--- tags: - dnabert - bacteria - kmer - classification - sequence-modeling library_name: transformers --- # BacteriaCDS-DNABERT-K6-89M This model, `BacteriaCDS-DNABERT-K6-89M`, is a **DNA sequence classifier** based on **DNABERT** trained for **coding sequence (CDS) classification** in bacterial genomes. It operates on **6-mer tokenized sequences** and was fine-tuned using **89M trainable parameters**. ## Model Details - **Base Model:** DNABERT - **Task:** Bacterial CDS Classification - **K-mer Size:** 6 - **Input Sequence:** Open Reading Frame(Last 510 nucleotides from end of the sequence) - **Number of Trainable Parameters:** 89M - **Max Sequence Length:** 512 - **Precision Used:** AMP (Automatic Mixed Precision) --- ### **Install Dependencies** Ensure you have `transformers` and `torch` installed: ```bash pip install torch transformers ``` ### **Load Model & Tokenizer** ```python import torch from transformers import AutoModelForSequenceClassification, AutoTokenizer # Load Model model_checkpoint = "Genereux-akotenou/BacteriaCDS-DNABERT-K6-89M" model = AutoModelForSequenceClassification.from_pretrained(model_checkpoint) tokenizer = AutoTokenizer.from_pretrained(model_checkpoint) ``` ### **Inference Example** This model works with 6-mer tokenized sequences. You need to convert raw DNA sequences into k-mer format: ```python def generate_kmer(sequence: str, k: int, overlap: int = 1): return " ".join([sequence[j:j+k] for j in range(0, len(sequence) - k + 1, overlap)]) sequence = "ATGAGAACCAGCCGGAGACCTCCTGCTCGTACATGAAAGGCTCGAGCAGCCGGGCGAGGGCGGTAG" seq_kmer = generate_kmer(sequence, k=6, overlap=3) # Run inference inputs = tokenizer( seq_kmer, return_tensors="pt", max_length=tokenizer.model_max_length, padding="max_length", truncation=True ) with torch.no_grad(): outputs = model(**inputs) logits = outputs.logits predicted_class = torch.argmax(logits, dim=-1).item() ```