importance in increasing the likelihood of WTP for this training by about 0.43 and 0.01, with the former likely to have more effect. Despite the marginal effect associated with years of education, its relevance cannot be sidelined. This is because processors with higher level/increased years of education are better exposed/accommodative to new technologies and, hence, are more likely to better appreciate the benefits to be derived from the use of organic manure, particularly on environmental and health grounds. This result is consistent with that of [45][46][47], who found persons with a higher level of education more willing to pay for solid waste disposal management services."},{"index":4,"size":142,"text":"However, the relationship between the quantity of cassava processed and WTP for training in organic manure production was found to be negatively significant and with lesser effect. This indicates that any increase in the amount of cassava processed is likely to decrease the WTP for training in organic manure production. This is contrary to expectation, given the fact that those with a larger quantity of cassava to process should be the ones with more interest in finding alternative ways of disposing of solid waste, particularly if such processes will bring additional income. The observed result may arise if the processors do not find organic manure training an attractive/relevant measure for addressing their large solid waste concern. Moreover, as earlier stated, most processors believed that the additional production activities around cassava peel are time-consuming and would distract them from their main processing activities."}]},{"head":"Conclusions","index":13,"paragraphs":[{"index":1,"size":158,"text":"The study examined the willingness to pay for value-added solid-waste management systems among 403 cassava processors in the humid forest and Guinea savannah zones of Nigeria. The study showed that the solid-waste management practices currently in use by the cassava processors are dumping, gifting, and selling solid waste in wet and dry forms. The factors influencing the processor's decision on the type of waste management system were observed to include gender, membership of association, quantity of cassava processed and ownership structure. Two value-added solid-waste management options (organic manure and mushroom production) were introduced to the cassava processors, and more than half of them were willing to pay for acquiring the knowledge to use them. The factors positively influencing the WTP for expertise on conversion of solid waste to organic manure were female gender, household size, years of education, and awareness of the new options, while a possible increase in the quantity of cassava processed negatively influenced the WTP."},{"index":2,"size":141,"text":"Similarly, while gender, household size and awareness of the new options positively influenced the willingness to pay for training in mushroom production, a possible increase in the quantity of cassava processed negatively influenced the WTP. While large quantities of waste are generated during both the high and low processing seasons, which can create significant environmental and human health hazards in the short run and in the long run, processors were willing to pay only a small amount of money to learn new methods of profitably disposing of the waste. This finding could be due to insufficient hygiene regulations and enforcement by the local authorities at cassava processing centres, which means that the processors had never been made to pay for waste disposal. Such circumstances decrease the processors' willingness to pay adequate amounts for training in new waste conversion or disposal methods."},{"index":3,"size":93,"text":"Therefore, based on the findings of this study, it is recommended that sensitisation and subsidised training of processors in the benefits of safe waste conversion and disposal and in various new options for value-added management of solid waste should be intensified to encourage and enable cassava processors to manage agro-based waste safely. The large amount of waste generated by each processor shows the need for environmental hygiene protocols to be developed and enforced at community cassava processing centres. At the same time, the market for value-added agro-based waste products should be vigorously expanded."}]}],"figures":[{"text":"Figure 1 . Figure 1. Map of Nigeria showing study areas. "},{"text":"Figure 1 . Figure 1. Map of Nigeria showing study areas. "},{"text":"Table 1 . Descriptive Statistics of the Respondents. Characteristics Percentage Characteristics Percentage Sex Level of education (years)  Female 68.7 ≤10 67.5 Female68.7≤1067.5 Male 31.3 11-20 32.5 Male31.311-2032.5 Age (years)  Type of education  Age (years)Type of education <30 3.2 No formal education 16.6 <303.2No formal education16.6 31-45 40.2 Arabic education 3.7 31-4540.2Arabic education3.7 46-65 53.6 Adult education 2.2 46-6553.6Adult education2.2 >66 13.0 Primary education 39.7 >6613.0Primary education39.7 Marital status  Secondary education 28.5 Marital statusSecondary education28.5 Single 3.0 Tertiary education 9.2 Single3.0Tertiary education9.2 Married 90.6 Source of finance  Married90.6Source of finance Divorced 2.7 Commercial bank 1.6 Divorced2.7Commercial bank1.6 Widowed 3.3 Cooperative society 21.8 Widowed3.3Cooperative society21.8 Household size  Money lender 7.9 Household sizeMoney lender7.9 1-5 36.7 Produce buyer 3.6 1-536.7Produce buyer3.6 6-10 59.3 Friends/family 18.5 6-1059.3Friends/family18.5 11-15 4.0 Self 57.0 11-154.0Self57.0 Scale of operation    Scale of operation <1 tonne 18.6 Ownership structure  <1 tonne18.6Ownership structure 1-10 tonne 62.3 Sole 83.3 1-10 tonne62.3Sole83.3 11-20 tonne 8.9 Partnership 8.7 11-20 tonne8.9Partnership8.7 >20 tonne 10.2 Cooperative 8.0 >20 tonne10.2Cooperative8.0  "},{"text":"Table 1 . Descriptive Statistics of the Respondents. Characteristics Percentage Characteristics Percentage CharacteristicsPercentageCharacteristicsPercentage Sex  Level of education (years)  SexLevel of education (years) Female 68.7 ≤10 67.5 Female68.7≤1067.5 Male 31.3 11-20 32.5 Male31.311-2032.5 Age (years)  Type of education  Age (years)Type of education <30 3.2 No formal education 16.6 <303.2No formal education16.6 31-45 40.2 Arabic education 3.7 31-4540.2Arabic education3.7 46-65 53.6 Adult education 2.2 46-6553.6Adult education2.2 >66 13.0 Primary education 39.7 >6613.0Primary education39.7 Marital status  Secondary education 28.5 Marital statusSecondary education28.5 Single 3.0 Tertiary education 9.2 Single3.0Tertiary education9.2 Married 90.6 Source of finance  Married90.6Source of finance Divorced 2.7 Commercial bank 1.6 Divorced2.7Commercial bank1.6 Widowed 3.3 Cooperative society 21.8 Widowed3.3Cooperative society21.8 Household size  Money lender 7.9 Household sizeMoney lender7.9 1-5 36.7 Produce buyer 3.6 1-536.7Produce buyer3.6 6-10 59.3 Friends/family 18.5 6-1059.3Friends/family18.5 11-15 4.0 Self 57.0 11-154.0Self57.0 Scale of operation    Scale of operation <1 tonne 18.6 Ownership structure  <1 tonne18.6Ownership structure 1-10 tonne 62.3 Sole 83.3 1-10 tonne62.3Sole83.3 11-20 tonne 8.9 Partnership 8.7 11-20 tonne8.9Partnership8.7 >20 tonne 10.2 Cooperative 8.0 >20 tonne10.2Cooperative8.0  "},{"text":"Table 2 . Quantity of Solid Wastes Produced. Quantity of Waste (kg/Processor/Month) High Season (%) Low Season (%) Quantity of Waste (kg/Processor/Month)High Season (%)Low Season (%) Peel (n = 403)   Peel (n = 403) <500 50.4 63.8 <50050.463.8 501-1000 30.8 30.9 501-100030.830.9 1001-1500 14.6 4.1 1001-150014.64.1 >1500 4.2 1.1 >15004.21.1 Average waste in peels 737 ± 954 511 ± 561 Average waste in peels737 ± 954511 ± 561 Chaff (n = 192)   Chaff (n = 192) <150 69.8 84.0 <15069.884.0 151-300 21.4 14.8 151-30021.414.8 >300 8.9 1.2 >3008.91.2 Average waste in chaff 141 ± 131 94 ± 92 Average waste in chaff141 ± 13194 ± 92 4.3. Current Solid-Waste Management Systems Used by Cassava Processors  4.3. Current Solid-Waste Management Systems Used by Cassava Processors  "},{"text":"Table 3 . Solid-Waste Management Options Used. Waste Management Practices (n = 403) Percentage of \"Yes\" Responses Waste Management Practices (n = 403)Percentage of \"Yes\" Responses Dumping 59.6 Dumping59.6 Giving out free 58.1 Giving out free58.1 Selling wet waste 27.8 Selling wet waste27.8 Selling dry waste 35.5 Selling dry waste35.5 4.3.2. Estimates of the Determinants of Current Cassava Solid-Waste Management Systems 4.3.2. Estimates of the Determinants of Current Cassava Solid-Waste Management Systems  "},{"text":"Table 4 . Estimates of Determinants of the Current Cassava Solid-Waste Management System Used by the Cassava Processors.   Dumping   Giving out Freely   Selling Wet   Selling Dry  DumpingGiving out FreelySelling WetSelling Dry Variables Coeff. Std. Err. Marginal Effect Coeff. Std. Err. Marginal Effect Coeff. Std. Err. Marginal Effect Coeff. Std. Err. Marginal Effect VariablesCoeff.Std. Err.Marginal EffectCoeff.Std. Err.Marginal EffectCoeff.Std. Err.Marginal EffectCoeff.Std. Err.Marginal Effect Sex (female = 1) 0.122 0.329 0.073 0.530 ** 0.245 0.133 −0.112 0.298 −0.050 −0.378 0.259 −0.103 Sex (female = 1)0.1220.3290.0730.530 **0.2450.133−0.1120.298−0.050−0.3780.259−0.103 Household size 0.073 0.683 −0.007 −0.053 0.051 −0.014 0.038 0.060 0.002 −0.009 0.054 −0.007 Household size0.0730.683−0.007−0.0530.051−0.0140.0380.0600.002−0.0090.054−0.007 Quantity of cassava processed 0.40 × 10 −4 ** 0.19 × 10 −4 2.26 × 10 −6 −7.06 × 10 −6 0.11 × 10 −4 −1.52 × 10 −6 −1.31 × 10 −5 1.26 × 10 −5 −4.78 × 10 −6 3.28 × 10 −5 ** 0.14 × 10 −5 4.45 × 10 −6 Quantity of cassava processed 0.40 × 10 −4 **0.19 × 10 −42.26 × 10 −6−7.06 × 10 −60.11 × 10 −4−1.52 × 10 −6−1.31 × 10 −51.26 × 10 −5−4.78 × 10 −63.28 × 10 −5 **0.14 × 10 −54.45 × 10 −6 Year of experience −0.012 0.016 −0.002 −0.012 0.013 −0.003 0.041 *** 0.015 0.006 0.006 0.013 0.001 Year of experience−0.0120.016−0.002−0.0120.013−0.0030.041 ***0.0150.0060.0060.0130.001 Member of association −0.382 0.311 −0.110 −0.091 0.235 −0.025 0.560 ** 0.296 0.100 0.225 0.255 0.072 Member of association−0.3820.311−0.110−0.0910.235−0.0250.560 **0.2960.1000.2250.2550.072 Ownership structure (coop/partnership = 1) −0.688 * 0.396 −0.269 0.533 * 0.317 0.113 1.287 *** 0.342 0.327 0.324 0.317 0.156 Ownership structure (coop/partnership = 1)−0.688 *0.396−0.2690.533 *0.3170.1131.287 ***0.3420.3270.3240.3170.156 State of location (Kwara = 1) −3.910 *** 0.484 0.077 0.427 0.328 0.165 1.567 0.373 −0.138 1.512 *** 0.355 0.114 State of location (Kwara = 1)−3.910 ***0.4840.0770.4270.3280.1651.5670.373−0.1381.512 ***0.3550.114 State of location (Ogun = 1) 0.337 0.468 0.044 1.340 *** 0.350 0.273 −1.305 0.456 −0.143 −0.684 * 0.388 −0.110 State of location (Ogun = 1)0.3370.4680.0441.340 ***0.3500.273−1.3050.456−0.143−0.684 *0.388−0.110 Producing starch −0.778 ** 0.312 −0.022 0.440 0.282 0.110 0.007 0.337 0.050 −0.476 0.301 −0.133 Producing starch−0.778 **0.312−0.0220.4400.2820.1100.0070.3370.050−0.4760.301−0.133 Producing fufu 0.874 *** 0.387 0.278 0.313 0.243 0.088 −0.245 0.282 −0.123 −0.622 ** 0.253 −0.208 Producing fufu0.874 ***0.3870.2780.3130.2430.088−0.2450.282−0.123−0.622 **0.253−0.208 Producing gari 0.977 * 0.554 0.367 2.345 *** 0.467 0.500 −0.615 0.465 0.234 0.308 0.452 −0.054 Producing gari0.977 *0.5540.3672.345 ***0.4670.500−0.6150.4650.2340.3080.452−0.054 Producing lafun 0.170 0.387 0.200 0.752 * 0.305 0.156 −0.458 0.350 0.078 −0.293 0.308 0.068 Producing lafun0.1700.3870.2000.752 *0.3050.156−0.4580.3500.078−0.2930.3080.068 Constant 0.948 0.887  −2.636 *** 0.695  −1.403 * 0.768  −0.970 0.763  Constant0.9480.887−2.636 ***0.695−1.403 *0.768−0.9700.763  Number of obs. = 403 Number of obs. = 403 Number of obs. = 403 Number of obs. = 403  Number of obs. = 403Number of obs. = 403Number of obs. = 403Number of obs. = 403  Likelihood = −158.04  likelihood= −239.26   Likelihood = −178.31  Likelihood = −214.43  Likelihood = −158.04likelihood= −239.26Likelihood = −178.31Likelihood = −214.43  Prob >chi2 = 0.0000   Prob >chi2 = 0.0000   Prob >chi2 = 0.0000   Prob >chi2 = 0.0000  Prob >chi2 = 0.0000Prob >chi2 = 0.0000Prob >chi2 = 0.0000Prob >chi2 = 0.0000   Pseudo R 2 = 0.418   Pseudo R 2 = 0.127   Pseudo R 2 = 0.251   Pseudo R 2 = 0.182  Pseudo R 2 = 0.418Pseudo R 2 = 0.127Pseudo R 2 = 0.251Pseudo R 2 = 0.182  LR chi2(12) = 64.33   LR chi2(12) = 69.14   LR chi2(12) = 56.52   LR chi2(11) = 44.66  LR chi2(12) = 64.33LR chi2(12) = 69.14LR chi2(12) = 56.52LR chi2(11) = 44.66  Marginal effect Y = 0.6077 Marginal effect Y = 0.5911 Marginal effect Y = 0.2485 Marginal effect Y = 0.3374 Marginal effect Y = 0.6077Marginal effect Y = 0.5911Marginal effect Y = 0.2485Marginal effect Y = 0.3374  "},{"text":"Table 5 . Responses of the Cassava Processors on Willingness to Pay for Improved Waste Management Systems. Willingness to Pay (n = 403) Percentage of \"Yes\" Responses Willingness to Pay (n = 403)Percentage of \"Yes\" Responses Conversion of cassava waste to organic manure 61.8 Conversion of cassava waste to organic manure61.8 Production of mushrooms from cassava waste 56.3 Production of mushrooms from cassava waste56.3  "},{"text":"Table 6 . Mean Willingness to Pay for Training in Organic Manure and Mushroom Production from Cassava Waste.  "},{"text":"Organic Manure Production from Cassava Waste Variable Coeff. Std. Err. Z-Stat. p-Value  Constant −1.7472 0.2330 −7.50 0.0000 Constant−1.74720.2330−7.500.0000 Price (β 1 ) 0.0011 0.0001 7.73 0.0000 Price (β 1 )0.00110.00017.730.0000  Number of obs. = 403  Number of obs. = 403  LR chi2(1) = 211.87   LR chi2(1) = 211.87  Prob>chi2 = 0.0000   Prob>chi2 = 0.0000  Pseudo R 2 = 0.3952   Pseudo R 2 = 0.3952  Log likelihood = −162.10  Log likelihood = −162.10  Mean willingness to pay = 159.15  Mean willingness to pay = 159.15 Mushroom Production from Cassava Waste  Mushroom Production from Cassava Waste Variable Coeff. Std. Err. Z-Stat. p-Value VariableCoeff.Std. Err.Z-Stat.p-Value Constant −1.1631 0.1835 −6.34 0.0000 Constant−1.16310.1835−6.340.0000 Price (β 1 ) 0.0005 0.0001 7.48 0.0000 Price (β 1 )0.00050.00017.480.0000  Number of obs. = 403  Number of obs. = 403  LR chi2(1) = 134.97   LR chi2(1) = 134.97  Prob >chi2 = 0.0000  Prob >chi2 = 0.0000   Pseudo R 2 = 0.244   Pseudo R 2 = 0.244  Log likelihood = −208.62  Log likelihood = −208.62  Mean willingness to pay = 540.63  Mean willingness to pay = 540.63  "},{"text":"Table 7 . Factors Influencing the Willingness to Pay for Training in New Solid-Waste Management Options.  Organic Manure  Mushroom Production Organic ManureMushroom Production Variable Coeff. Std. Err. Marginal Effect Coeff. Std. Err. Marginal Effect VariableCoeff.Std. Err.Marginal EffectCoeff.Std. Err.Marginal Effect Sex (female = 1) 0.604 ** 0.258 0.137 0.556 ** 0.246 0.136 Sex (female = 1)0.604 **0.2580.1370.556 **0.2460.136 Household size 0.143 *** 0.055 0.032 0.110 ** 0.052 0.027 Household size0.143 ***0.0550.0320.110 **0.0520.027 Quantity of cassava processed −5.08 × 10 −5 *** 1.15 × 10 −5 −1.15 × 10 −5 −7.83 × 10 −5 *** 1.171 × 10 −5 −1.92 × 10 −5 Quantity of cassava processed−5.08 × 10 −5 ***1.15 × 10 −5−1.15 × 10 −5−7.83 × 10 −5 ***1.171 × 10 −5−1.92 × 10 −5 Scale of operation (large scale = 1) 0.135 0.279 0.025 0.601 ** 0.267 0.148 Scale of operation (large scale = 1)0.1350.2790.0250.601 **0.2670.148 Ownership structure (Coop/partnership = 1) −0.353 0.327 −0.081 −0.167 0.308 −0.041 Ownership structure (Coop/partnership = 1)−0.3530.327−0.081−0.1670.308−0.041 Years of experience −0.002 0.013 −0.001 −0.001 0.013 −0.001 Years of experience−0.0020.013−0.001−0.0010.013−0.001 Year of education 0.049 ** 0.026 0.011 0.039 0.025 0.009 Year of education0.049 **0.0260.0110.0390.0250.009 Member of association −0.354 0.247 −0.079 −0.148 0.234 −0.036 Member of association−0.3540.247−0.079−0.1480.234−0.036 Awareness of new management system 2.112 *** 0.276 0.426 1.396 *** 0.240 0.324 Awareness of new management system2.112 ***0.2760.4261.396 ***0.2400.324 Constant −1.379 0.557  −1.407 0.531  Constant−1.3790.557−1.4070.531  Number of obs. = 403  Number of obs. = 403  Number of obs. = 403Number of obs. = 403  LR chi2(10) = 100.99  LR chi2 (10) = 76.97  LR chi2(10) = 100.99LR chi2 (10) = 76.97  Prob >chi2 = 0.0000  Prob >chi2 = 0.0000  Prob >chi2 = 0.0000Prob >chi2 = 0.0000  Pseudo R 2 = 0.188  Pseudo R 2 = 0.1394  Pseudo R 2 = 0.188Pseudo R 2 = 0.1394  Log likelihood = −217.54 Log likelihood = −237.62 Log likelihood = −217.54Log likelihood = −237.62  Marginal effect after logit Y = 0.6541 Marginal effect after logit Y = 0.5678 Marginal effect after logit Y = 0.6541Marginal effect after logit Y = 0.5678 ***, and ** denote 1%, and 5% significant levels, respectively.   ***, and ** denote 1%, and 5% significant levels, respectively.  "}],"sieverID":"8c17fbaa-c5ee-4dd8-bc5a-dc106d610f38","abstract":"The paper examined the willingness of smallholder cassava processors to pay for value-added solid wastes management solutions in Nigeria. We employed a multistage sampling procedure to obtain primary data from 403 cassava processors from the forest and Guinea savannah zones of Nigeria. Contingent valuation and logistic regression were used to determine the willingness of the processors to pay for improved waste management options and the factors influencing their decision on the type of waste management system adopted and willingness to pay for a value-added solid-waste management system option. Women constituted the largest population of smallholder cassava processors, and the processors generated a lot of solid waste (605-878 kg/processor/season). Waste was usually dumped (59.6%), given to others (58.1%), or sold in wet (27.8%) or dry (35.5%) forms. The factors influencing the processors' decision on the type of waste management system to adopt included sex of processors, membership of an association, quantity of cassava processed and ownership structure. Whereas the processors were willing to pay for new training on improved waste management technologies, they were not willing to pay more than US$3. However, US$3 may be paid for training in mushroom production. It is expected that public expenditure on training to empower processors to use solid-waste conversion technologies for generating value-added products will lead to such social benefits as lower exposure to environmental toxins from the air, rivers and underground water, among others, and additional income for the smallholder processors. The output of the study can serve as the basis for developing usable and affordable solid-waste management systems for community cassava processing units in African countries involved in cassava production."}